Starting /dee2/code/volunteer_pipeline.sh SRR12671034 current disk space = 3050094161920 free memory = 1465737496 SRR12671034 SRAfilesize 250acd7e62139cdad8ded5c8a557fe57 SRR12671034.sra SRR12671034.sra file validated SRR12671034 is paired end SRR12671034 is conventional basespace SRR12671034 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671034_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.54525 37.0 37.0 37.0 37.0 37.0 2 36.374 37.0 37.0 37.0 37.0 37.0 3 36.53 37.0 37.0 37.0 37.0 37.0 4 36.573 37.0 37.0 37.0 37.0 37.0 5 36.681 37.0 37.0 37.0 37.0 37.0 6 36.5915 37.0 37.0 37.0 37.0 37.0 7 36.5865 37.0 37.0 37.0 37.0 37.0 8 36.671 37.0 37.0 37.0 37.0 37.0 9 36.6225 37.0 37.0 37.0 37.0 37.0 10-14 36.5904 37.0 37.0 37.0 37.0 37.0 15-19 36.6152 37.0 37.0 37.0 37.0 37.0 20-24 36.5527 37.0 37.0 37.0 37.0 37.0 25-29 36.536 37.0 37.0 37.0 37.0 37.0 30-34 36.4747 37.0 37.0 37.0 37.0 37.0 35-39 36.504999999999995 37.0 37.0 37.0 37.0 37.0 40-44 36.512899999999995 37.0 37.0 37.0 37.0 37.0 45-49 36.4884 37.0 37.0 37.0 37.0 37.0 50-54 36.443 37.0 37.0 37.0 37.0 37.0 55-59 36.4407 37.0 37.0 37.0 37.0 37.0 60-64 36.3493 37.0 37.0 37.0 37.0 37.0 65-69 36.355000000000004 37.0 37.0 37.0 37.0 37.0 70-74 36.3297 37.0 37.0 37.0 37.0 37.0 75-79 36.2988 37.0 37.0 37.0 37.0 37.0 80-84 36.2467 37.0 37.0 37.0 37.0 37.0 85-89 36.248599999999996 37.0 37.0 37.0 37.0 37.0 90-94 36.2458 37.0 37.0 37.0 37.0 37.0 95-99 36.2412 37.0 37.0 37.0 37.0 37.0 100-104 36.2047 37.0 37.0 37.0 37.0 37.0 105-109 36.1922 37.0 37.0 37.0 37.0 37.0 110-114 36.1367 37.0 37.0 37.0 37.0 37.0 115-119 36.139599999999994 37.0 37.0 37.0 37.0 37.0 120-124 35.982099999999996 37.0 37.0 37.0 37.0 37.0 125-129 35.998599999999996 37.0 37.0 37.0 37.0 37.0 130-134 35.8442 37.0 37.0 37.0 37.0 37.0 135-139 35.8746 37.0 37.0 37.0 37.0 37.0 140-144 35.904900000000005 37.0 37.0 37.0 37.0 37.0 145-149 35.7139 37.0 37.0 37.0 37.0 37.0 150-151 35.45525 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 2.0 20 0.0 21 1.0 22 0.0 23 5.0 24 2.0 25 2.0 26 5.0 27 4.0 28 16.0 29 25.0 30 31.0 31 40.0 32 53.0 33 67.0 34 113.0 35 249.0 36 2759.0 37 626.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.4333583395849 10.37759439859965 6.101525381345336 50.08752188047012 2 15.375 10.875 41.699999999999996 32.05 3 16.475 14.95 26.924999999999997 41.65 4 21.85 21.675 23.05 33.425 5 23.7 29.65 23.974999999999998 22.675 6 19.375 34.375 24.65 21.6 7 14.075 25.624999999999996 42.6 17.7 8 16.25 25.874999999999996 34.0 23.875 9 15.525 23.775 37.25 23.45 10-14 19.465 29.94 28.435 22.16 15-19 18.925 27.855 28.205000000000002 25.014999999999997 20-24 19.66 28.595 28.125 23.62 25-29 19.835 28.07 28.199999999999996 23.895 30-34 19.025 28.854999999999997 27.495000000000005 24.625 35-39 20.26 27.785 27.93 24.025 40-44 20.645 28.21 27.63 23.515 45-49 20.035 28.79 27.355 23.82 50-54 19.985 28.525 27.73 23.76 55-59 19.525000000000002 28.77 28.13 23.575 60-64 20.064999999999998 28.215 27.689999999999998 24.03 65-69 19.81 28.07 28.16 23.96 70-74 20.105 28.255000000000003 27.575 24.065 75-79 19.64 28.285 28.125 23.95 80-84 20.28 27.735 28.415000000000003 23.57 85-89 20.105 28.405 27.794999999999998 23.695 90-94 20.45 27.939999999999998 28.26 23.35 95-99 20.125 28.38 28.1 23.395 100-104 20.86 28.71 27.375 23.055 105-109 20.395 27.529999999999998 28.07 24.005000000000003 110-114 19.84 28.444999999999997 27.334999999999997 24.38 115-119 20.805 28.455000000000002 27.884999999999998 22.855 120-124 20.04 27.825 28.439999999999998 23.695 125-129 20.935000000000002 28.305000000000003 27.615000000000002 23.145 130-134 20.69 28.38 28.044999999999998 22.884999999999998 135-139 20.45 28.225 27.825 23.5 140-144 20.875 28.185 27.32 23.62 145-149 20.82 28.285 27.245 23.65 150-151 20.525 29.1375 27.237499999999997 23.1 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 1.0 3 1.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.5 15 1.0 16 0.5 17 0.0 18 0.0 19 0.5 20 0.5 21 0.5 22 2.0 23 2.5 24 4.0 25 4.5 26 6.5 27 8.0 28 8.5 29 11.0 30 16.5 31 24.0 32 30.5 33 40.5 34 54.5 35 75.0 36 92.0 37 101.0 38 117.5 39 148.0 40 194.0 41 221.0 42 233.5 43 250.0 44 269.0 45 270.0 46 261.0 47 241.5 48 218.0 49 210.5 50 192.5 51 159.5 52 133.5 53 105.0 54 74.5 55 56.0 56 37.0 57 32.5 58 28.5 59 19.0 60 12.0 61 9.0 62 8.0 63 5.5 64 1.5 65 0.5 66 0.0 67 1.0 68 1.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.025 #Duplication Level Percentage of deduplicated Percentage of total 1 91.23867069486404 83.05 2 7.772589947816535 14.149999999999999 3 0.8788794287283713 2.4 4 0.10985992859104642 0.4 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.2 0.0 0.0 0.0 0.0 94-95 0.2375 0.0 0.0 0.0 0.0 96-97 0.275 0.0 0.0 0.0 0.0 98-99 0.275 0.0 0.0 0.0 0.0 100-101 0.4 0.0 0.0 0.0 0.0 102-103 0.55 0.0 0.0 0.0 0.0 104-105 0.6375 0.0 0.0 0.0 0.0 106-107 0.7625 0.0 0.0 0.0 0.0 108-109 0.8625 0.0 0.0 0.0 0.0 110-111 0.9375 0.0 0.0 0.0 0.0 112-113 1.0125 0.0 0.0 0.0 0.0 114-115 1.2125 0.0 0.0 0.0 0.0 116-117 1.45 0.0 0.0 0.0 0.0 118-119 1.675 0.0 0.0 0.0 0.0 120-121 1.9125 0.0 0.0 0.0 0.0 122-123 2.275 0.0 0.0 0.0 0.0 124-125 2.6125 0.0 0.0 0.0 0.0 126-127 2.8375 0.0 0.0 0.0 0.0 128-129 2.975 0.0 0.0 0.0 0.0 130-131 3.1500000000000004 0.0 0.0 0.0 0.0 132-133 3.4000000000000004 0.0 0.0 0.0 0.0 134-135 3.825 0.0 0.0 0.0 0.0 136-137 4.0125 0.0 0.0 0.0 0.0 138-139 4.4 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12671034 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671034_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.384 37.0 37.0 37.0 37.0 37.0 2 36.4285 37.0 37.0 37.0 37.0 37.0 3 36.393 37.0 37.0 37.0 37.0 37.0 4 36.449 37.0 37.0 37.0 37.0 37.0 5 36.51 37.0 37.0 37.0 37.0 37.0 6 36.5315 37.0 37.0 37.0 37.0 37.0 7 36.465 37.0 37.0 37.0 37.0 37.0 8 36.4795 37.0 37.0 37.0 37.0 37.0 9 36.5205 37.0 37.0 37.0 37.0 37.0 10-14 36.5033 37.0 37.0 37.0 37.0 37.0 15-19 36.5578 37.0 37.0 37.0 37.0 37.0 20-24 36.5117 37.0 37.0 37.0 37.0 37.0 25-29 36.4513 37.0 37.0 37.0 37.0 37.0 30-34 36.4377 37.0 37.0 37.0 37.0 37.0 35-39 36.369899999999994 37.0 37.0 37.0 37.0 37.0 40-44 36.317600000000006 37.0 37.0 37.0 37.0 37.0 45-49 36.2959 37.0 37.0 37.0 37.0 37.0 50-54 36.3154 37.0 37.0 37.0 37.0 37.0 55-59 36.31570000000001 37.0 37.0 37.0 37.0 37.0 60-64 36.3136 37.0 37.0 37.0 37.0 37.0 65-69 36.3146 37.0 37.0 37.0 37.0 37.0 70-74 36.2973 37.0 37.0 37.0 37.0 37.0 75-79 36.243100000000005 37.0 37.0 37.0 37.0 37.0 80-84 36.2315 37.0 37.0 37.0 37.0 37.0 85-89 36.1928 37.0 37.0 37.0 37.0 37.0 90-94 36.212 37.0 37.0 37.0 37.0 37.0 95-99 36.1862 37.0 37.0 37.0 37.0 37.0 100-104 36.181599999999996 37.0 37.0 37.0 37.0 37.0 105-109 36.0974 37.0 37.0 37.0 37.0 37.0 110-114 36.1017 37.0 37.0 37.0 37.0 37.0 115-119 36.05890000000001 37.0 37.0 37.0 37.0 37.0 120-124 35.9806 37.0 37.0 37.0 37.0 37.0 125-129 35.9298 37.0 37.0 37.0 37.0 37.0 130-134 35.9146 37.0 37.0 37.0 37.0 37.0 135-139 35.94 37.0 37.0 37.0 37.0 37.0 140-144 35.9041 37.0 37.0 37.0 37.0 37.0 145-149 35.745 37.0 37.0 37.0 37.0 37.0 150-151 35.381 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 0.0 17 3.0 18 1.0 19 0.0 20 1.0 21 1.0 22 0.0 23 2.0 24 5.0 25 3.0 26 7.0 27 13.0 28 7.0 29 15.0 30 26.0 31 24.0 32 51.0 33 76.0 34 131.0 35 380.0 36 2641.0 37 612.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 31.2 24.625 11.475 32.7 2 24.925 27.700000000000003 34.825 12.55 3 19.45 27.375 32.9 20.275000000000002 4 21.15 34.5 25.124999999999996 19.225 5 24.875 36.975 22.45 15.7 6 18.099999999999998 40.225 24.099999999999998 17.575 7 19.950000000000003 21.525 39.550000000000004 18.975 8 18.2 26.6 32.0 23.200000000000003 9 21.025 24.45 31.45 23.075000000000003 10-14 22.56 29.625 27.060000000000002 20.755000000000003 15-19 21.884999999999998 29.065 27.47 21.58 20-24 22.89 28.46 27.694999999999997 20.955 25-29 22.425 28.02 28.655 20.9 30-34 22.355 28.185 28.349999999999998 21.11 35-39 22.685 28.044999999999998 28.804999999999996 20.465 40-44 22.535 28.29 27.810000000000002 21.365000000000002 45-49 21.78 28.34 28.884999999999998 20.995 50-54 22.75 27.994999999999997 27.97 21.285 55-59 23.235 28.349999999999998 27.675 20.74 60-64 22.28 28.305000000000003 28.305000000000003 21.11 65-69 23.09 27.515 28.1 21.295 70-74 22.505 28.235 27.584999999999997 21.675 75-79 22.68 28.335 27.889999999999997 21.095 80-84 22.79 28.470000000000002 27.755000000000003 20.985 85-89 23.06 28.48 27.43 21.029999999999998 90-94 22.98 28.15 28.084999999999997 20.785 95-99 22.770000000000003 28.199999999999996 27.810000000000002 21.22 100-104 23.555 28.265 27.229999999999997 20.95 105-109 22.564999999999998 27.775 28.215 21.445 110-114 23.085 28.945 27.900000000000002 20.07 115-119 23.885 27.87 28.27 19.975 120-124 23.41 28.005000000000003 27.944999999999997 20.64 125-129 24.474999999999998 28.185 27.029999999999998 20.31 130-134 23.41 28.775000000000002 27.589999999999996 20.225 135-139 24.445 28.060000000000002 27.265 20.23 140-144 24.45 27.85 27.63 20.07 145-149 24.77 27.985 27.025 20.22 150-151 23.8875 27.6875 28.1125 20.3125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 0.5 16 0.0 17 0.0 18 0.5 19 1.0 20 0.5 21 0.0 22 0.5 23 3.0 24 5.0 25 8.0 26 8.0 27 5.5 28 8.5 29 15.0 30 24.5 31 27.5 32 34.5 33 46.5 34 61.5 35 84.5 36 107.5 37 118.0 38 137.0 39 186.0 40 201.0 41 200.0 42 236.0 43 260.5 44 271.5 45 290.5 46 286.5 47 259.0 48 218.5 49 178.5 50 149.0 51 122.0 52 106.5 53 84.0 54 61.0 55 48.5 56 40.5 57 34.0 58 20.0 59 12.5 60 11.5 61 7.0 62 2.5 63 3.5 64 3.0 65 2.0 66 2.0 67 1.0 68 0.5 69 0.0 70 0.0 71 0.0 72 0.5 73 0.5 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.2 #Duplication Level Percentage of deduplicated Percentage of total 1 91.55701754385966 83.5 2 7.538377192982456 13.750000000000002 3 0.712719298245614 1.95 4 0.10964912280701754 0.4 5 0.05482456140350877 0.25 6 0.027412280701754384 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 6 0.15 No Hit CACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATC 5 0.125 No Hit AAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.025 0.0 12-13 0.0 0.0 0.0 0.025 0.0 14-15 0.0 0.0 0.0 0.025 0.0 16-17 0.0 0.0 0.0 0.025 0.0 18-19 0.0 0.0 0.0 0.025 0.0 20-21 0.0 0.0 0.0 0.025 0.0 22-23 0.0 0.0 0.0 0.025 0.0 24-25 0.0 0.0 0.0 0.025 0.0 26-27 0.0 0.0 0.0 0.025 0.0 28-29 0.0 0.0 0.0 0.025 0.0 30-31 0.0 0.0 0.0 0.025 0.0 32-33 0.0 0.0 0.0 0.025 0.0 34-35 0.0 0.0 0.0 0.025 0.0 36-37 0.0 0.0 0.0 0.025 0.0 38-39 0.0 0.0 0.0 0.025 0.0 40-41 0.0 0.0 0.0 0.025 0.0 42-43 0.0 0.0 0.0 0.025 0.0 44-45 0.0 0.0 0.0 0.025 0.0 46-47 0.0 0.0 0.0 0.025 0.0 48-49 0.0 0.0 0.0 0.025 0.0 50-51 0.0 0.0 0.0 0.025 0.0 52-53 0.0 0.0 0.0 0.025 0.0 54-55 0.0 0.0 0.0 0.025 0.0 56-57 0.025 0.0 0.0 0.025 0.0 58-59 0.025 0.0 0.0 0.025 0.0 60-61 0.025 0.0 0.0 0.025 0.0 62-63 0.025 0.0 0.0 0.025 0.0 64-65 0.025 0.0 0.0 0.025 0.0 66-67 0.025 0.0 0.0 0.025 0.0 68-69 0.025 0.0 0.0 0.025 0.0 70-71 0.025 0.0 0.0 0.025 0.0 72-73 0.025 0.0 0.0 0.025 0.0 74-75 0.025 0.0 0.0 0.025 0.0 76-77 0.025 0.0 0.0 0.025 0.0 78-79 0.037500000000000006 0.0 0.0 0.025 0.0 80-81 0.075 0.0 0.0 0.025 0.0 82-83 0.0875 0.0 0.0 0.025 0.0 84-85 0.1 0.0 0.0 0.025 0.0 86-87 0.1125 0.0 0.0 0.025 0.0 88-89 0.15 0.0 0.0 0.025 0.0 90-91 0.175 0.0 0.0 0.025 0.0 92-93 0.2 0.0 0.0 0.025 0.0 94-95 0.2375 0.0 0.0 0.025 0.0 96-97 0.275 0.0 0.0 0.025 0.0 98-99 0.275 0.0 0.0 0.025 0.0 100-101 0.4 0.0 0.0 0.025 0.0 102-103 0.55 0.0 0.0 0.025 0.0 104-105 0.6375 0.0 0.0 0.025 0.0 106-107 0.7625 0.0 0.0 0.025 0.0 108-109 0.8625 0.0 0.0 0.025 0.0 110-111 0.9375 0.0 0.0 0.025 0.0 112-113 1.0375 0.0 0.0 0.025 0.0 114-115 1.2375 0.0 0.0 0.025 0.0 116-117 1.475 0.0 0.0 0.025 0.0 118-119 1.7 0.0 0.0 0.025 0.0 120-121 1.9375 0.0 0.0 0.025 0.0 122-123 2.275 0.0 0.0 0.025 0.0 124-125 2.625 0.0 0.0 0.025 0.0 126-127 2.8625 0.0 0.0 0.025 0.0 128-129 3.0 0.0 0.0 0.025 0.0 130-131 3.175 0.0 0.0 0.025 0.0 132-133 3.425 0.0 0.0 0.025 0.0 134-135 3.8375 0.0 0.0 0.025 0.0 136-137 4.0125 0.0 0.0 0.025 0.0 138-139 4.425 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 492375 spots for SRR12671034.sra Written 492375 spots for SRR12671034.sra Read 492375 spots for SRR12671034.sra Written 492375 spots for SRR12671034.sra Read 492375 spots for SRR12671034.sra Written 492375 spots for SRR12671034.sra Read 492375 spots for SRR12671034.sra Written 492375 spots for SRR12671034.sra Read 492375 spots for SRR12671034.sra Written 492375 spots for SRR12671034.sra Read 492375 spots for SRR12671034.sra Written 492375 spots for SRR12671034.sra Read 492375 spots for SRR12671034.sra Written 492375 spots for SRR12671034.sra Read 492375 spots for SRR12671034.sra Written 492375 spots for SRR12671034.sra Read 492375 spots for SRR12671034.sra Written 492375 spots for SRR12671034.sra Read 492375 spots for SRR12671034.sra Written 492375 spots for SRR12671034.sra Read 492375 spots for SRR12671034.sra Written 492375 spots for SRR12671034.sra Read 492375 spots for SRR12671034.sra Written 492375 spots for SRR12671034.sra Read 492375 spots for SRR12671034.sra Written 492375 spots for SRR12671034.sra Read 492375 spots for SRR12671034.sra Written 492375 spots for SRR12671034.sra Read 492375 spots for SRR12671034.sra Written 492375 spots for SRR12671034.sra Read 492381 spots for SRR12671034.sra Written 492381 spots for SRR12671034.sra Read 492375 spots for SRR12671034.sra Written 492375 spots for SRR12671034.sra Read 492375 spots for SRR12671034.sra Written 492375 spots for SRR12671034.sra Read 492375 spots for SRR12671034.sra Written 492375 spots for SRR12671034.sra Read 492375 spots for SRR12671034.sra Written 492375 spots for SRR12671034.sra SRR ids: ['SRR12671034.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_d5qle9wr SRR12671034.sra spots: 9847506 blocks: [[1, 492375], [492376, 984750], [984751, 1477125], [1477126, 1969500], [1969501, 2461875], [2461876, 2954250], [2954251, 3446625], [3446626, 3939000], [3939001, 4431375], [4431376, 4923750], [4923751, 5416125], [5416126, 5908500], [5908501, 6400875], [6400876, 6893250], [6893251, 7385625], [7385626, 7878000], [7878001, 8370375], [8370376, 8862750], [8862751, 9355125], [9355126, 9847506]] SRR12671034 file size 3325210 SRR12671034 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671034 SRR12671034_1.fastq SRR12671034_2.fastq Input file: SRR12671034_1.fastq Paired file: SRR12671034_2.fastq trimmed: SRR12671034-trimmed-pair1.fastq, SRR12671034-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 14:33:38 2025 >> started Tue Feb 11 14:33:48 2025 >> done (10.804s) 9847506 read pairs processed; of these: 44 ( 0.00%) short read pairs filtered out after trimming by size control 317 ( 0.00%) empty read pairs filtered out after trimming by size control 9847145 (100.00%) read pairs available; of these: 666234 ( 6.77%) trimmed read pairs available after processing 9180911 (93.23%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 2 0.00% 20 3 0.00% 21 3 0.00% 22 2 0.00% 23 5 0.00% 24 2 0.00% 25 7 0.00% 26 2 0.00% 27 4 0.00% 28 3 0.00% 29 9 0.00% 30 5 0.00% 31 3 0.00% 32 10 0.00% 33 3 0.00% 34 6 0.00% 35 7 0.00% 36 11 0.00% 37 8 0.00% 38 7 0.00% 39 9 0.00% 40 4 0.00% 41 6 0.00% 42 10 0.00% 43 14 0.00% 44 12 0.00% 45 11 0.00% 46 7 0.00% 47 13 0.00% 48 15 0.00% 49 21 0.00% 50 25 0.00% 51 27 0.00% 52 33 0.00% 53 20 0.00% 54 32 0.00% 55 32 0.00% 56 28 0.00% 57 37 0.00% 58 45 0.00% 59 53 0.00% 60 59 0.00% 61 63 0.00% 62 71 0.00% 63 95 0.00% 64 111 0.00% 65 120 0.00% 66 127 0.00% 67 145 0.00% 68 160 0.00% 69 185 0.00% 70 204 0.00% 71 231 0.00% 72 263 0.00% 73 282 0.00% 74 368 0.00% 75 403 0.00% 76 403 0.00% 77 469 0.00% 78 578 0.01% 79 555 0.01% 80 650 0.01% 81 784 0.01% 82 807 0.01% 83 977 0.01% 84 1021 0.01% 85 1158 0.01% 86 1253 0.01% 87 1364 0.01% 88 1547 0.02% 89 1633 0.02% 90 1848 0.02% 91 2004 0.02% 92 2075 0.02% 93 2301 0.02% 94 2510 0.03% 95 2807 0.03% 96 2874 0.03% 97 3161 0.03% 98 3319 0.03% 99 3653 0.04% 100 3783 0.04% 101 4006 0.04% 102 4238 0.04% 103 4358 0.04% 104 4756 0.05% 105 5002 0.05% 106 5365 0.05% 107 5666 0.06% 108 5861 0.06% 109 6261 0.06% 110 6389 0.06% 111 6807 0.07% 112 7031 0.07% 113 7312 0.07% 114 7600 0.08% 115 7779 0.08% 116 8272 0.08% 117 8816 0.09% 118 9112 0.09% 119 9358 0.10% 120 9923 0.10% 121 10001 0.10% 122 10632 0.11% 123 10819 0.11% 124 11298 0.11% 125 11608 0.12% 126 11949 0.12% 127 12377 0.13% 128 12783 0.13% 129 13337 0.14% 130 13789 0.14% 131 14129 0.14% 132 14639 0.15% 133 14683 0.15% 134 15128 0.15% 135 15583 0.16% 136 16029 0.16% 137 16382 0.17% 138 17059 0.17% 139 17958 0.18% 140 18256 0.19% 141 18491 0.19% 142 19196 0.19% 143 19038 0.19% 144 20165 0.20% 145 20389 0.21% 146 20630 0.21% 147 21168 0.21% 148 22143 0.22% 149 22268 0.23% 150 23416 0.24% 151 9180911 93.23% 9847145 reads passed initial QC criterion=sequence-density sequence-density=0.38 sequence-density-rank=1 fanout-score=2.34 fanout-score-rank=21 prefix-density=0.41 prefix-fanout=2.2 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.09 sequence-density-rank=26 fanout-score=11.82 fanout-score-rank=1 prefix-density=0.18 prefix-fanout=6.0 sequence=GCTCCAAGCATGGCCCACCTGGAATGGATGACTTCAAGCTCACGGTTCTTGGCAAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCAGCCGTAGTCACCAGGGAACTCACCAGTCAAGTAGGATGGGGGCTCACCAGAGAACGGGCCCAAGTATTTAACACGGTCTGGTCCGTACCATGGGCTCCCGGAGGGAACAGGCTTGGTGGTTTTCCTCATGGAGACACGGCCATTGCCCATGATCTCAGAGGAGGAGGGGTTGAGCTTCACC criterion=sequence-density sequence-density=0.63 sequence-density-rank=1 fanout-score=2.06 fanout-score-rank=29 prefix-density=0.63 prefix-fanout=2.1 sequence=CCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTT criterion=fanout-score sequence-density=0.10 sequence-density-rank=29 fanout-score=71.62 fanout-score-rank=1 prefix-density=0.71 prefix-fanout=9.9 sequence=AAAAGAAAAGAAAA SRR12671034 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 14:34:34 Started mapping on | Feb 11 14:34:34 Finished on | Feb 11 14:35:39 Mapping speed, Million of reads per hour | 545.38 Number of input reads | 9847145 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 9439749 Uniquely mapped reads % | 95.86% Average mapped length | 297.85 Number of splices: Total | 9688304 Number of splices: Annotated (sjdb) | 9494838 Number of splices: GT/AG | 9494757 Number of splices: GC/AG | 163118 Number of splices: AT/AC | 5279 Number of splices: Non-canonical | 25150 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.85 Insertion rate per base | 0.03% Insertion average length | 2.35 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 219660 % of reads mapped to multiple loci | 2.23% Number of reads mapped to too many loci | 25578 % of reads mapped to too many loci | 0.26% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.58% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 187736 187736 187736 N_multimapping 219660 219660 219660 N_noFeature 380255 9312332 421027 N_ambiguous 144458 496 57621 UnstrandedReadsAssigned:8915036 PositiveStrandReadsAssigned:126921 NegativeStrandReadsAssigned:8961101 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671034 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671034-trimmed-pair1.fastq SRR12671034-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 9,847,145 reads, 8,914,017 reads pseudoaligned [quant] estimated average fragment length: 274.776 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 968 rounds 52401 SRR12671034.ke.tsv 34699 SRR12671034.se.tsv 87100 total ==> SRR12671034.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1744.22 293 16.9749 Potri.005G024800.1.v4.1 1035 761.224 144 19.1158 Potri.004G059700.1.v4.1 961 687.413 1 0.147003 Potri.007G009000.2.v4.1 1416 1142.22 0 0 Potri.003G141000.2.v4.1 2943 2669.22 660 24.9863 Potri.016G087400.1.v4.1 270 76.438 290 383.382 Potri.015G069301.1.v4.1 564 306.168 0 0 Potri.010G195200.1.v4.1 1773 1499.22 44 2.96571 Potri.012G127500.1.v4.1 977 703.348 45 6.46525 ==> SRR12671034.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 38 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 115 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 4 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 7 SRR12671034 completed mapping pipeline successfully