Starting /dee2/code/volunteer_pipeline.sh SRR12671033 current disk space = 3049849339904 free memory = 1020658548 SRR12671033 SRAfilesize 28eb7f800a9557f6f25dad677feda8e2 SRR12671033.sra SRR12671033.sra file validated SRR12671033 is paired end SRR12671033 is conventional basespace SRR12671033 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671033_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4315 37.0 37.0 37.0 37.0 37.0 2 36.4325 37.0 37.0 37.0 37.0 37.0 3 36.487 37.0 37.0 37.0 37.0 37.0 4 36.6005 37.0 37.0 37.0 37.0 37.0 5 36.612 37.0 37.0 37.0 37.0 37.0 6 36.6025 37.0 37.0 37.0 37.0 37.0 7 36.6 37.0 37.0 37.0 37.0 37.0 8 36.566 37.0 37.0 37.0 37.0 37.0 9 36.5935 37.0 37.0 37.0 37.0 37.0 10-14 36.632600000000004 37.0 37.0 37.0 37.0 37.0 15-19 36.577799999999996 37.0 37.0 37.0 37.0 37.0 20-24 36.573299999999996 37.0 37.0 37.0 37.0 37.0 25-29 36.5297 37.0 37.0 37.0 37.0 37.0 30-34 36.4409 37.0 37.0 37.0 37.0 37.0 35-39 36.4334 37.0 37.0 37.0 37.0 37.0 40-44 36.4531 37.0 37.0 37.0 37.0 37.0 45-49 36.423500000000004 37.0 37.0 37.0 37.0 37.0 50-54 36.417899999999996 37.0 37.0 37.0 37.0 37.0 55-59 36.391000000000005 37.0 37.0 37.0 37.0 37.0 60-64 36.3669 37.0 37.0 37.0 37.0 37.0 65-69 36.3836 37.0 37.0 37.0 37.0 37.0 70-74 36.3254 37.0 37.0 37.0 37.0 37.0 75-79 36.309999999999995 37.0 37.0 37.0 37.0 37.0 80-84 36.3118 37.0 37.0 37.0 37.0 37.0 85-89 36.2412 37.0 37.0 37.0 37.0 37.0 90-94 36.23459999999999 37.0 37.0 37.0 37.0 37.0 95-99 36.232299999999995 37.0 37.0 37.0 37.0 37.0 100-104 36.1846 37.0 37.0 37.0 37.0 37.0 105-109 36.143 37.0 37.0 37.0 37.0 37.0 110-114 36.1664 37.0 37.0 37.0 37.0 37.0 115-119 36.11605 37.0 37.0 37.0 37.0 37.0 120-124 36.0971 37.0 37.0 37.0 37.0 37.0 125-129 36.0508 37.0 37.0 37.0 37.0 37.0 130-134 35.933499999999995 37.0 37.0 37.0 37.0 37.0 135-139 35.9302 37.0 37.0 37.0 37.0 37.0 140-144 35.8681 37.0 37.0 37.0 37.0 37.0 145-149 35.752700000000004 37.0 37.0 37.0 37.0 37.0 150-151 35.6525 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 1.0 20 1.0 21 1.0 22 3.0 23 0.0 24 2.0 25 4.0 26 8.0 27 13.0 28 15.0 29 15.0 30 20.0 31 40.0 32 57.0 33 74.0 34 107.0 35 255.0 36 2733.0 37 650.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.84842421210605 12.706353176588294 5.427713856928464 35.01750875437719 2 20.724999999999998 10.775 35.199999999999996 33.300000000000004 3 17.75 15.15 28.125 38.975 4 21.425 20.974999999999998 25.900000000000002 31.7 5 23.65 28.65 26.125 21.575 6 22.400000000000002 31.624999999999996 23.05 22.925 7 15.85 27.175 39.475 17.5 8 16.75 27.1 32.5 23.65 9 17.875 24.075 35.175 22.875 10-14 19.39 30.130000000000003 28.435 22.045 15-19 19.685 28.785 27.860000000000003 23.669999999999998 20-24 20.7 28.365000000000002 28.189999999999998 22.745 25-29 20.085 28.46 27.87 23.585 30-34 21.060000000000002 28.52 27.02 23.400000000000002 35-39 19.895 28.725 28.04 23.34 40-44 20.26 29.404999999999998 27.155 23.18 45-49 19.945 28.349999999999998 27.779999999999998 23.925 50-54 19.545 28.83 27.665 23.96 55-59 19.994999999999997 29.544999999999998 27.485 22.975 60-64 20.435 28.599999999999998 27.98 22.985 65-69 20.11 28.315 27.345000000000002 24.23 70-74 20.205000000000002 28.610000000000003 27.265 23.919999999999998 75-79 20.25 28.88 27.61 23.26 80-84 20.955 28.265 27.735 23.044999999999998 85-89 20.595 28.34 27.295 23.77 90-94 20.044999999999998 28.444999999999997 27.62 23.89 95-99 19.98 28.439999999999998 27.889999999999997 23.69 100-104 20.22 29.095 26.76 23.925 105-109 20.195 28.199999999999996 27.38 24.224999999999998 110-114 20.485 28.189999999999998 27.58 23.745 115-119 20.696034801740087 28.291414570728534 27.806390319515977 23.2061603080154 120-124 20.865000000000002 27.800000000000004 27.765 23.57 125-129 20.78 27.860000000000003 27.71 23.65 130-134 20.485 28.645 27.200000000000003 23.669999999999998 135-139 20.865000000000002 28.03 26.955000000000002 24.15 140-144 20.495 27.425 28.139999999999997 23.94 145-149 21.101330399119735 28.203461038311495 26.928078423527058 23.76713013904171 150-151 21.099999999999998 28.025 27.400000000000002 23.474999999999998 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 1.0 6 1.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 1.5 16 1.0 17 0.0 18 0.5 19 1.5 20 1.5 21 3.5 22 4.0 23 1.5 24 2.5 25 5.0 26 5.0 27 6.5 28 10.5 29 18.0 30 22.5 31 25.0 32 31.0 33 46.5 34 57.5 35 67.5 36 90.0 37 111.5 38 137.0 39 159.5 40 179.5 41 195.5 42 216.5 43 240.0 44 244.5 45 240.5 46 258.5 47 273.0 48 248.0 49 196.5 50 166.0 51 157.5 52 133.5 53 106.0 54 80.0 55 65.5 56 59.5 57 40.5 58 25.5 59 20.5 60 13.0 61 6.0 62 4.5 63 6.5 64 3.5 65 2.0 66 1.5 67 1.0 68 1.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.005 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.03 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.45 #Duplication Level Percentage of deduplicated Percentage of total 1 91.12769485903814 82.425 2 7.545605306799337 13.65 3 1.077943615257048 2.9250000000000003 4 0.19347705914870095 0.7000000000000001 5 0.0 0.0 6 0.055279159756771695 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCCCAGTAGAATTTCTCCATACGACCATCACGGATAAGAGGAGCATACAA 6 0.15 No Hit CCACACCAGAGGCCACAGACATGGCCAATACATAACAATGAAGAAGACAC 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.1875 0.0 0.0 0.0 0.0 96-97 0.2 0.0 0.0 0.0 0.0 98-99 0.225 0.0 0.0 0.0 0.0 100-101 0.3125 0.0 0.0 0.0 0.0 102-103 0.375 0.0 0.0 0.0 0.0 104-105 0.6 0.0 0.0 0.0 0.0 106-107 0.6375 0.0 0.0 0.0 0.0 108-109 0.6875 0.0 0.0 0.0 0.0 110-111 0.8 0.0 0.0 0.0 0.0 112-113 0.9375 0.0 0.0 0.0 0.0 114-115 1.1375000000000002 0.0 0.0 0.0 0.0 116-117 1.2875 0.0 0.0 0.0 0.0 118-119 1.4625 0.0 0.0 0.0 0.0 120-121 1.5625 0.0 0.0 0.0 0.0 122-123 1.75 0.0 0.0 0.0 0.0 124-125 1.95 0.0 0.0 0.0 0.0 126-127 2.25 0.0 0.0 0.0 0.0 128-129 2.4375 0.0 0.0 0.0 0.0 130-131 2.75 0.0 0.0 0.0 0.0 132-133 2.9875 0.0 0.0 0.0 0.0 134-135 3.125 0.0 0.0 0.0 0.0 136-137 3.2875 0.0 0.0 0.0 0.0 138-139 3.5250000000000004 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGCCAAC 10 0.006830828 145.0 3 ATCGCCA 10 0.006830828 145.0 1 ACAGGAC 10 0.006830828 145.0 8 CAGGACT 10 0.006830828 145.0 9 CAACGAG 10 0.006830828 145.0 8 CTCCAAT 30 0.0017973486 72.5 145 >>END_MODULE SRR12671033 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671033_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.142 37.0 37.0 37.0 37.0 37.0 2 36.3575 37.0 37.0 37.0 37.0 37.0 3 36.373 37.0 37.0 37.0 37.0 37.0 4 36.352 37.0 37.0 37.0 37.0 37.0 5 36.496 37.0 37.0 37.0 37.0 37.0 6 36.4575 37.0 37.0 37.0 37.0 37.0 7 36.497 37.0 37.0 37.0 37.0 37.0 8 36.5155 37.0 37.0 37.0 37.0 37.0 9 36.408 37.0 37.0 37.0 37.0 37.0 10-14 36.484899999999996 37.0 37.0 37.0 37.0 37.0 15-19 36.46510000000001 37.0 37.0 37.0 37.0 37.0 20-24 36.500099999999996 37.0 37.0 37.0 37.0 37.0 25-29 36.3558 37.0 37.0 37.0 37.0 37.0 30-34 36.4004 37.0 37.0 37.0 37.0 37.0 35-39 36.3385 37.0 37.0 37.0 37.0 37.0 40-44 36.3586 37.0 37.0 37.0 37.0 37.0 45-49 36.3042 37.0 37.0 37.0 37.0 37.0 50-54 36.35079999999999 37.0 37.0 37.0 37.0 37.0 55-59 36.3343 37.0 37.0 37.0 37.0 37.0 60-64 36.30129999999999 37.0 37.0 37.0 37.0 37.0 65-69 36.2856 37.0 37.0 37.0 37.0 37.0 70-74 36.257799999999996 37.0 37.0 37.0 37.0 37.0 75-79 36.157599999999995 37.0 37.0 37.0 37.0 37.0 80-84 36.21900000000001 37.0 37.0 37.0 37.0 37.0 85-89 36.158550000000005 37.0 37.0 37.0 37.0 37.0 90-94 36.1796 37.0 37.0 37.0 37.0 37.0 95-99 36.209 37.0 37.0 37.0 37.0 37.0 100-104 36.1654 37.0 37.0 37.0 37.0 37.0 105-109 36.094100000000005 37.0 37.0 37.0 37.0 37.0 110-114 36.120400000000004 37.0 37.0 37.0 37.0 37.0 115-119 36.1046 37.0 37.0 37.0 37.0 37.0 120-124 35.9846 37.0 37.0 37.0 37.0 37.0 125-129 35.9384 37.0 37.0 37.0 37.0 37.0 130-134 35.950199999999995 37.0 37.0 37.0 37.0 37.0 135-139 35.91029999999999 37.0 37.0 37.0 37.0 37.0 140-144 35.87069999999999 37.0 37.0 37.0 37.0 37.0 145-149 35.7124 37.0 37.0 37.0 37.0 37.0 150-151 35.442499999999995 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 2.0 14 2.0 15 0.0 16 1.0 17 0.0 18 1.0 19 1.0 20 1.0 21 1.0 22 2.0 23 2.0 24 1.0 25 3.0 26 6.0 27 17.0 28 9.0 29 14.0 30 28.0 31 28.0 32 46.0 33 65.0 34 121.0 35 380.0 36 2679.0 37 589.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.125 26.25 8.799999999999999 22.825 2 29.65 25.85 29.075 15.425 3 19.375 28.275 34.325 18.025 4 23.400000000000002 32.125 25.75 18.725 5 25.0 37.15 21.525 16.325 6 19.55 40.575 22.275 17.599999999999998 7 21.025 22.900000000000002 38.125 17.95 8 19.675 26.375 29.575000000000003 24.375 9 21.925 25.074999999999996 30.475 22.525000000000002 10-14 23.71 29.955 25.545 20.79 15-19 23.855 28.155 27.139999999999997 20.849999999999998 20-24 23.505000000000003 28.744999999999997 27.295 20.455000000000002 25-29 23.119999999999997 28.465 27.529999999999998 20.885 30-34 22.74 28.155 27.74 21.365000000000002 35-39 22.53 27.935 28.1 21.435000000000002 40-44 23.9 27.800000000000004 27.994999999999997 20.305 45-49 22.884999999999998 28.215 27.845 21.055 50-54 22.935 28.4 27.54 21.125 55-59 22.945 27.615000000000002 27.644999999999996 21.795 60-64 23.09 27.445000000000004 27.955000000000002 21.51 65-69 23.02 26.82 29.145 21.015 70-74 23.555 27.52 27.74 21.185000000000002 75-79 23.53 27.915 27.805000000000003 20.75 80-84 22.86 27.715 28.07 21.355 85-89 23.891194559727985 27.861393069653484 27.366368318415923 20.88104405220261 90-94 23.630000000000003 27.88 27.41 21.08 95-99 23.285 27.565 28.155 20.995 100-104 23.175 29.330000000000002 26.655 20.84 105-109 23.150000000000002 27.73 27.765 21.355 110-114 23.974999999999998 28.26 27.505000000000003 20.26 115-119 23.709741948389677 27.885577115423082 27.455491098219643 20.949189837967594 120-124 23.405 28.060000000000002 27.73 20.805 125-129 23.835 27.639999999999997 27.38 21.145 130-134 24.075 27.474999999999998 27.889999999999997 20.560000000000002 135-139 24.435000000000002 27.265 28.025 20.275000000000002 140-144 23.90478095619124 27.71054210842168 27.970594118823765 20.41408281656331 145-149 24.775 27.775 27.145000000000003 20.305 150-151 25.4375 27.987499999999997 27.187499999999996 19.3875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 1.0 20 1.0 21 0.5 22 1.0 23 1.5 24 5.0 25 7.0 26 6.5 27 8.0 28 8.0 29 9.0 30 15.0 31 20.0 32 22.0 33 28.5 34 37.5 35 57.0 36 79.0 37 95.0 38 124.5 39 154.5 40 196.5 41 230.5 42 250.0 43 265.0 44 278.5 45 278.5 46 272.5 47 271.0 48 254.0 49 230.5 50 178.5 51 137.0 52 112.0 53 87.0 54 71.5 55 55.5 56 39.0 57 27.5 58 24.5 59 21.0 60 13.5 61 6.5 62 5.0 63 3.0 64 1.0 65 1.5 66 0.5 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.5 95 0.5 96 0.0 97 0.0 98 0.0 99 0.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.005 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.02 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.02 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.10000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 90.64927857935628 81.675 2 7.963374028856826 14.35 3 1.1653718091009988 3.15 4 0.1942286348501665 0.7000000000000001 5 0.02774694783573807 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTGAAAAGGAGGCAGTGAACGTGTCCCTTGGACACTTGCTAACCTACCCG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.1875 0.0 0.0 0.0 0.0 96-97 0.2 0.0 0.0 0.0 0.0 98-99 0.225 0.0 0.0 0.0 0.0 100-101 0.3125 0.0 0.0 0.0 0.0 102-103 0.375 0.0 0.0 0.0 0.0 104-105 0.6 0.0 0.0 0.0 0.0 106-107 0.6375 0.0 0.0 0.0 0.0 108-109 0.6875 0.0 0.0 0.0 0.0 110-111 0.8125 0.0 0.0 0.0 0.0 112-113 0.95 0.0 0.0 0.0 0.0 114-115 1.1375000000000002 0.0 0.0 0.0 0.0 116-117 1.2875 0.0 0.0 0.0 0.0 118-119 1.4625 0.0 0.0 0.0 0.0 120-121 1.5625 0.0 0.0 0.0 0.0 122-123 1.75 0.0 0.0 0.0 0.0 124-125 1.9375 0.0 0.0 0.0 0.0 126-127 2.2249999999999996 0.0 0.0 0.0 0.0 128-129 2.4125 0.0 0.0 0.0 0.0 130-131 2.7375 0.0 0.0 0.0 0.0 132-133 2.9625 0.0 0.0 0.0 0.0 134-135 3.0999999999999996 0.0 0.0 0.0 0.0 136-137 3.2750000000000004 0.0 0.0 0.0 0.0 138-139 3.5250000000000004 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTCAAG 10 0.006830828 145.0 6 GATTTTG 10 0.006830828 145.0 5 CAGTGCT 10 0.006830828 145.0 6 GAAAGGA 10 0.006830828 145.0 7 >>END_MODULE Read 1047279 spots for SRR12671033.sra Written 1047279 spots for SRR12671033.sra Read 1047279 spots for SRR12671033.sra Written 1047279 spots for SRR12671033.sra Read 1047279 spots for SRR12671033.sra Written 1047279 spots for SRR12671033.sra Read 1047279 spots for SRR12671033.sra Written 1047279 spots for SRR12671033.sra Read 1047279 spots for SRR12671033.sra Written 1047279 spots for SRR12671033.sra Read 1047279 spots for SRR12671033.sra Written 1047279 spots for SRR12671033.sra Read 1047279 spots for SRR12671033.sra Written 1047279 spots for SRR12671033.sra Read 1047279 spots for SRR12671033.sra Written 1047279 spots for SRR12671033.sra Read 1047279 spots for SRR12671033.sra Written 1047279 spots for SRR12671033.sra Read 1047279 spots for SRR12671033.sra Written 1047279 spots for SRR12671033.sra Read 1047279 spots for SRR12671033.sra Written 1047279 spots for SRR12671033.sra Read 1047279 spots for SRR12671033.sra Written 1047279 spots for SRR12671033.sra Read 1047279 spots for SRR12671033.sra Written 1047279 spots for SRR12671033.sra Read 1047279 spots for SRR12671033.sra Written 1047279 spots for SRR12671033.sra Read 1047279 spots for SRR12671033.sra Written 1047279 spots for SRR12671033.sra Read 1047279 spots for SRR12671033.sra Written 1047279 spots for SRR12671033.sra Read 1047279 spots for SRR12671033.sra Written 1047279 spots for SRR12671033.sra Read 1047279 spots for SRR12671033.sra Written 1047279 spots for SRR12671033.sra Read 1047279 spots for SRR12671033.sra Written 1047279 spots for SRR12671033.sra Read 1047291 spots for SRR12671033.sra Written 1047291 spots for SRR12671033.sra SRR ids: ['SRR12671033.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_shvhcra1 SRR12671033.sra spots: 20945592 blocks: [[1, 1047279], [1047280, 2094558], [2094559, 3141837], [3141838, 4189116], [4189117, 5236395], [5236396, 6283674], [6283675, 7330953], [7330954, 8378232], [8378233, 9425511], [9425512, 10472790], [10472791, 11520069], [11520070, 12567348], [12567349, 13614627], [13614628, 14661906], [14661907, 15709185], [15709186, 16756464], [16756465, 17803743], [17803744, 18851022], [18851023, 19898301], [19898302, 20945592]] SRR12671033 file size 7096528 SRR12671033 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671033 SRR12671033_1.fastq SRR12671033_2.fastq Input file: SRR12671033_1.fastq Paired file: SRR12671033_2.fastq trimmed: SRR12671033-trimmed-pair1.fastq, SRR12671033-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 14:45:31 2025 >> started Tue Feb 11 14:45:55 2025 >> done (23.935s) 20945592 read pairs processed; of these: 33 ( 0.00%) short read pairs filtered out after trimming by size control 3332 ( 0.02%) empty read pairs filtered out after trimming by size control 20942227 (99.98%) read pairs available; of these: 1196665 ( 5.71%) trimmed read pairs available after processing 19745562 (94.29%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 8 0.00% 20 6 0.00% 21 4 0.00% 22 10 0.00% 23 14 0.00% 24 11 0.00% 25 12 0.00% 26 14 0.00% 27 14 0.00% 28 22 0.00% 29 14 0.00% 30 14 0.00% 31 9 0.00% 32 25 0.00% 33 16 0.00% 34 16 0.00% 35 24 0.00% 36 18 0.00% 37 23 0.00% 38 28 0.00% 39 29 0.00% 40 30 0.00% 41 40 0.00% 42 25 0.00% 43 33 0.00% 44 23 0.00% 45 34 0.00% 46 36 0.00% 47 29 0.00% 48 38 0.00% 49 59 0.00% 50 48 0.00% 51 68 0.00% 52 70 0.00% 53 82 0.00% 54 70 0.00% 55 89 0.00% 56 110 0.00% 57 109 0.00% 58 137 0.00% 59 132 0.00% 60 205 0.00% 61 194 0.00% 62 196 0.00% 63 221 0.00% 64 270 0.00% 65 294 0.00% 66 326 0.00% 67 312 0.00% 68 371 0.00% 69 433 0.00% 70 524 0.00% 71 573 0.00% 72 670 0.00% 73 774 0.00% 74 952 0.00% 75 931 0.00% 76 1020 0.00% 77 1156 0.01% 78 1340 0.01% 79 1453 0.01% 80 1564 0.01% 81 1756 0.01% 82 1976 0.01% 83 2160 0.01% 84 2428 0.01% 85 2622 0.01% 86 2996 0.01% 87 3071 0.01% 88 3335 0.02% 89 3626 0.02% 90 3864 0.02% 91 4105 0.02% 92 4510 0.02% 93 4755 0.02% 94 5170 0.02% 95 5677 0.03% 96 6091 0.03% 97 6395 0.03% 98 6641 0.03% 99 7043 0.03% 100 7536 0.04% 101 7821 0.04% 102 8304 0.04% 103 8512 0.04% 104 9126 0.04% 105 9833 0.05% 106 10150 0.05% 107 10477 0.05% 108 10930 0.05% 109 11541 0.06% 110 11805 0.06% 111 12133 0.06% 112 12650 0.06% 113 13254 0.06% 114 13654 0.07% 115 14243 0.07% 116 14722 0.07% 117 15752 0.08% 118 16403 0.08% 119 16490 0.08% 120 17367 0.08% 121 18089 0.09% 122 18016 0.09% 123 19130 0.09% 124 19972 0.10% 125 20311 0.10% 126 21325 0.10% 127 21947 0.10% 128 22367 0.11% 129 23212 0.11% 130 24179 0.12% 131 24343 0.12% 132 25245 0.12% 133 26275 0.13% 134 26184 0.13% 135 27322 0.13% 136 28663 0.14% 137 28798 0.14% 138 29546 0.14% 139 31483 0.15% 140 31580 0.15% 141 32108 0.15% 142 32992 0.16% 143 33844 0.16% 144 35000 0.17% 145 35562 0.17% 146 36426 0.17% 147 36896 0.18% 148 38701 0.18% 149 39861 0.19% 150 40990 0.20% 151 19745562 94.29% 20942227 reads passed initial QC criterion=sequence-density sequence-density=0.68 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=18 prefix-density=0.68 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=23 fanout-score=12.28 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=2.6 sequence=GACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGTTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTG criterion=sequence-density sequence-density=0.85 sequence-density-rank=1 fanout-score=2.03 fanout-score-rank=23 prefix-density=0.86 prefix-fanout=2.0 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGT criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=38.83 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=2.2 sequence=GGAACTCAAACGCATAGCTTCCTACAAATACCCCAGCTAGCCAATACTCTCAACCACTAAACCCAAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTC SRR12671033 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 14:47:12 Started mapping on | Feb 11 14:47:12 Finished on | Feb 11 14:49:48 Mapping speed, Million of reads per hour | 483.28 Number of input reads | 20942227 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 19764464 Uniquely mapped reads % | 94.38% Average mapped length | 298.17 Number of splices: Total | 20416909 Number of splices: Annotated (sjdb) | 20032419 Number of splices: GT/AG | 19989240 Number of splices: GC/AG | 364179 Number of splices: AT/AC | 10933 Number of splices: Non-canonical | 52557 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.80 Insertion rate per base | 0.02% Insertion average length | 2.30 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 459894 % of reads mapped to multiple loci | 2.20% Number of reads mapped to too many loci | 42421 % of reads mapped to too many loci | 0.20% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.14% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 717869 717869 717869 N_multimapping 459894 459894 459894 N_noFeature 676907 19465954 770322 N_ambiguous 333254 1262 127551 UnstrandedReadsAssigned:18754303 PositiveStrandReadsAssigned:297248 NegativeStrandReadsAssigned:18866591 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671033 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671033-trimmed-pair1.fastq SRR12671033-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,942,227 reads, 18,815,689 reads pseudoaligned [quant] estimated average fragment length: 271.75 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,047 rounds 52401 SRR12671033.ke.tsv 34699 SRR12671033.se.tsv 87100 total ==> SRR12671033.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1747.25 454 11.602 Potri.005G024800.1.v4.1 1035 764.25 228 13.3208 Potri.004G059700.1.v4.1 961 690.388 5 0.323376 Potri.007G009000.2.v4.1 1416 1145.25 0 0 Potri.003G141000.2.v4.1 2943 2672.25 1146 19.1487 Potri.016G087400.1.v4.1 270 72.5394 992 610.618 Potri.015G069301.1.v4.1 564 305.018 0 0 Potri.010G195200.1.v4.1 1773 1502.25 55 1.63475 Potri.012G127500.1.v4.1 977 706.313 82 5.1838 ==> SRR12671033.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 161 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 321 Potri.001G212900.v4.1 4 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 5 SRR12671033 completed mapping pipeline successfully