Starting /dee2/code/volunteer_pipeline.sh SRR12671030 current disk space = 3049780236288 free memory = 1578930264 SRR12671030 SRAfilesize 6a09298100dc77bed176ca758533ad03 SRR12671030.sra SRR12671030.sra file validated SRR12671030 is paired end SRR12671030 is conventional basespace SRR12671030 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671030_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.47325 37.0 37.0 37.0 37.0 37.0 2 36.3875 37.0 37.0 37.0 37.0 37.0 3 36.507 37.0 37.0 37.0 37.0 37.0 4 36.582 37.0 37.0 37.0 37.0 37.0 5 36.6255 37.0 37.0 37.0 37.0 37.0 6 36.579 37.0 37.0 37.0 37.0 37.0 7 36.5395 37.0 37.0 37.0 37.0 37.0 8 36.605 37.0 37.0 37.0 37.0 37.0 9 36.6045 37.0 37.0 37.0 37.0 37.0 10-14 36.61990000000001 37.0 37.0 37.0 37.0 37.0 15-19 36.578199999999995 37.0 37.0 37.0 37.0 37.0 20-24 36.5496 37.0 37.0 37.0 37.0 37.0 25-29 36.5317 37.0 37.0 37.0 37.0 37.0 30-34 36.4918 37.0 37.0 37.0 37.0 37.0 35-39 36.498599999999996 37.0 37.0 37.0 37.0 37.0 40-44 36.4687 37.0 37.0 37.0 37.0 37.0 45-49 36.4365 37.0 37.0 37.0 37.0 37.0 50-54 36.4123 37.0 37.0 37.0 37.0 37.0 55-59 36.3594 37.0 37.0 37.0 37.0 37.0 60-64 36.2887 37.0 37.0 37.0 37.0 37.0 65-69 36.2918 37.0 37.0 37.0 37.0 37.0 70-74 36.3317 37.0 37.0 37.0 37.0 37.0 75-79 36.2474 37.0 37.0 37.0 37.0 37.0 80-84 36.263799999999996 37.0 37.0 37.0 37.0 37.0 85-89 36.247400000000006 37.0 37.0 37.0 37.0 37.0 90-94 36.1832 37.0 37.0 37.0 37.0 37.0 95-99 36.1555 37.0 37.0 37.0 37.0 37.0 100-104 36.1533 37.0 37.0 37.0 37.0 37.0 105-109 36.0669 37.0 37.0 37.0 37.0 37.0 110-114 36.0494 37.0 37.0 37.0 37.0 37.0 115-119 36.0424 37.0 37.0 37.0 37.0 37.0 120-124 35.9683 37.0 37.0 37.0 37.0 37.0 125-129 35.9978 37.0 37.0 37.0 37.0 37.0 130-134 35.7931 37.0 37.0 37.0 37.0 37.0 135-139 35.840700000000005 37.0 37.0 37.0 37.0 37.0 140-144 35.8195 37.0 37.0 37.0 37.0 37.0 145-149 35.5716 37.0 37.0 37.0 37.0 37.0 150-151 35.494 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 2.0 22 1.0 23 0.0 24 2.0 25 1.0 26 8.0 27 13.0 28 16.0 29 26.0 30 29.0 31 47.0 32 54.0 33 77.0 34 117.0 35 277.0 36 2708.0 37 622.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.88622155538885 11.977994498624655 6.126531632908227 37.009252313078264 2 19.900000000000002 11.15 36.475 32.475 3 17.25 16.3 28.825 37.625 4 23.400000000000002 23.025000000000002 24.25 29.325000000000003 5 22.8 32.25 23.75 21.2 6 19.675 33.45 24.525 22.35 7 15.825 26.8 41.949999999999996 15.425 8 16.825000000000003 25.575 32.15 25.45 9 17.25 23.175 35.25 24.325 10-14 19.59 30.615 26.755000000000003 23.04 15-19 19.54 28.7 27.52 24.240000000000002 20-24 19.855 28.685 27.57 23.89 25-29 20.5 28.515 27.18 23.805 30-34 19.515 28.705000000000002 27.85 23.93 35-39 19.81 28.610000000000003 27.875 23.705000000000002 40-44 20.53 28.975 27.384999999999998 23.11 45-49 20.32 28.199999999999996 28.044999999999998 23.435 50-54 20.165 28.294999999999998 27.689999999999998 23.849999999999998 55-59 19.875 28.57 27.884999999999998 23.669999999999998 60-64 20.53 28.34 28.01 23.119999999999997 65-69 19.415 28.694999999999997 27.98 23.91 70-74 20.244999999999997 28.375 27.750000000000004 23.630000000000003 75-79 20.655 27.894999999999996 27.815 23.635 80-84 19.675 28.08 27.72 24.525 85-89 20.53 28.110000000000003 27.615000000000002 23.745 90-94 20.645 28.000000000000004 27.495000000000005 23.86 95-99 20.43 28.435 27.544999999999998 23.59 100-104 20.555 28.325 27.435 23.685000000000002 105-109 20.43 28.24 27.76 23.57 110-114 20.275000000000002 28.535 27.705000000000002 23.485 115-119 20.724999999999998 28.105000000000004 27.88 23.29 120-124 20.695 28.015 27.805000000000003 23.485 125-129 20.369999999999997 28.144999999999996 27.544999999999998 23.94 130-134 20.974999999999998 28.205000000000002 27.67 23.150000000000002 135-139 21.005 28.24 27.82 22.935 140-144 20.974999999999998 28.49 26.900000000000002 23.635 145-149 20.65 27.93 27.655 23.765 150-151 20.9 27.8125 27.737499999999997 23.549999999999997 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.5 13 0.5 14 0.5 15 1.5 16 1.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.5 23 3.5 24 6.5 25 5.0 26 4.0 27 4.5 28 11.0 29 15.5 30 14.5 31 28.0 32 37.5 33 47.5 34 61.0 35 70.0 36 87.5 37 99.5 38 117.5 39 145.0 40 179.0 41 202.0 42 238.5 43 268.0 44 258.0 45 261.5 46 261.5 47 237.0 48 223.0 49 209.5 50 176.5 51 145.0 52 119.0 53 97.0 54 89.0 55 64.0 56 50.5 57 50.5 58 29.0 59 15.5 60 10.5 61 15.0 62 15.0 63 6.5 64 2.5 65 3.0 66 1.5 67 2.0 68 2.0 69 0.5 70 0.0 71 0.5 72 0.5 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.175 #Duplication Level Percentage of deduplicated Percentage of total 1 92.13452671548684 84.925 2 7.268782207756984 13.4 3 0.5695687550854354 1.575 4 0.027122321670735017 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0125 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.30000000000000004 0.0 0.0 0.0 0.0 92-93 0.35 0.0 0.0 0.0 0.0 94-95 0.475 0.0 0.0 0.0 0.0 96-97 0.575 0.0 0.0 0.0 0.0 98-99 0.6625000000000001 0.0 0.0 0.0 0.0 100-101 0.7625 0.0 0.0 0.0 0.0 102-103 0.8875 0.0 0.0 0.0 0.0 104-105 0.925 0.0 0.0 0.0 0.0 106-107 1.0 0.0 0.0 0.0 0.0 108-109 1.0499999999999998 0.0 0.0 0.0 0.0 110-111 1.2625 0.0 0.0 0.0 0.0 112-113 1.4125 0.0 0.0 0.0 0.0 114-115 1.5625 0.0 0.0 0.0 0.0 116-117 1.675 0.0 0.0 0.0 0.0 118-119 1.9 0.0 0.0 0.0 0.0 120-121 2.0999999999999996 0.0 0.0 0.0 0.0 122-123 2.325 0.0 0.0 0.0 0.0 124-125 2.8375 0.0 0.0 0.0 0.0 126-127 3.175 0.0 0.0 0.0 0.0 128-129 3.5250000000000004 0.0 0.0 0.0 0.0 130-131 3.875 0.0 0.0 0.0 0.0 132-133 4.25 0.0 0.0 0.0 0.0 134-135 4.6 0.0 0.0 0.0 0.0 136-137 5.1125 0.0 0.0 0.0 0.0 138-139 5.625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12671030 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671030_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.1605 37.0 37.0 37.0 37.0 37.0 2 36.237 37.0 37.0 37.0 37.0 37.0 3 36.2265 37.0 37.0 37.0 37.0 37.0 4 36.202 37.0 37.0 37.0 37.0 37.0 5 36.22 37.0 37.0 37.0 37.0 37.0 6 36.2855 37.0 37.0 37.0 37.0 37.0 7 36.362 37.0 37.0 37.0 37.0 37.0 8 36.344 37.0 37.0 37.0 37.0 37.0 9 36.375 37.0 37.0 37.0 37.0 37.0 10-14 36.3748 37.0 37.0 37.0 37.0 37.0 15-19 36.333499999999994 37.0 37.0 37.0 37.0 37.0 20-24 36.2983 37.0 37.0 37.0 37.0 37.0 25-29 36.2347 37.0 37.0 37.0 37.0 37.0 30-34 36.19690000000001 37.0 37.0 37.0 37.0 37.0 35-39 36.166900000000005 37.0 37.0 37.0 37.0 37.0 40-44 36.1661 37.0 37.0 37.0 37.0 37.0 45-49 36.1763 37.0 37.0 37.0 37.0 37.0 50-54 36.1443 37.0 37.0 37.0 37.0 37.0 55-59 36.0831 37.0 37.0 37.0 37.0 37.0 60-64 36.096900000000005 37.0 37.0 37.0 37.0 37.0 65-69 36.140100000000004 37.0 37.0 37.0 37.0 37.0 70-74 36.0513 37.0 37.0 37.0 37.0 37.0 75-79 36.01090000000001 37.0 37.0 37.0 37.0 37.0 80-84 36.0111 37.0 37.0 37.0 37.0 37.0 85-89 35.9498 37.0 37.0 37.0 37.0 37.0 90-94 36.009699999999995 37.0 37.0 37.0 37.0 37.0 95-99 36.0197 37.0 37.0 37.0 37.0 37.0 100-104 35.9971 37.0 37.0 37.0 37.0 37.0 105-109 35.9274 37.0 37.0 37.0 37.0 37.0 110-114 35.9029 37.0 37.0 37.0 37.0 37.0 115-119 35.8898 37.0 37.0 37.0 37.0 37.0 120-124 35.7783 37.0 37.0 37.0 37.0 37.0 125-129 35.7202 37.0 37.0 37.0 37.0 37.0 130-134 35.7469 37.0 37.0 37.0 37.0 37.0 135-139 35.6998 37.0 37.0 37.0 37.0 37.0 140-144 35.63590000000001 37.0 37.0 37.0 37.0 37.0 145-149 35.416399999999996 37.0 37.0 37.0 37.0 37.0 150-151 35.119749999999996 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 5.0 14 2.0 15 5.0 16 0.0 17 2.0 18 2.0 19 0.0 20 2.0 21 5.0 22 3.0 23 4.0 24 6.0 25 11.0 26 8.0 27 20.0 28 17.0 29 15.0 30 33.0 31 29.0 32 53.0 33 77.0 34 151.0 35 354.0 36 2645.0 37 551.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.375 24.2 8.9 23.525 2 27.450000000000003 25.25 31.6 15.7 3 21.45 27.025 32.725 18.8 4 25.45 33.125 22.650000000000002 18.775 5 25.8 38.025 19.925 16.25 6 22.8 39.625 20.125 17.45 7 21.224999999999998 23.0 37.25 18.525 8 21.075 25.95 28.849999999999998 24.125 9 21.875 25.55 30.625000000000004 21.95 10-14 23.415 28.865000000000002 26.32 21.4 15-19 23.35 28.03 28.24 20.380000000000003 20-24 23.0 27.975 28.199999999999996 20.825 25-29 23.11 27.85 28.325 20.715 30-34 23.215 27.735 27.96 21.09 35-39 23.16 27.725 28.134999999999998 20.979999999999997 40-44 22.345000000000002 27.985 28.665000000000003 21.005 45-49 22.53 28.23 27.834999999999997 21.404999999999998 50-54 22.99 28.24 27.865000000000002 20.905 55-59 22.82 28.285 27.944999999999997 20.95 60-64 22.785 28.199999999999996 27.82 21.195 65-69 23.79 27.750000000000004 27.575 20.885 70-74 23.74 27.775 27.395000000000003 21.09 75-79 23.585 28.249999999999996 27.33 20.835 80-84 23.36 28.895 27.12 20.625 85-89 23.485 27.560000000000002 28.205000000000002 20.75 90-94 23.494999999999997 27.935 27.529999999999998 21.04 95-99 23.799999999999997 28.02 27.555000000000003 20.625 100-104 23.65 27.685 27.51 21.154999999999998 105-109 23.35 28.315 27.405 20.93 110-114 23.415 27.894999999999996 27.955000000000002 20.735 115-119 24.115000000000002 28.175 27.13 20.580000000000002 120-124 24.104999999999997 28.04 27.515 20.34 125-129 23.695 28.025 27.825 20.455000000000002 130-134 24.515 28.634999999999998 26.93 19.919999999999998 135-139 24.01 27.994999999999997 27.595 20.4 140-144 24.21 28.299999999999997 27.224999999999998 20.265 145-149 25.180000000000003 28.095 26.805 19.919999999999998 150-151 24.962500000000002 27.750000000000004 27.250000000000004 20.0375 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.5 6 0.5 7 0.0 8 0.5 9 1.0 10 0.5 11 0.0 12 0.5 13 0.5 14 1.0 15 1.5 16 1.0 17 2.0 18 2.5 19 2.0 20 2.0 21 4.0 22 4.5 23 1.5 24 1.0 25 3.5 26 4.0 27 3.5 28 12.0 29 15.0 30 14.0 31 20.5 32 25.0 33 38.5 34 53.5 35 65.5 36 91.5 37 108.5 38 123.5 39 158.5 40 190.0 41 222.5 42 248.0 43 261.0 44 272.5 45 262.0 46 257.0 47 253.0 48 230.5 49 200.5 50 171.5 51 136.0 52 104.0 53 86.0 54 76.0 55 68.0 56 47.0 57 39.0 58 31.5 59 18.0 60 13.0 61 9.0 62 7.5 63 8.0 64 4.0 65 1.5 66 1.5 67 1.5 68 1.0 69 0.0 70 0.0 71 0.0 72 1.0 73 1.0 74 0.0 75 0.0 76 0.5 77 1.5 78 1.5 79 1.0 80 1.0 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.5 90 0.5 91 0.0 92 0.5 93 0.5 94 0.0 95 0.0 96 0.5 97 1.0 98 0.5 99 0.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.05 #Duplication Level Percentage of deduplicated Percentage of total 1 92.28680065181966 84.95 2 7.0342205323193925 12.950000000000001 3 0.5160239000543183 1.425 4 0.10863661053775121 0.4 5 0.027159152634437803 0.125 6 0.027159152634437803 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 6 0.15 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0125 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.30000000000000004 0.0 0.0 0.0 0.0 92-93 0.35 0.0 0.0 0.0 0.0 94-95 0.44999999999999996 0.0 0.0 0.0 0.0 96-97 0.55 0.0 0.0 0.0 0.0 98-99 0.6375 0.0 0.0 0.0 0.0 100-101 0.7375 0.0 0.0 0.0 0.0 102-103 0.875 0.0 0.0 0.0 0.0 104-105 0.925 0.0 0.0 0.0 0.0 106-107 1.0 0.0 0.0 0.0 0.0 108-109 1.0750000000000002 0.0 0.0 0.0 0.0 110-111 1.2875 0.0 0.0 0.0 0.0 112-113 1.4500000000000002 0.0 0.0 0.0 0.0 114-115 1.6125 0.0 0.0 0.0 0.0 116-117 1.725 0.0 0.0 0.0 0.0 118-119 1.9625 0.0 0.0 0.0 0.0 120-121 2.175 0.0 0.0 0.0 0.0 122-123 2.4125 0.0 0.0 0.0 0.0 124-125 2.9625 0.0 0.0 0.0 0.0 126-127 3.325 0.0 0.0 0.0 0.0 128-129 3.675 0.0 0.0 0.0 0.0 130-131 4.025 0.0 0.0 0.0 0.0 132-133 4.4125 0.0 0.0 0.0 0.0 134-135 4.8 0.0 0.0 0.0 0.0 136-137 5.3125 0.0 0.0 0.0 0.0 138-139 5.8125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAGTCAA 10 0.006830828 145.0 5 GAAGATG 25 8.7132835E-4 87.0 2 TTTTTTT 20 0.00593511 29.0 100-104 >>END_MODULE Read 466978 spots for SRR12671030.sra Written 466978 spots for SRR12671030.sra Read 466978 spots for SRR12671030.sra Written 466978 spots for SRR12671030.sra Read 466978 spots for SRR12671030.sra Written 466978 spots for SRR12671030.sra Read 466978 spots for SRR12671030.sra Written 466978 spots for SRR12671030.sra Read 466978 spots for SRR12671030.sra Written 466978 spots for SRR12671030.sra Read 466978 spots for SRR12671030.sra Written 466978 spots for SRR12671030.sra Read 466978 spots for SRR12671030.sra Written 466978 spots for SRR12671030.sra Read 466978 spots for SRR12671030.sra Written 466978 spots for SRR12671030.sra Read 466978 spots for SRR12671030.sra Written 466978 spots for SRR12671030.sra Read 466978 spots for SRR12671030.sra Written 466978 spots for SRR12671030.sra Read 466978 spots for SRR12671030.sra Written 466978 spots for SRR12671030.sra Read 466978 spots for SRR12671030.sra Written 466978 spots for SRR12671030.sra Read 466978 spots for SRR12671030.sra Written 466978 spots for SRR12671030.sra Read 466978 spots for SRR12671030.sra Written 466978 spots for SRR12671030.sra Read 466978 spots for SRR12671030.sra Written 466978 spots for SRR12671030.sra Read 466978 spots for SRR12671030.sra Written 466978 spots for SRR12671030.sra Read 466978 spots for SRR12671030.sra Written 466978 spots for SRR12671030.sra Read 466987 spots for SRR12671030.sra Written 466987 spots for SRR12671030.sra Read 466978 spots for SRR12671030.sra Written 466978 spots for SRR12671030.sra Read 466978 spots for SRR12671030.sra Written 466978 spots for SRR12671030.sra SRR ids: ['SRR12671030.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_f5is6293 SRR12671030.sra spots: 9339569 blocks: [[1, 466978], [466979, 933956], [933957, 1400934], [1400935, 1867912], [1867913, 2334890], [2334891, 2801868], [2801869, 3268846], [3268847, 3735824], [3735825, 4202802], [4202803, 4669780], [4669781, 5136758], [5136759, 5603736], [5603737, 6070714], [6070715, 6537692], [6537693, 7004670], [7004671, 7471648], [7471649, 7938626], [7938627, 8405604], [8405605, 8872582], [8872583, 9339569]] SRR12671030 file size 3153583 SRR12671030 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671030 SRR12671030_1.fastq SRR12671030_2.fastq Input file: SRR12671030_1.fastq Paired file: SRR12671030_2.fastq trimmed: SRR12671030-trimmed-pair1.fastq, SRR12671030-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 15:17:45 2025 >> started Tue Feb 11 15:17:55 2025 >> done (10.233s) 9339569 read pairs processed; of these: 49 ( 0.00%) short read pairs filtered out after trimming by size control 3184 ( 0.03%) empty read pairs filtered out after trimming by size control 9336336 (99.97%) read pairs available; of these: 845444 ( 9.06%) trimmed read pairs available after processing 8490892 (90.94%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 4 0.00% 20 5 0.00% 21 6 0.00% 22 4 0.00% 23 3 0.00% 24 4 0.00% 25 7 0.00% 26 6 0.00% 27 4 0.00% 28 6 0.00% 29 9 0.00% 30 2 0.00% 31 11 0.00% 32 10 0.00% 33 14 0.00% 34 7 0.00% 35 9 0.00% 36 10 0.00% 37 11 0.00% 38 10 0.00% 39 7 0.00% 40 14 0.00% 41 5 0.00% 42 16 0.00% 43 17 0.00% 44 15 0.00% 45 10 0.00% 46 19 0.00% 47 23 0.00% 48 23 0.00% 49 22 0.00% 50 24 0.00% 51 28 0.00% 52 27 0.00% 53 43 0.00% 54 43 0.00% 55 41 0.00% 56 51 0.00% 57 59 0.00% 58 58 0.00% 59 73 0.00% 60 87 0.00% 61 109 0.00% 62 99 0.00% 63 124 0.00% 64 154 0.00% 65 139 0.00% 66 163 0.00% 67 194 0.00% 68 224 0.00% 69 217 0.00% 70 294 0.00% 71 311 0.00% 72 410 0.00% 73 470 0.01% 74 500 0.01% 75 561 0.01% 76 606 0.01% 77 701 0.01% 78 760 0.01% 79 876 0.01% 80 916 0.01% 81 1021 0.01% 82 1265 0.01% 83 1337 0.01% 84 1561 0.02% 85 1612 0.02% 86 1862 0.02% 87 1974 0.02% 88 2087 0.02% 89 2278 0.02% 90 2563 0.03% 91 2787 0.03% 92 3065 0.03% 93 3290 0.04% 94 3678 0.04% 95 3824 0.04% 96 4036 0.04% 97 4396 0.05% 98 4559 0.05% 99 4919 0.05% 100 5046 0.05% 101 5445 0.06% 102 5824 0.06% 103 6073 0.07% 104 6600 0.07% 105 6924 0.07% 106 7183 0.08% 107 7341 0.08% 108 7685 0.08% 109 8067 0.09% 110 8297 0.09% 111 8703 0.09% 112 9306 0.10% 113 9618 0.10% 114 10161 0.11% 115 10741 0.12% 116 11158 0.12% 117 11486 0.12% 118 11784 0.13% 119 12047 0.13% 120 12581 0.13% 121 13192 0.14% 122 13421 0.14% 123 14012 0.15% 124 14868 0.16% 125 14921 0.16% 126 15918 0.17% 127 15775 0.17% 128 16320 0.17% 129 16566 0.18% 130 17364 0.19% 131 17532 0.19% 132 18148 0.19% 133 18826 0.20% 134 19477 0.21% 135 20011 0.21% 136 20109 0.22% 137 21094 0.23% 138 21166 0.23% 139 21666 0.23% 140 21811 0.23% 141 22534 0.24% 142 23115 0.25% 143 23675 0.25% 144 24779 0.27% 145 25115 0.27% 146 25611 0.27% 147 25917 0.28% 148 26129 0.28% 149 26408 0.28% 150 27100 0.29% 151 8490892 90.94% 9336336 reads passed initial QC criterion=sequence-density sequence-density=0.42 sequence-density-rank=1 fanout-score=1.97 fanout-score-rank=21 prefix-density=0.41 prefix-fanout=2.0 sequence=GTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTG criterion=fanout-score sequence-density=0.10 sequence-density-rank=22 fanout-score=11.45 fanout-score-rank=1 prefix-density=0.19 prefix-fanout=5.9 sequence=CCATCCACATTAGCACCATATTTGTCGACATATTGGTACAC criterion=sequence-density sequence-density=0.50 sequence-density-rank=1 fanout-score=2.14 fanout-score-rank=26 prefix-density=0.51 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.13 sequence-density-rank=28 fanout-score=34.10 fanout-score-rank=1 prefix-density=0.36 prefix-fanout=12.6 sequence=AAAGAAAAGAAAA SRR12671030 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 15:18:40 Started mapping on | Feb 11 15:18:40 Finished on | Feb 11 15:19:52 Mapping speed, Million of reads per hour | 466.82 Number of input reads | 9336336 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 8540808 Uniquely mapped reads % | 91.48% Average mapped length | 296.35 Number of splices: Total | 8601996 Number of splices: Annotated (sjdb) | 8410615 Number of splices: GT/AG | 8428873 Number of splices: GC/AG | 139554 Number of splices: AT/AC | 5601 Number of splices: Non-canonical | 27968 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 3.00 Insertion rate per base | 0.02% Insertion average length | 2.40 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 228237 % of reads mapped to multiple loci | 2.44% Number of reads mapped to too many loci | 90266 % of reads mapped to too many loci | 0.97% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.90% % of reads unmapped: other | 0.21% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 567291 567291 567291 N_multimapping 228237 228237 228237 N_noFeature 365443 8405014 410793 N_ambiguous 144393 547 53620 UnstrandedReadsAssigned:8030972 PositiveStrandReadsAssigned:135247 NegativeStrandReadsAssigned:8076395 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671030 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671030-trimmed-pair1.fastq SRR12671030-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 9,336,336 reads, 8,123,652 reads pseudoaligned [quant] estimated average fragment length: 263.74 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,007 rounds 52401 SRR12671030.ke.tsv 34699 SRR12671030.se.tsv 87100 total ==> SRR12671030.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1755.26 350 21.6091 Potri.005G024800.1.v4.1 1035 772.26 113 15.8572 Potri.004G059700.1.v4.1 961 698.465 3 0.465465 Potri.007G009000.2.v4.1 1416 1153.26 0 0 Potri.003G141000.2.v4.1 2943 2680.26 367 14.8388 Potri.016G087400.1.v4.1 270 82.23 319 420.408 Potri.015G069301.1.v4.1 564 316.865 0 0 Potri.010G195200.1.v4.1 1773 1510.26 51 3.65956 Potri.012G127500.1.v4.1 977 714.355 80 12.1363 ==> SRR12671030.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 111 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 96 Potri.001G212900.v4.1 7 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 7 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4 SRR12671030 completed mapping pipeline successfully