Starting /dee2/code/volunteer_pipeline.sh SRR12671031 current disk space = 3049824219136 free memory = 1486715380 SRR12671031 SRAfilesize 406ea0f6c3a00108b18d1cbf4f7dabf6 SRR12671031.sra SRR12671031.sra file validated SRR12671031 is paired end SRR12671031 is conventional basespace SRR12671031 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671031_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.538 37.0 37.0 37.0 37.0 37.0 2 36.3585 37.0 37.0 37.0 37.0 37.0 3 36.526 37.0 37.0 37.0 37.0 37.0 4 36.5745 37.0 37.0 37.0 37.0 37.0 5 36.7015 37.0 37.0 37.0 37.0 37.0 6 36.7155 37.0 37.0 37.0 37.0 37.0 7 36.5755 37.0 37.0 37.0 37.0 37.0 8 36.6275 37.0 37.0 37.0 37.0 37.0 9 36.673 37.0 37.0 37.0 37.0 37.0 10-14 36.6348 37.0 37.0 37.0 37.0 37.0 15-19 36.660000000000004 37.0 37.0 37.0 37.0 37.0 20-24 36.5779 37.0 37.0 37.0 37.0 37.0 25-29 36.5586 37.0 37.0 37.0 37.0 37.0 30-34 36.537800000000004 37.0 37.0 37.0 37.0 37.0 35-39 36.538599999999995 37.0 37.0 37.0 37.0 37.0 40-44 36.5322 37.0 37.0 37.0 37.0 37.0 45-49 36.4938 37.0 37.0 37.0 37.0 37.0 50-54 36.4884 37.0 37.0 37.0 37.0 37.0 55-59 36.4478 37.0 37.0 37.0 37.0 37.0 60-64 36.439099999999996 37.0 37.0 37.0 37.0 37.0 65-69 36.428399999999996 37.0 37.0 37.0 37.0 37.0 70-74 36.3794 37.0 37.0 37.0 37.0 37.0 75-79 36.3207 37.0 37.0 37.0 37.0 37.0 80-84 36.304700000000004 37.0 37.0 37.0 37.0 37.0 85-89 36.304899999999996 37.0 37.0 37.0 37.0 37.0 90-94 36.2773 37.0 37.0 37.0 37.0 37.0 95-99 36.2964 37.0 37.0 37.0 37.0 37.0 100-104 36.2444 37.0 37.0 37.0 37.0 37.0 105-109 36.2068 37.0 37.0 37.0 37.0 37.0 110-114 36.216899999999995 37.0 37.0 37.0 37.0 37.0 115-119 36.116200000000006 37.0 37.0 37.0 37.0 37.0 120-124 36.07619999999999 37.0 37.0 37.0 37.0 37.0 125-129 36.0279 37.0 37.0 37.0 37.0 37.0 130-134 35.899 37.0 37.0 37.0 37.0 37.0 135-139 35.890699999999995 37.0 37.0 37.0 37.0 37.0 140-144 35.861200000000004 37.0 37.0 37.0 37.0 37.0 145-149 35.697300000000006 37.0 37.0 37.0 37.0 37.0 150-151 35.50925 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 1.0 22 2.0 23 0.0 24 1.0 25 4.0 26 2.0 27 10.0 28 12.0 29 23.0 30 18.0 31 32.0 32 47.0 33 70.0 34 112.0 35 282.0 36 2743.0 37 640.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 52.07603801900951 11.155577788894448 3.651825912956478 33.11655827913957 2 18.125 12.525 38.45 30.9 3 17.125 16.5 28.849999999999998 37.525 4 21.9 23.25 25.85 28.999999999999996 5 22.975 31.8 24.575 20.65 6 20.575 33.125 24.349999999999998 21.95 7 15.675 26.3 40.150000000000006 17.875 8 16.075 26.35 34.325 23.25 9 17.675 24.175 35.25 22.900000000000002 10-14 19.85 29.805 28.07 22.275 15-19 19.455 28.305000000000003 28.605000000000004 23.635 20-24 19.955000000000002 28.175 27.805000000000003 24.065 25-29 19.2 28.315 28.535 23.95 30-34 19.814999999999998 28.335 27.779999999999998 24.07 35-39 19.919999999999998 28.655 28.15 23.275000000000002 40-44 19.950000000000003 28.73 28.000000000000004 23.32 45-49 19.8 28.875 27.944999999999997 23.380000000000003 50-54 19.98 28.194999999999997 27.715 24.11 55-59 19.400000000000002 28.33 28.815 23.455000000000002 60-64 19.21 28.875 28.055000000000003 23.86 65-69 19.375 29.085 28.139999999999997 23.400000000000002 70-74 19.68 28.58 28.04 23.7 75-79 19.73 28.384999999999998 28.139999999999997 23.745 80-84 19.915 28.01 28.825 23.25 85-89 19.6 28.884999999999998 27.889999999999997 23.625 90-94 20.244999999999997 28.694999999999997 28.175 22.884999999999998 95-99 20.32 28.294999999999998 27.725 23.66 100-104 20.025000000000002 29.404999999999998 27.76 22.81 105-109 20.580000000000002 28.105000000000004 28.46 22.855 110-114 19.955000000000002 28.425 28.285 23.335 115-119 20.064999999999998 29.525000000000002 27.279999999999998 23.13 120-124 20.105 28.51 27.765 23.62 125-129 20.405 27.965 28.49 23.14 130-134 20.18 29.09 27.939999999999998 22.79 135-139 20.69 28.53 27.200000000000003 23.580000000000002 140-144 20.560000000000002 28.32 27.725 23.395 145-149 20.92209220922092 28.292829282928295 27.742774277427745 23.042304230423042 150-151 21.462500000000002 27.8625 26.525 24.15 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 2.5 23 2.0 24 4.5 25 5.5 26 5.5 27 10.0 28 13.5 29 12.5 30 14.5 31 32.0 32 41.0 33 48.0 34 59.5 35 81.5 36 99.5 37 114.5 38 148.0 39 160.5 40 185.0 41 223.5 42 246.5 43 264.0 44 258.5 45 267.5 46 282.5 47 244.0 48 210.5 49 194.5 50 160.5 51 124.5 52 103.0 53 87.5 54 75.0 55 58.0 56 40.5 57 32.5 58 22.0 59 18.5 60 13.5 61 9.0 62 7.0 63 4.0 64 3.0 65 2.5 66 2.0 67 0.5 68 0.5 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.01 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.975 #Duplication Level Percentage of deduplicated Percentage of total 1 90.93157460840891 82.72500000000001 2 8.298983237153063 15.1 3 0.6870019236053861 1.875 4 0.08244023083264633 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.0875 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.1375 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.2375 0.0 0.0 0.0 0.0 98-99 0.275 0.0 0.0 0.0 0.0 100-101 0.3125 0.0 0.0 0.0 0.0 102-103 0.4 0.0 0.0 0.0 0.0 104-105 0.55 0.0 0.0 0.0 0.0 106-107 0.65 0.0 0.0 0.0 0.0 108-109 0.7375 0.0 0.0 0.0 0.0 110-111 0.8500000000000001 0.0 0.0 0.0 0.0 112-113 0.95 0.0 0.0 0.0 0.0 114-115 1.0875 0.0 0.0 0.0 0.0 116-117 1.2625000000000002 0.0 0.0 0.0 0.0 118-119 1.4125 0.0 0.0 0.0 0.0 120-121 1.475 0.0 0.0 0.0 0.0 122-123 1.6875 0.0 0.0 0.0 0.0 124-125 2.075 0.0 0.0 0.0 0.0 126-127 2.4125 0.0 0.0 0.0 0.0 128-129 2.675 0.0 0.0 0.0 0.0 130-131 3.125 0.0 0.0 0.0 0.0 132-133 3.5125 0.0 0.0 0.0 0.0 134-135 3.8625 0.0 0.0 0.0 0.0 136-137 4.15 0.0 0.0 0.0 0.0 138-139 4.4125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCTACTT 10 0.006830828 145.0 1 TTGCTGC 10 0.006830828 145.0 8 >>END_MODULE SRR12671031 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671031_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.275 37.0 37.0 37.0 37.0 37.0 2 36.256 37.0 37.0 37.0 37.0 37.0 3 36.309 37.0 37.0 37.0 37.0 37.0 4 36.341 37.0 37.0 37.0 37.0 37.0 5 36.4345 37.0 37.0 37.0 37.0 37.0 6 36.394 37.0 37.0 37.0 37.0 37.0 7 36.4735 37.0 37.0 37.0 37.0 37.0 8 36.48 37.0 37.0 37.0 37.0 37.0 9 36.4825 37.0 37.0 37.0 37.0 37.0 10-14 36.4553 37.0 37.0 37.0 37.0 37.0 15-19 36.4305 37.0 37.0 37.0 37.0 37.0 20-24 36.4097 37.0 37.0 37.0 37.0 37.0 25-29 36.3479 37.0 37.0 37.0 37.0 37.0 30-34 36.3202 37.0 37.0 37.0 37.0 37.0 35-39 36.281600000000005 37.0 37.0 37.0 37.0 37.0 40-44 36.244299999999996 37.0 37.0 37.0 37.0 37.0 45-49 36.2912 37.0 37.0 37.0 37.0 37.0 50-54 36.2417 37.0 37.0 37.0 37.0 37.0 55-59 36.2324 37.0 37.0 37.0 37.0 37.0 60-64 36.2528 37.0 37.0 37.0 37.0 37.0 65-69 36.2842 37.0 37.0 37.0 37.0 37.0 70-74 36.201299999999996 37.0 37.0 37.0 37.0 37.0 75-79 36.188300000000005 37.0 37.0 37.0 37.0 37.0 80-84 36.1386 37.0 37.0 37.0 37.0 37.0 85-89 36.1026 37.0 37.0 37.0 37.0 37.0 90-94 36.108999999999995 37.0 37.0 37.0 37.0 37.0 95-99 36.1215 37.0 37.0 37.0 37.0 37.0 100-104 36.07340000000001 37.0 37.0 37.0 37.0 37.0 105-109 35.9875 37.0 37.0 37.0 37.0 37.0 110-114 36.0714 37.0 37.0 37.0 37.0 37.0 115-119 35.973749999999995 37.0 37.0 37.0 37.0 37.0 120-124 35.9081 37.0 37.0 37.0 37.0 37.0 125-129 35.8146 37.0 37.0 37.0 37.0 37.0 130-134 35.835300000000004 37.0 37.0 37.0 37.0 37.0 135-139 35.85119999999999 37.0 37.0 37.0 37.0 37.0 140-144 35.77735 37.0 37.0 37.0 37.0 37.0 145-149 35.5257 37.0 37.0 37.0 37.0 37.0 150-151 35.28725 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 3.0 14 5.0 15 1.0 16 3.0 17 0.0 18 2.0 19 1.0 20 1.0 21 3.0 22 3.0 23 2.0 24 7.0 25 6.0 26 5.0 27 6.0 28 6.0 29 17.0 30 26.0 31 29.0 32 49.0 33 71.0 34 149.0 35 386.0 36 2662.0 37 557.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 48.65 24.95 6.800000000000001 19.6 2 26.025 24.725 33.6 15.65 3 21.575 27.975 31.275 19.175 4 23.95 35.125 23.599999999999998 17.325 5 23.875 37.775 21.475 16.875 6 20.599999999999998 40.6 21.75 17.05 7 20.599999999999998 22.75 37.974999999999994 18.675 8 19.825 26.900000000000002 30.675 22.6 9 21.725 25.1 30.049999999999997 23.125 10-14 22.855 29.794999999999998 26.82 20.53 15-19 23.330000000000002 28.52 27.88 20.27 20-24 22.215 28.63 28.465 20.69 25-29 22.759999999999998 27.939999999999998 28.4 20.9 30-34 22.645 27.905 28.965000000000003 20.485 35-39 22.755 28.439999999999998 28.294999999999998 20.51 40-44 22.505 29.110000000000003 27.950000000000003 20.435 45-49 22.355 28.505000000000003 28.345 20.794999999999998 50-54 21.85 28.854999999999997 28.499999999999996 20.794999999999998 55-59 22.235 28.599999999999998 28.27 20.895 60-64 22.919999999999998 28.365000000000002 28.110000000000003 20.605 65-69 23.355 27.735 28.599999999999998 20.31 70-74 22.38 28.08 28.310000000000002 21.23 75-79 23.03 28.144999999999996 28.165000000000003 20.66 80-84 22.755 28.12 28.455000000000002 20.669999999999998 85-89 23.630000000000003 28.04 27.400000000000002 20.93 90-94 22.95 27.975 28.365000000000002 20.71 95-99 22.605 29.195 28.084999999999997 20.115 100-104 23.135 28.43 27.694999999999997 20.74 105-109 23.055 28.49 27.834999999999997 20.62 110-114 22.68 29.515 27.175 20.630000000000003 115-119 23.401170058502927 29.081454072703632 27.226361318065905 20.29101455072754 120-124 24.03 28.49 27.295 20.185 125-129 23.41 28.799999999999997 27.589999999999996 20.200000000000003 130-134 23.825 27.83 27.860000000000003 20.485 135-139 23.515 28.59 27.705000000000002 20.19 140-144 24.15620781039052 28.136406820341016 27.636381819090953 20.07100355017751 145-149 24.474999999999998 28.175 27.32 20.03 150-151 24.7 28.237499999999997 28.075 18.987499999999997 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 1.0 3 0.5 4 0.0 5 0.0 6 0.5 7 1.0 8 0.5 9 0.5 10 0.5 11 0.0 12 0.0 13 0.5 14 1.0 15 1.0 16 1.0 17 0.5 18 0.0 19 0.0 20 0.5 21 1.5 22 2.0 23 2.5 24 4.0 25 5.5 26 6.5 27 9.0 28 13.5 29 15.5 30 20.0 31 29.5 32 40.5 33 48.0 34 58.5 35 76.0 36 94.5 37 130.5 38 155.5 39 175.0 40 208.0 41 227.0 42 259.5 43 275.5 44 277.0 45 269.0 46 254.5 47 255.5 48 213.0 49 168.0 50 152.0 51 119.0 52 88.0 53 82.0 54 71.0 55 50.0 56 34.0 57 22.5 58 16.0 59 15.5 60 10.5 61 6.5 62 6.5 63 4.5 64 4.0 65 3.0 66 2.0 67 0.5 68 0.0 69 0.0 70 0.5 71 1.0 72 0.5 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.5 83 1.0 84 0.5 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.5 98 0.5 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.005 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.005 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.875 #Duplication Level Percentage of deduplicated Percentage of total 1 91.14167812929848 82.825 2 8.033012379642365 14.6 3 0.6327372764786795 1.725 4 0.11004126547455295 0.4 5 0.055020632737276476 0.25 6 0.0 0.0 7 0.0 0.0 8 0.027510316368638238 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 8 0.2 No Hit CACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATC 5 0.125 No Hit CATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.0875 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.1375 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.2375 0.0 0.0 0.0 0.0 98-99 0.275 0.0 0.0 0.0 0.0 100-101 0.3125 0.0 0.0 0.0 0.0 102-103 0.4 0.0 0.0 0.0 0.0 104-105 0.55 0.0 0.0 0.0 0.0 106-107 0.675 0.0 0.0 0.0 0.0 108-109 0.7625 0.0 0.0 0.0 0.0 110-111 0.875 0.0 0.0 0.0 0.0 112-113 0.975 0.0 0.0 0.0 0.0 114-115 1.1125 0.0 0.0 0.0 0.0 116-117 1.2875 0.0 0.0 0.0 0.0 118-119 1.4375 0.0 0.0 0.0 0.0 120-121 1.5375 0.0 0.0 0.0 0.0 122-123 1.775 0.0 0.0 0.0 0.0 124-125 2.175 0.0 0.0 0.0 0.0 126-127 2.5125 0.0 0.0 0.0 0.0 128-129 2.7625 0.0 0.0 0.0 0.0 130-131 3.2 0.0 0.0 0.0 0.0 132-133 3.5875000000000004 0.0 0.0 0.0 0.0 134-135 3.9375 0.0 0.0 0.0 0.0 136-137 4.25 0.0 0.0 0.0 0.0 138-139 4.5375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 697348 spots for SRR12671031.sra Written 697348 spots for SRR12671031.sra Read 697348 spots for SRR12671031.sra Written 697348 spots for SRR12671031.sra Read 697348 spots for SRR12671031.sra Written 697348 spots for SRR12671031.sra Read 697348 spots for SRR12671031.sra Written 697348 spots for SRR12671031.sra Read 697348 spots for SRR12671031.sra Written 697348 spots for SRR12671031.sra Read 697348 spots for SRR12671031.sra Written 697348 spots for SRR12671031.sra Read 697348 spots for SRR12671031.sra Written 697348 spots for SRR12671031.sra Read 697348 spots for SRR12671031.sra Written 697348 spots for SRR12671031.sra Read 697348 spots for SRR12671031.sra Written 697348 spots for SRR12671031.sra Read 697348 spots for SRR12671031.sra Written 697348 spots for SRR12671031.sra Read 697348 spots for SRR12671031.sra Written 697348 spots for SRR12671031.sra Read 697348 spots for SRR12671031.sra Written 697348 spots for SRR12671031.sra Read 697348 spots for SRR12671031.sra Written 697348 spots for SRR12671031.sra Read 697348 spots for SRR12671031.sra Written 697348 spots for SRR12671031.sra Read 697348 spots for SRR12671031.sra Written 697348 spots for SRR12671031.sra Read 697348 spots for SRR12671031.sra Written 697348 spots for SRR12671031.sra Read 697348 spots for SRR12671031.sra Written 697348 spots for SRR12671031.sra Read 697352 spots for SRR12671031.sra Written 697352 spots for SRR12671031.sra Read 697348 spots for SRR12671031.sra Written 697348 spots for SRR12671031.sra Read 697348 spots for SRR12671031.sra Written 697348 spots for SRR12671031.sra SRR ids: ['SRR12671031.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_togx217i SRR12671031.sra spots: 13946964 blocks: [[1, 697348], [697349, 1394696], [1394697, 2092044], [2092045, 2789392], [2789393, 3486740], [3486741, 4184088], [4184089, 4881436], [4881437, 5578784], [5578785, 6276132], [6276133, 6973480], [6973481, 7670828], [7670829, 8368176], [8368177, 9065524], [9065525, 9762872], [9762873, 10460220], [10460221, 11157568], [11157569, 11854916], [11854917, 12552264], [12552265, 13249612], [13249613, 13946964]] SRR12671031 file size 4718088 SRR12671031 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671031 SRR12671031_1.fastq SRR12671031_2.fastq Input file: SRR12671031_1.fastq Paired file: SRR12671031_2.fastq trimmed: SRR12671031-trimmed-pair1.fastq, SRR12671031-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 15:09:23 2025 >> started Tue Feb 11 15:09:39 2025 >> done (15.769s) 13946964 read pairs processed; of these: 120 ( 0.00%) short read pairs filtered out after trimming by size control 1202 ( 0.01%) empty read pairs filtered out after trimming by size control 13945642 (99.99%) read pairs available; of these: 976042 ( 7.00%) trimmed read pairs available after processing 12969600 (93.00%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 13 0.00% 19 6 0.00% 20 9 0.00% 21 15 0.00% 22 12 0.00% 23 20 0.00% 24 20 0.00% 25 17 0.00% 26 19 0.00% 27 23 0.00% 28 15 0.00% 29 22 0.00% 30 26 0.00% 31 26 0.00% 32 23 0.00% 33 25 0.00% 34 23 0.00% 35 14 0.00% 36 16 0.00% 37 15 0.00% 38 22 0.00% 39 11 0.00% 40 18 0.00% 41 20 0.00% 42 12 0.00% 43 25 0.00% 44 18 0.00% 45 15 0.00% 46 13 0.00% 47 22 0.00% 48 23 0.00% 49 20 0.00% 50 33 0.00% 51 27 0.00% 52 30 0.00% 53 35 0.00% 54 34 0.00% 55 49 0.00% 56 40 0.00% 57 52 0.00% 58 59 0.00% 59 56 0.00% 60 66 0.00% 61 62 0.00% 62 54 0.00% 63 85 0.00% 64 97 0.00% 65 104 0.00% 66 126 0.00% 67 144 0.00% 68 138 0.00% 69 172 0.00% 70 175 0.00% 71 212 0.00% 72 232 0.00% 73 305 0.00% 74 299 0.00% 75 346 0.00% 76 405 0.00% 77 449 0.00% 78 477 0.00% 79 602 0.00% 80 650 0.00% 81 753 0.01% 82 850 0.01% 83 925 0.01% 84 1032 0.01% 85 1177 0.01% 86 1246 0.01% 87 1417 0.01% 88 1585 0.01% 89 1620 0.01% 90 1827 0.01% 91 2133 0.02% 92 2257 0.02% 93 2570 0.02% 94 2798 0.02% 95 3166 0.02% 96 3316 0.02% 97 3745 0.03% 98 3951 0.03% 99 4155 0.03% 100 4586 0.03% 101 5106 0.04% 102 5324 0.04% 103 5784 0.04% 104 6138 0.04% 105 6707 0.05% 106 7209 0.05% 107 7445 0.05% 108 8041 0.06% 109 8397 0.06% 110 8959 0.06% 111 9212 0.07% 112 9899 0.07% 113 10535 0.08% 114 10998 0.08% 115 11560 0.08% 116 12209 0.09% 117 12944 0.09% 118 13416 0.10% 119 13806 0.10% 120 14385 0.10% 121 15353 0.11% 122 15858 0.11% 123 16229 0.12% 124 17364 0.12% 125 17441 0.13% 126 18274 0.13% 127 18809 0.13% 128 19674 0.14% 129 20489 0.15% 130 20860 0.15% 131 20811 0.15% 132 22066 0.16% 133 22598 0.16% 134 23111 0.17% 135 23922 0.17% 136 24378 0.17% 137 25404 0.18% 138 26090 0.19% 139 27341 0.20% 140 26920 0.19% 141 28369 0.20% 142 29081 0.21% 143 29155 0.21% 144 30567 0.22% 145 30609 0.22% 146 31866 0.23% 147 32373 0.23% 148 33149 0.24% 149 33359 0.24% 150 35146 0.25% 151 12969600 93.00% 13945642 reads passed initial QC criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=26 prefix-density=0.27 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.07 sequence-density-rank=24 fanout-score=58.12 fanout-score-rank=1 prefix-density=0.34 prefix-fanout=11.9 sequence=TCAGCAACAACATCAGGATGGCTGAATATCTTAGCAGCATCACATCTCTTATTTGTCGGAATTGGCTCGCCAGCAGGAGTATAAGCGTCACATATGACGAGGATGTTATTGCCCCTCCTAAATGGATCTCTGAAAATAGCTTGTGGATATAGGATCACTTCACTGTCTTGTCCAGGAGCCTGGCCTGTGCTGGAACCATCATAGTTCCATTTGGGAAGCTTTGCAGGATCACTAACTGGGCCGGA criterion=sequence-density sequence-density=0.34 sequence-density-rank=1 fanout-score=2.59 fanout-score-rank=29 prefix-density=0.36 prefix-fanout=2.4 sequence=TGCAAGTGCGGCAGTGGCTGCAATGGATGCAGCATGTACCCAGACTTGAGTTTCTCCGAGACCACCACAAGTCAGACAATCATTGCTGGTGTAGCTCCAGTTAGGATGTTCTACGAGAGCTCTGAGATGAACTTTGGTGCTGAGAATGGCTG criterion=fanout-score sequence-density=0.07 sequence-density-rank=36 fanout-score=98.09 fanout-score-rank=1 prefix-density=0.57 prefix-fanout=12.5 sequence=AAAAGAAAAGAAAA SRR12671031 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 15:10:21 Started mapping on | Feb 11 15:10:21 Finished on | Feb 11 15:12:04 Mapping speed, Million of reads per hour | 487.42 Number of input reads | 13945642 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 12899556 Uniquely mapped reads % | 92.50% Average mapped length | 297.47 Number of splices: Total | 13037790 Number of splices: Annotated (sjdb) | 12696615 Number of splices: GT/AG | 12782373 Number of splices: GC/AG | 194024 Number of splices: AT/AC | 8906 Number of splices: Non-canonical | 52487 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 3.02 Insertion rate per base | 0.03% Insertion average length | 2.34 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 361371 % of reads mapped to multiple loci | 2.59% Number of reads mapped to too many loci | 24565 % of reads mapped to too many loci | 0.18% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.62% % of reads unmapped: other | 0.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 684715 684715 684715 N_multimapping 361371 361371 361371 N_noFeature 576568 12699661 633079 N_ambiguous 250893 719 107205 UnstrandedReadsAssigned:12072095 PositiveStrandReadsAssigned:199176 NegativeStrandReadsAssigned:12159272 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671031 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671031-trimmed-pair1.fastq SRR12671031-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,945,642 reads, 12,091,806 reads pseudoaligned [quant] estimated average fragment length: 276.544 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,125 rounds 52401 SRR12671031.ke.tsv 34699 SRR12671031.se.tsv 87100 total ==> SRR12671031.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1742.46 1165 47.7871 Potri.005G024800.1.v4.1 1035 759.456 293 27.5747 Potri.004G059700.1.v4.1 961 685.778 2 0.208446 Potri.007G009000.2.v4.1 1416 1140.46 0 0 Potri.003G141000.2.v4.1 2943 2667.46 744.94 19.9605 Potri.016G087400.1.v4.1 270 78.404 730 665.474 Potri.015G069301.1.v4.1 564 307.474 0 0 Potri.010G195200.1.v4.1 1773 1497.46 506 24.1514 Potri.012G127500.1.v4.1 977 701.622 100 10.1869 ==> SRR12671031.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 240 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 179 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 53 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR12671031 completed mapping pipeline successfully