Starting /dee2/code/volunteer_pipeline.sh SRR12671032 current disk space = 3050086125568 free memory = 1434427928 SRR12671032 SRAfilesize 1f0abc2f3289f74eede4b34ac377b505 SRR12671032.sra SRR12671032.sra file validated SRR12671032 is paired end SRR12671032 is conventional basespace SRR12671032 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671032_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.50225 37.0 37.0 37.0 37.0 37.0 2 36.3315 37.0 37.0 37.0 37.0 37.0 3 36.55 37.0 37.0 37.0 37.0 37.0 4 36.636 37.0 37.0 37.0 37.0 37.0 5 36.6185 37.0 37.0 37.0 37.0 37.0 6 36.649 37.0 37.0 37.0 37.0 37.0 7 36.5765 37.0 37.0 37.0 37.0 37.0 8 36.6115 37.0 37.0 37.0 37.0 37.0 9 36.5525 37.0 37.0 37.0 37.0 37.0 10-14 36.6221 37.0 37.0 37.0 37.0 37.0 15-19 36.5952 37.0 37.0 37.0 37.0 37.0 20-24 36.5356 37.0 37.0 37.0 37.0 37.0 25-29 36.5064 37.0 37.0 37.0 37.0 37.0 30-34 36.5038 37.0 37.0 37.0 37.0 37.0 35-39 36.456900000000005 37.0 37.0 37.0 37.0 37.0 40-44 36.489799999999995 37.0 37.0 37.0 37.0 37.0 45-49 36.44520000000001 37.0 37.0 37.0 37.0 37.0 50-54 36.409800000000004 37.0 37.0 37.0 37.0 37.0 55-59 36.40820000000001 37.0 37.0 37.0 37.0 37.0 60-64 36.38720000000001 37.0 37.0 37.0 37.0 37.0 65-69 36.3737 37.0 37.0 37.0 37.0 37.0 70-74 36.3697 37.0 37.0 37.0 37.0 37.0 75-79 36.3033 37.0 37.0 37.0 37.0 37.0 80-84 36.296400000000006 37.0 37.0 37.0 37.0 37.0 85-89 36.3028 37.0 37.0 37.0 37.0 37.0 90-94 36.257 37.0 37.0 37.0 37.0 37.0 95-99 36.2164 37.0 37.0 37.0 37.0 37.0 100-104 36.176 37.0 37.0 37.0 37.0 37.0 105-109 36.1372 37.0 37.0 37.0 37.0 37.0 110-114 36.073 37.0 37.0 37.0 37.0 37.0 115-119 36.0792 37.0 37.0 37.0 37.0 37.0 120-124 36.0508 37.0 37.0 37.0 37.0 37.0 125-129 35.9932 37.0 37.0 37.0 37.0 37.0 130-134 35.86110000000001 37.0 37.0 37.0 37.0 37.0 135-139 35.89110000000001 37.0 37.0 37.0 37.0 37.0 140-144 35.8254 37.0 37.0 37.0 37.0 37.0 145-149 35.705999999999996 37.0 37.0 37.0 37.0 37.0 150-151 35.47125 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 2.0 20 0.0 21 1.0 22 2.0 23 0.0 24 3.0 25 4.0 26 6.0 27 7.0 28 12.0 29 17.0 30 29.0 31 33.0 32 58.0 33 91.0 34 132.0 35 250.0 36 2692.0 37 661.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 58.53963490872718 11.75293823455864 4.326081520380095 25.381345336334082 2 19.950000000000003 10.575 35.55 33.925 3 16.625 17.349999999999998 30.025000000000002 36.0 4 21.825 23.225 25.874999999999996 29.075 5 23.025000000000002 31.7 24.349999999999998 20.925 6 20.150000000000002 33.575 23.400000000000002 22.875 7 14.799999999999999 28.725 41.4 15.075 8 15.975 26.700000000000003 33.7 23.625 9 17.325 23.175 34.925 24.575 10-14 19.415 29.535 28.189999999999998 22.86 15-19 20.1 28.000000000000004 28.025 23.875 20-24 20.064999999999998 28.854999999999997 27.655 23.425 25-29 20.205000000000002 28.754999999999995 27.91 23.13 30-34 19.925 29.060000000000002 26.939999999999998 24.075 35-39 19.905 28.4 28.435 23.26 40-44 20.1 29.185 26.674999999999997 24.04 45-49 20.47 28.470000000000002 27.49 23.57 50-54 19.86 28.744999999999997 27.474999999999998 23.919999999999998 55-59 19.38 28.005000000000003 28.410000000000004 24.205 60-64 20.54 28.910000000000004 26.979999999999997 23.57 65-69 19.935 28.189999999999998 27.975 23.9 70-74 20.794999999999998 28.615000000000002 27.505000000000003 23.085 75-79 20.22 27.73 28.115000000000002 23.935000000000002 80-84 20.47 28.065 27.615000000000002 23.849999999999998 85-89 20.13 28.610000000000003 27.325 23.935000000000002 90-94 20.724999999999998 28.575 27.189999999999998 23.51 95-99 20.505000000000003 28.985 26.86 23.65 100-104 20.47 28.64 27.805000000000003 23.085 105-109 20.544999999999998 28.505000000000003 26.939999999999998 24.01 110-114 20.745 27.915 27.834999999999997 23.505000000000003 115-119 20.845 28.255000000000003 27.555000000000003 23.345 120-124 20.665 27.98 27.67 23.685000000000002 125-129 21.235 27.900000000000002 27.47 23.395 130-134 21.02 27.98 27.265 23.735 135-139 20.810000000000002 28.494999999999997 26.99 23.705000000000002 140-144 20.705000000000002 27.785 28.055000000000003 23.455000000000002 145-149 21.257125712571256 28.16281628162816 27.222722272227223 23.357335733573358 150-151 20.9 28.000000000000004 27.5875 23.5125 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 0.5 2 0.5 3 0.5 4 0.0 5 0.0 6 1.0 7 1.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.5 14 1.0 15 1.0 16 1.0 17 0.5 18 0.5 19 0.5 20 2.0 21 2.0 22 2.5 23 5.0 24 5.5 25 5.0 26 6.5 27 7.5 28 7.5 29 9.0 30 19.5 31 27.0 32 29.0 33 48.5 34 63.0 35 72.0 36 79.0 37 94.5 38 122.5 39 143.0 40 161.0 41 185.0 42 228.0 43 273.0 44 276.0 45 275.0 46 269.0 47 237.0 48 236.5 49 228.0 50 189.0 51 136.0 52 104.0 53 95.0 54 77.5 55 70.0 56 64.5 57 43.5 58 24.0 59 20.0 60 14.0 61 10.5 62 8.0 63 3.0 64 2.5 65 2.0 66 1.0 67 1.5 68 2.0 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 1.0 75 1.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.01 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.875 #Duplication Level Percentage of deduplicated Percentage of total 1 91.05914718019257 82.75 2 7.977991746905088 14.499999999999998 3 0.8253094910591471 2.25 4 0.1375515818431912 0.5 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0125 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.0625 0.0 0.0 0.0 0.0 46-47 0.075 0.0 0.0 0.0 0.0 48-49 0.075 0.0 0.0 0.0 0.0 50-51 0.075 0.0 0.0 0.0 0.0 52-53 0.075 0.0 0.0 0.0 0.0 54-55 0.075 0.0 0.0 0.0 0.0 56-57 0.0875 0.0 0.0 0.0 0.0 58-59 0.1 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.21250000000000002 0.0 0.0 0.0 0.0 92-93 0.25 0.0 0.0 0.0 0.0 94-95 0.35 0.0 0.0 0.0 0.0 96-97 0.4375 0.0 0.0 0.0 0.0 98-99 0.4875 0.0 0.0 0.0 0.0 100-101 0.575 0.0 0.0 0.0 0.0 102-103 0.6 0.0 0.0 0.0 0.0 104-105 0.6375 0.0 0.0 0.0 0.0 106-107 0.75 0.0 0.0 0.0 0.0 108-109 0.825 0.0 0.0 0.0 0.0 110-111 0.9875 0.0 0.0 0.0 0.0 112-113 1.1 0.0 0.0 0.0 0.0 114-115 1.2625 0.0 0.0 0.0 0.0 116-117 1.3875000000000002 0.0 0.0 0.0 0.0 118-119 1.5375 0.0 0.0 0.0 0.0 120-121 1.6875 0.0 0.0 0.0 0.0 122-123 1.8875000000000002 0.0 0.0 0.0 0.0 124-125 2.125 0.0 0.0 0.0 0.0 126-127 2.275 0.0 0.0 0.0 0.0 128-129 2.4625 0.0 0.0 0.0 0.0 130-131 2.7 0.0 0.0 0.0 0.0 132-133 2.7874999999999996 0.0 0.0 0.0 0.0 134-135 2.95 0.0 0.0 0.0 0.0 136-137 3.175 0.0 0.0 0.0 0.0 138-139 3.3499999999999996 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGCTGAT 10 0.006830828 145.0 1 GCCCAGT 10 0.006830828 145.0 1 TGAAACC 10 0.006830828 145.0 8 >>END_MODULE SRR12671032 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671032_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.1745 37.0 37.0 37.0 37.0 37.0 2 36.1755 37.0 37.0 37.0 37.0 37.0 3 36.276 37.0 37.0 37.0 37.0 37.0 4 36.1715 37.0 37.0 37.0 37.0 37.0 5 36.377 37.0 37.0 37.0 37.0 37.0 6 36.4055 37.0 37.0 37.0 37.0 37.0 7 36.338 37.0 37.0 37.0 37.0 37.0 8 36.405 37.0 37.0 37.0 37.0 37.0 9 36.41 37.0 37.0 37.0 37.0 37.0 10-14 36.381 37.0 37.0 37.0 37.0 37.0 15-19 36.3067 37.0 37.0 37.0 37.0 37.0 20-24 36.321400000000004 37.0 37.0 37.0 37.0 37.0 25-29 36.2197 37.0 37.0 37.0 37.0 37.0 30-34 36.245999999999995 37.0 37.0 37.0 37.0 37.0 35-39 36.1716 37.0 37.0 37.0 37.0 37.0 40-44 36.1101 37.0 37.0 37.0 37.0 37.0 45-49 36.1163 37.0 37.0 37.0 37.0 37.0 50-54 36.1061 37.0 37.0 37.0 37.0 37.0 55-59 36.0726 37.0 37.0 37.0 37.0 37.0 60-64 36.020900000000005 37.0 37.0 37.0 37.0 37.0 65-69 36.05740000000001 37.0 37.0 37.0 37.0 37.0 70-74 35.9823 37.0 37.0 37.0 37.0 37.0 75-79 35.975300000000004 37.0 37.0 37.0 37.0 37.0 80-84 35.954600000000006 37.0 37.0 37.0 37.0 37.0 85-89 35.9053 37.0 37.0 37.0 37.0 37.0 90-94 35.9274 37.0 37.0 37.0 37.0 37.0 95-99 35.9329 37.0 37.0 37.0 37.0 37.0 100-104 35.8769 37.0 37.0 37.0 37.0 37.0 105-109 35.814499999999995 37.0 37.0 37.0 37.0 37.0 110-114 35.812200000000004 37.0 37.0 37.0 37.0 37.0 115-119 35.72985 37.0 37.0 37.0 37.0 37.0 120-124 35.7281 37.0 37.0 37.0 37.0 37.0 125-129 35.634299999999996 37.0 37.0 37.0 37.0 37.0 130-134 35.666399999999996 37.0 37.0 37.0 37.0 37.0 135-139 35.6323 37.0 37.0 37.0 37.0 37.0 140-144 35.63855 37.0 37.0 37.0 37.0 37.0 145-149 35.4847 37.0 37.0 37.0 37.0 37.0 150-151 35.206 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 1.0 13 5.0 14 5.0 15 6.0 16 3.0 17 4.0 18 3.0 19 3.0 20 5.0 21 0.0 22 10.0 23 1.0 24 7.0 25 8.0 26 12.0 27 14.0 28 14.0 29 26.0 30 18.0 31 37.0 32 45.0 33 75.0 34 123.0 35 359.0 36 2661.0 37 554.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 50.425 27.900000000000002 5.800000000000001 15.875 2 29.725 24.425 28.299999999999997 17.549999999999997 3 20.7 28.349999999999998 33.675 17.275 4 25.424999999999997 34.025 22.25 18.3 5 25.85 36.3 21.349999999999998 16.5 6 20.875 40.2 21.2 17.724999999999998 7 21.224999999999998 23.425 37.225 18.125 8 20.525 25.575 28.375 25.525 9 22.875 24.099999999999998 30.375000000000004 22.650000000000002 10-14 23.805 29.049999999999997 26.700000000000003 20.445 15-19 24.235 27.47 27.67 20.625 20-24 23.705000000000002 28.615000000000002 27.145000000000003 20.535 25-29 24.025 27.915 27.485 20.575 30-34 23.419999999999998 27.47 28.315 20.794999999999998 35-39 22.965 28.43 27.275 21.33 40-44 22.75 28.155 28.384999999999998 20.71 45-49 22.91 27.87 28.360000000000003 20.86 50-54 22.68 28.105000000000004 27.485 21.73 55-59 22.59 29.085 27.235 21.09 60-64 23.21 27.875 28.155 20.76 65-69 23.415 27.96 27.339999999999996 21.285 70-74 23.015 28.64 26.69 21.654999999999998 75-79 24.07 28.07 26.68 21.18 80-84 23.575 27.944999999999997 27.034999999999997 21.445 85-89 23.535 28.015 27.589999999999996 20.86 90-94 23.635 28.355000000000004 27.27 20.74 95-99 23.755000000000003 28.32 27.52 20.405 100-104 23.400000000000002 28.725 27.605 20.27 105-109 23.71 27.915 27.435 20.94 110-114 23.89 28.000000000000004 27.445000000000004 20.665 115-119 23.92119605980299 28.126406320316015 27.861393069653484 20.091004550227513 120-124 24.240000000000002 27.875 27.750000000000004 20.135 125-129 23.93 27.845 27.794999999999998 20.43 130-134 23.849999999999998 28.04 27.655 20.455000000000002 135-139 24.11 27.944999999999997 27.860000000000003 20.085 140-144 24.131206560328017 27.91139556977849 27.891394569728483 20.066003300165008 145-149 24.495 28.27 27.235 20.0 150-151 24.775 28.425 26.6 20.200000000000003 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 1.0 3 1.0 4 0.5 5 0.5 6 0.0 7 0.5 8 0.5 9 0.5 10 1.5 11 1.5 12 2.0 13 2.0 14 1.5 15 2.0 16 1.5 17 1.5 18 3.0 19 2.5 20 1.5 21 2.5 22 2.0 23 1.5 24 2.5 25 5.0 26 6.5 27 8.5 28 10.0 29 8.5 30 14.5 31 23.0 32 26.0 33 35.5 34 44.0 35 55.0 36 81.0 37 113.5 38 125.0 39 141.0 40 183.5 41 219.0 42 260.0 43 282.5 44 276.5 45 262.5 46 256.0 47 257.0 48 245.5 49 207.5 50 151.5 51 123.0 52 108.0 53 91.0 54 83.0 55 69.5 56 47.5 57 28.5 58 24.0 59 22.5 60 13.5 61 7.0 62 2.5 63 2.5 64 4.0 65 1.5 66 0.5 67 1.0 68 1.0 69 2.0 70 2.0 71 2.0 72 1.5 73 0.5 74 0.5 75 1.0 76 1.5 77 0.5 78 0.0 79 0.0 80 1.0 81 1.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 1.0 92 1.0 93 0.5 94 1.0 95 1.5 96 1.5 97 1.0 98 1.5 99 2.5 100 6.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.005 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.005 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.325 #Duplication Level Percentage of deduplicated Percentage of total 1 91.30916136174923 82.475 2 7.777470246332688 14.05 3 0.6089122612787158 1.6500000000000001 4 0.16606698034874065 0.6 5 0.05535566011624688 0.25 6 0.02767783005812344 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.05535566011624688 0.8250000000000001 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 22 0.5499999999999999 No Hit AGAACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 11 0.27499999999999997 No Hit AGAGAACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 6 0.15 No Hit GCTTCGATTAACAGCTGGTGTCTCACCTCTGTCTCTGCCTCTAAGAGATC 5 0.125 No Hit ATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAAT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0125 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.0625 0.0 0.0 0.0 0.0 46-47 0.075 0.0 0.0 0.0 0.0 48-49 0.075 0.0 0.0 0.0 0.0 50-51 0.075 0.0 0.0 0.0 0.0 52-53 0.075 0.0 0.0 0.0 0.0 54-55 0.075 0.0 0.0 0.0 0.0 56-57 0.0875 0.0 0.0 0.0 0.0 58-59 0.1 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.21250000000000002 0.0 0.0 0.0 0.0 92-93 0.25 0.0 0.0 0.0 0.0 94-95 0.35 0.0 0.0 0.0 0.0 96-97 0.4375 0.0 0.0 0.0 0.0 98-99 0.4875 0.0 0.0 0.0 0.0 100-101 0.575 0.0 0.0 0.0 0.0 102-103 0.6 0.0 0.0 0.0 0.0 104-105 0.6375 0.0 0.0 0.0 0.0 106-107 0.725 0.0 0.0 0.0 0.0 108-109 0.8 0.0 0.0 0.0 0.0 110-111 0.9624999999999999 0.0 0.0 0.0 0.0 112-113 1.0750000000000002 0.0 0.0 0.0 0.0 114-115 1.2375 0.0 0.0 0.0 0.0 116-117 1.3624999999999998 0.0 0.0 0.0 0.0 118-119 1.5125000000000002 0.0 0.0 0.0 0.0 120-121 1.6625 0.0 0.0 0.0 0.0 122-123 1.8624999999999998 0.0 0.0 0.0 0.0 124-125 2.0999999999999996 0.0 0.0 0.0 0.0 126-127 2.25 0.0 0.0 0.0 0.0 128-129 2.45 0.0 0.0 0.0 0.0 130-131 2.7 0.0 0.0 0.0 0.0 132-133 2.7874999999999996 0.0 0.0 0.0 0.0 134-135 2.95 0.0 0.0 0.0 0.0 136-137 3.175 0.0 0.0 0.0 0.0 138-139 3.375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 672905 spots for SRR12671032.sra Written 672905 spots for SRR12671032.sra Read 672905 spots for SRR12671032.sra Written 672905 spots for SRR12671032.sra Read 672905 spots for SRR12671032.sra Written 672905 spots for SRR12671032.sra Read 672905 spots for SRR12671032.sra Written 672905 spots for SRR12671032.sra Read 672905 spots for SRR12671032.sra Written 672905 spots for SRR12671032.sra Read 672905 spots for SRR12671032.sra Written 672905 spots for SRR12671032.sra Read 672905 spots for SRR12671032.sra Written 672905 spots for SRR12671032.sra Read 672905 spots for SRR12671032.sra Written 672905 spots for SRR12671032.sra Read 672905 spots for SRR12671032.sra Written 672905 spots for SRR12671032.sra Read 672905 spots for SRR12671032.sra Written 672905 spots for SRR12671032.sra Read 672905 spots for SRR12671032.sra Written 672905 spots for SRR12671032.sra Read 672905 spots for SRR12671032.sra Written 672905 spots for SRR12671032.sra Read 672905 spots for SRR12671032.sra Written 672905 spots for SRR12671032.sra Read 672905 spots for SRR12671032.sra Written 672905 spots for SRR12671032.sra Read 672905 spots for SRR12671032.sra Written 672905 spots for SRR12671032.sra Read 672905 spots for SRR12671032.sra Written 672905 spots for SRR12671032.sra Read 672915 spots for SRR12671032.sra Written 672915 spots for SRR12671032.sra Read 672905 spots for SRR12671032.sra Written 672905 spots for SRR12671032.sra Read 672905 spots for SRR12671032.sra Written 672905 spots for SRR12671032.sra Read 672905 spots for SRR12671032.sra Written 672905 spots for SRR12671032.sra SRR ids: ['SRR12671032.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_7om3nex1 SRR12671032.sra spots: 13458110 blocks: [[1, 672905], [672906, 1345810], [1345811, 2018715], [2018716, 2691620], [2691621, 3364525], [3364526, 4037430], [4037431, 4710335], [4710336, 5383240], [5383241, 6056145], [6056146, 6729050], [6729051, 7401955], [7401956, 8074860], [8074861, 8747765], [8747766, 9420670], [9420671, 10093575], [10093576, 10766480], [10766481, 11439385], [11439386, 12112290], [12112291, 12785195], [12785196, 13458110]] SRR12671032 file size 4551954 SRR12671032 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671032 SRR12671032_1.fastq SRR12671032_2.fastq Input file: SRR12671032_1.fastq Paired file: SRR12671032_2.fastq trimmed: SRR12671032-trimmed-pair1.fastq, SRR12671032-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 14:11:02 2025 >> started Tue Feb 11 14:11:17 2025 >> done (14.849s) 13458110 read pairs processed; of these: 105 ( 0.00%) short read pairs filtered out after trimming by size control 15873 ( 0.12%) empty read pairs filtered out after trimming by size control 13442132 (99.88%) read pairs available; of these: 667300 ( 4.96%) trimmed read pairs available after processing 12774832 (95.04%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 6 0.00% 20 18 0.00% 21 13 0.00% 22 16 0.00% 23 19 0.00% 24 13 0.00% 25 15 0.00% 26 25 0.00% 27 20 0.00% 28 37 0.00% 29 25 0.00% 30 27 0.00% 31 25 0.00% 32 28 0.00% 33 19 0.00% 34 20 0.00% 35 29 0.00% 36 24 0.00% 37 23 0.00% 38 19 0.00% 39 21 0.00% 40 31 0.00% 41 20 0.00% 42 32 0.00% 43 29 0.00% 44 34 0.00% 45 26 0.00% 46 33 0.00% 47 38 0.00% 48 46 0.00% 49 35 0.00% 50 52 0.00% 51 47 0.00% 52 55 0.00% 53 62 0.00% 54 68 0.00% 55 53 0.00% 56 85 0.00% 57 90 0.00% 58 101 0.00% 59 91 0.00% 60 136 0.00% 61 135 0.00% 62 164 0.00% 63 166 0.00% 64 179 0.00% 65 176 0.00% 66 199 0.00% 67 232 0.00% 68 259 0.00% 69 280 0.00% 70 361 0.00% 71 367 0.00% 72 496 0.00% 73 511 0.00% 74 553 0.00% 75 596 0.00% 76 645 0.00% 77 754 0.01% 78 741 0.01% 79 836 0.01% 80 956 0.01% 81 1153 0.01% 82 1198 0.01% 83 1328 0.01% 84 1612 0.01% 85 1587 0.01% 86 1692 0.01% 87 1803 0.01% 88 2012 0.01% 89 2151 0.02% 90 2291 0.02% 91 2397 0.02% 92 2716 0.02% 93 2777 0.02% 94 3082 0.02% 95 3335 0.02% 96 3490 0.03% 97 3704 0.03% 98 3796 0.03% 99 4148 0.03% 100 4214 0.03% 101 4399 0.03% 102 4753 0.04% 103 4924 0.04% 104 5186 0.04% 105 5475 0.04% 106 5769 0.04% 107 5797 0.04% 108 6329 0.05% 109 6215 0.05% 110 6485 0.05% 111 6669 0.05% 112 7034 0.05% 113 7370 0.05% 114 7494 0.06% 115 7959 0.06% 116 8430 0.06% 117 8624 0.06% 118 9175 0.07% 119 9333 0.07% 120 9652 0.07% 121 10105 0.08% 122 10209 0.08% 123 10698 0.08% 124 11134 0.08% 125 11066 0.08% 126 11920 0.09% 127 12310 0.09% 128 12453 0.09% 129 13008 0.10% 130 13108 0.10% 131 13633 0.10% 132 13814 0.10% 133 14207 0.11% 134 14588 0.11% 135 15285 0.11% 136 15894 0.12% 137 15920 0.12% 138 16343 0.12% 139 17468 0.13% 140 17277 0.13% 141 17883 0.13% 142 18382 0.14% 143 18602 0.14% 144 19357 0.14% 145 19381 0.14% 146 20067 0.15% 147 20534 0.15% 148 21219 0.16% 149 21345 0.16% 150 22315 0.17% 151 12774832 95.04% 13442132 reads passed initial QC criterion=sequence-density sequence-density=0.68 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=20 prefix-density=0.66 prefix-fanout=2.0 sequence=TTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=149.01 fanout-score-rank=1 prefix-density=0.16 prefix-fanout=10.0 sequence=TCTCCAAAAACCCAATAAAAAAGGAAGAGGTAAAGCATTTTGCCAAGGTCTAAGTACAATTTAAACAAACCACCCCTAAGGCCCTAACAGATATAGCTAGGGACACATCAAGTTCTGGGACGACTTAGACACCTTTCGGCTTGGCGGCAATAAAGCTGATGCACTGCACTTGACG criterion=sequence-density sequence-density=0.89 sequence-density-rank=1 fanout-score=2.15 fanout-score-rank=30 prefix-density=0.91 prefix-fanout=2.1 sequence=CCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=55.16 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=8.2 sequence=AAACCCAAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTCCTCCCCTTCGCTAGCCGGAAAGGCGGTGAAGCTCAACCCCTCCTCCTCTGAGATCATGGGCAATGGCCGTGTCTCCATGAGGAAAACCACCAAGCCTGTTCCCTCCGGGAGCCCATGGTACGGACCAGACCGTGTTAAATACTTGGGCCCGTTCTCTGGTGAGCCCCCATCCTACTTGACTGGTGAGTTCCCTGG SRR12671032 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 14:12:02 Started mapping on | Feb 11 14:12:02 Finished on | Feb 11 14:13:39 Mapping speed, Million of reads per hour | 498.88 Number of input reads | 13442132 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 12283436 Uniquely mapped reads % | 91.38% Average mapped length | 298.06 Number of splices: Total | 12589857 Number of splices: Annotated (sjdb) | 12327959 Number of splices: GT/AG | 12341027 Number of splices: GC/AG | 207748 Number of splices: AT/AC | 7651 Number of splices: Non-canonical | 33431 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 2.81 Insertion rate per base | 0.02% Insertion average length | 2.27 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 299499 % of reads mapped to multiple loci | 2.23% Number of reads mapped to too many loci | 142384 % of reads mapped to too many loci | 1.06% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.01% % of reads unmapped: other | 0.32% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 859197 859197 859197 N_multimapping 299499 299499 299499 N_noFeature 520553 12061049 584633 N_ambiguous 233225 954 74353 UnstrandedReadsAssigned:11529658 PositiveStrandReadsAssigned:221433 NegativeStrandReadsAssigned:11624450 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671032 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671032-trimmed-pair1.fastq SRR12671032-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,442,132 reads, 11,691,228 reads pseudoaligned [quant] estimated average fragment length: 291.854 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,080 rounds 52401 SRR12671032.ke.tsv 34699 SRR12671032.se.tsv 87100 total ==> SRR12671032.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1727.15 466 18.5583 Potri.005G024800.1.v4.1 1035 744.146 119 10.9994 Potri.004G059700.1.v4.1 961 670.44 6 0.615561 Potri.007G009000.2.v4.1 1416 1125.15 0 0 Potri.003G141000.2.v4.1 2943 2652.15 631 16.3649 Potri.016G087400.1.v4.1 270 71.8454 470 449.965 Potri.015G069301.1.v4.1 564 292.883 0 0 Potri.010G195200.1.v4.1 1773 1482.15 28 1.29941 Potri.012G127500.1.v4.1 977 686.29 75 7.51681 ==> SRR12671032.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 180 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 177 Potri.001G212900.v4.1 13 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 4 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 6 SRR12671032 completed mapping pipeline successfully