Starting /dee2/code/volunteer_pipeline.sh SRR12671035 current disk space = 3049705091072 free memory = 1511087380 SRR12671035 SRAfilesize c35f4b71672d75c205e9d2785141bd9d SRR12671035.sra SRR12671035.sra file validated SRR12671035 is paired end SRR12671035 is conventional basespace SRR12671035 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671035_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.477 37.0 37.0 37.0 37.0 37.0 2 36.374 37.0 37.0 37.0 37.0 37.0 3 36.4665 37.0 37.0 37.0 37.0 37.0 4 36.547 37.0 37.0 37.0 37.0 37.0 5 36.587 37.0 37.0 37.0 37.0 37.0 6 36.593 37.0 37.0 37.0 37.0 37.0 7 36.4935 37.0 37.0 37.0 37.0 37.0 8 36.584 37.0 37.0 37.0 37.0 37.0 9 36.6635 37.0 37.0 37.0 37.0 37.0 10-14 36.6306 37.0 37.0 37.0 37.0 37.0 15-19 36.5745 37.0 37.0 37.0 37.0 37.0 20-24 36.520599999999995 37.0 37.0 37.0 37.0 37.0 25-29 36.4772 37.0 37.0 37.0 37.0 37.0 30-34 36.3904 37.0 37.0 37.0 37.0 37.0 35-39 36.4086 37.0 37.0 37.0 37.0 37.0 40-44 36.3963 37.0 37.0 37.0 37.0 37.0 45-49 36.271100000000004 37.0 37.0 37.0 37.0 37.0 50-54 36.2949 37.0 37.0 37.0 37.0 37.0 55-59 36.2332 37.0 37.0 37.0 37.0 37.0 60-64 36.22860000000001 37.0 37.0 37.0 37.0 37.0 65-69 36.2024 37.0 37.0 37.0 37.0 37.0 70-74 36.1787 37.0 37.0 37.0 37.0 37.0 75-79 36.1179 37.0 37.0 37.0 37.0 37.0 80-84 36.0938 37.0 37.0 37.0 37.0 37.0 85-89 36.088300000000004 37.0 37.0 37.0 37.0 37.0 90-94 36.0441 37.0 37.0 37.0 37.0 37.0 95-99 36.0483 37.0 37.0 37.0 37.0 37.0 100-104 36.011199999999995 37.0 37.0 37.0 37.0 37.0 105-109 35.948299999999996 37.0 37.0 37.0 37.0 37.0 110-114 35.9552 37.0 37.0 37.0 37.0 37.0 115-119 35.91425 37.0 37.0 37.0 37.0 37.0 120-124 35.8948 37.0 37.0 37.0 37.0 37.0 125-129 35.88590000000001 37.0 37.0 37.0 37.0 37.0 130-134 35.72580000000001 37.0 37.0 37.0 37.0 37.0 135-139 35.7587 37.0 37.0 37.0 37.0 37.0 140-144 35.708999999999996 37.0 37.0 37.0 37.0 37.0 145-149 35.5685 37.0 37.0 37.0 37.0 37.0 150-151 35.438500000000005 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 1.0 18 0.0 19 1.0 20 2.0 21 3.0 22 9.0 23 6.0 24 7.0 25 6.0 26 9.0 27 11.0 28 12.0 29 25.0 30 36.0 31 41.0 32 64.0 33 81.0 34 109.0 35 288.0 36 2625.0 37 664.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 47.19859929964982 11.805902951475739 7.903951975987994 33.09154577288644 2 20.474999999999998 9.675 35.9 33.95 3 17.45 14.45 28.9 39.2 4 21.85 21.775 26.150000000000002 30.225 5 22.875 29.45 25.474999999999998 22.2 6 21.675 31.85 23.025000000000002 23.45 7 15.15 28.799999999999997 40.325 15.725 8 16.85 27.474999999999998 33.175 22.5 9 16.25 24.65 35.925000000000004 23.175 10-14 19.39 30.31 28.134999999999998 22.165000000000003 15-19 19.495 27.915 28.16 24.43 20-24 19.830000000000002 28.07 28.675 23.425 25-29 19.33 28.485 28.275 23.91 30-34 19.715 28.799999999999997 28.475 23.01 35-39 19.615 28.349999999999998 28.815 23.22 40-44 20.16 28.199999999999996 28.075 23.565 45-49 19.689999999999998 28.77 27.544999999999998 23.995 50-54 19.645000000000003 28.685 27.634999999999998 24.035 55-59 19.994999999999997 28.310000000000002 28.084999999999997 23.61 60-64 19.939999999999998 27.63 28.76 23.669999999999998 65-69 19.634999999999998 28.205000000000002 28.365000000000002 23.794999999999998 70-74 19.89 28.215 28.249999999999996 23.645 75-79 19.705000000000002 28.165000000000003 28.01 24.12 80-84 19.715 28.43 28.355000000000004 23.5 85-89 20.515 28.1 27.605 23.78 90-94 20.794999999999998 28.235 27.275 23.695 95-99 20.29 28.59 28.035 23.085 100-104 20.285 29.759999999999998 26.810000000000002 23.145 105-109 20.5 27.944999999999997 27.815 23.74 110-114 20.8 28.65 26.99 23.56 115-119 20.841042052102605 28.536426821341067 27.50637531876594 23.11615580779039 120-124 21.044999999999998 27.575 27.975 23.405 125-129 20.695 27.900000000000002 27.49 23.915 130-134 21.055 28.37 26.634999999999998 23.94 135-139 20.845 28.615000000000002 26.8 23.74 140-144 21.27 27.800000000000004 27.245 23.685000000000002 145-149 20.534106821364272 28.550710142028407 26.885377075415086 24.02980596119224 150-151 20.45 27.962500000000002 26.174999999999997 25.412499999999998 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 5.0 1 4.5 2 2.0 3 1.5 4 2.0 5 1.5 6 1.5 7 1.0 8 1.5 9 1.5 10 1.0 11 0.5 12 0.5 13 1.0 14 1.0 15 1.5 16 2.0 17 2.0 18 3.0 19 2.5 20 0.5 21 0.5 22 1.0 23 1.0 24 1.5 25 3.5 26 6.5 27 8.5 28 14.0 29 18.0 30 19.0 31 24.5 32 38.5 33 55.0 34 58.5 35 68.5 36 93.0 37 108.5 38 128.0 39 156.5 40 175.5 41 194.0 42 215.0 43 230.0 44 238.0 45 252.0 46 261.0 47 243.5 48 223.0 49 218.5 50 195.0 51 146.5 52 123.0 53 117.0 54 86.5 55 61.0 56 51.0 57 34.5 58 25.0 59 20.5 60 17.0 61 12.0 62 6.5 63 5.5 64 4.0 65 1.5 66 1.0 67 1.0 68 1.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.005 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.02 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 88.97500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 89.26664793481315 79.425 2 9.440854172520371 16.8 3 1.1801067715650464 3.15 4 0.0561955605507165 0.2 5 0.02809778027535825 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02809778027535825 0.3 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 12 0.3 No Hit GCACATTGGAAAAATCAAATCTTCTGGAAATCATGAATCAAACTGCACTG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.0625 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.2 0.0 0.0 0.0 0.0 96-97 0.21250000000000002 0.0 0.0 0.0 0.0 98-99 0.225 0.0 0.0 0.0 0.0 100-101 0.325 0.0 0.0 0.0 0.0 102-103 0.425 0.0 0.0 0.0 0.0 104-105 0.4875 0.0 0.0 0.0 0.0 106-107 0.6125 0.0 0.0 0.0 0.0 108-109 0.65 0.0 0.0 0.0 0.0 110-111 0.7125 0.0 0.0 0.0 0.0 112-113 0.875 0.0 0.0 0.0 0.0 114-115 1.1 0.0 0.0 0.0 0.0 116-117 1.1875 0.0 0.0 0.0 0.0 118-119 1.3125 0.0 0.0 0.0 0.0 120-121 1.475 0.0 0.0 0.0 0.0 122-123 1.775 0.0 0.0 0.0 0.0 124-125 2.0375 0.0 0.0 0.0 0.0 126-127 2.375 0.0 0.0 0.0 0.0 128-129 2.7 0.0 0.0 0.0 0.0 130-131 2.9125 0.0 0.0 0.0 0.0 132-133 3.175 0.0 0.0 0.0 0.0 134-135 3.4625 0.0 0.0 0.0 0.0 136-137 3.7875 0.0 0.0 0.0 0.0 138-139 4.1875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCCAGCT 10 0.006830828 145.0 1 GGGGGGG 30 0.0014437955 24.166668 65-69 >>END_MODULE SRR12671035 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671035_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.0985 37.0 37.0 37.0 37.0 37.0 2 36.21 37.0 37.0 37.0 37.0 37.0 3 36.2655 37.0 37.0 37.0 37.0 37.0 4 36.239 37.0 37.0 37.0 37.0 37.0 5 36.344 37.0 37.0 37.0 37.0 37.0 6 36.371 37.0 37.0 37.0 37.0 37.0 7 36.327 37.0 37.0 37.0 37.0 37.0 8 36.4455 37.0 37.0 37.0 37.0 37.0 9 36.3285 37.0 37.0 37.0 37.0 37.0 10-14 36.3486 37.0 37.0 37.0 37.0 37.0 15-19 36.352500000000006 37.0 37.0 37.0 37.0 37.0 20-24 36.3579 37.0 37.0 37.0 37.0 37.0 25-29 36.3098 37.0 37.0 37.0 37.0 37.0 30-34 36.3245 37.0 37.0 37.0 37.0 37.0 35-39 36.2381 37.0 37.0 37.0 37.0 37.0 40-44 36.254000000000005 37.0 37.0 37.0 37.0 37.0 45-49 36.2428 37.0 37.0 37.0 37.0 37.0 50-54 36.230199999999996 37.0 37.0 37.0 37.0 37.0 55-59 36.17379999999999 37.0 37.0 37.0 37.0 37.0 60-64 36.201499999999996 37.0 37.0 37.0 37.0 37.0 65-69 36.113600000000005 37.0 37.0 37.0 37.0 37.0 70-74 36.161 37.0 37.0 37.0 37.0 37.0 75-79 36.0635 37.0 37.0 37.0 37.0 37.0 80-84 36.1047 37.0 37.0 37.0 37.0 37.0 85-89 36.02685 37.0 37.0 37.0 37.0 37.0 90-94 36.025400000000005 37.0 37.0 37.0 37.0 37.0 95-99 36.027 37.0 37.0 37.0 37.0 37.0 100-104 36.0156 37.0 37.0 37.0 37.0 37.0 105-109 35.924699999999994 37.0 37.0 37.0 37.0 37.0 110-114 35.942600000000006 37.0 37.0 37.0 37.0 37.0 115-119 35.910900000000005 37.0 37.0 37.0 37.0 37.0 120-124 35.883900000000004 37.0 37.0 37.0 37.0 37.0 125-129 35.7534 37.0 37.0 37.0 37.0 37.0 130-134 35.7861 37.0 37.0 37.0 37.0 37.0 135-139 35.7913 37.0 37.0 37.0 37.0 37.0 140-144 35.661500000000004 37.0 37.0 37.0 37.0 37.0 145-149 35.5458 37.0 37.0 37.0 37.0 37.0 150-151 35.248000000000005 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 3.0 14 0.0 15 2.0 16 3.0 17 2.0 18 2.0 19 4.0 20 5.0 21 2.0 22 2.0 23 4.0 24 5.0 25 9.0 26 13.0 27 11.0 28 13.0 29 18.0 30 21.0 31 38.0 32 71.0 33 83.0 34 119.0 35 317.0 36 2649.0 37 604.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.375 25.900000000000002 9.625 21.099999999999998 2 27.975 25.55 29.225 17.25 3 21.375 26.8 33.95 17.875 4 23.825 34.325 23.025000000000002 18.825 5 26.224999999999998 35.699999999999996 21.2 16.875 6 22.275 39.4 21.825 16.5 7 23.075000000000003 22.275 36.675000000000004 17.974999999999998 8 20.849999999999998 26.625 28.1 24.425 9 22.925 24.6 31.225 21.25 10-14 23.119999999999997 29.845 26.465 20.57 15-19 23.745 28.235 27.125 20.895 20-24 23.175 29.17 26.85 20.805 25-29 23.41 27.965 27.534999999999997 21.09 30-34 23.335 27.139999999999997 28.325 21.2 35-39 23.16 28.12 27.625 21.095 40-44 23.885 28.365000000000002 26.979999999999997 20.77 45-49 23.325000000000003 28.27 27.825 20.580000000000002 50-54 22.725 27.99 27.98 21.305 55-59 23.205000000000002 28.08 27.425 21.29 60-64 23.369999999999997 27.405 28.24 20.985 65-69 23.455000000000002 27.525 27.785 21.235 70-74 23.919999999999998 27.865000000000002 27.284999999999997 20.93 75-79 22.93 28.325 27.375 21.37 80-84 23.09 28.425 27.589999999999996 20.895 85-89 23.736186809340467 27.27136356817841 27.50637531876594 21.486074303715185 90-94 23.44 28.525 26.99 21.044999999999998 95-99 23.655 27.85 27.685 20.810000000000002 100-104 23.765 27.994999999999997 27.395000000000003 20.845 105-109 23.39 28.03 27.644999999999996 20.935000000000002 110-114 23.580000000000002 27.839999999999996 28.09 20.49 115-119 24.007400740074008 27.707770777077705 27.527752775277527 20.757075707570756 120-124 24.015 28.165000000000003 27.155 20.665 125-129 23.630000000000003 28.360000000000003 27.185 20.825 130-134 24.46 28.235 27.250000000000004 20.055 135-139 23.74 27.689999999999998 27.935 20.635 140-144 24.267426742674267 27.77777777777778 27.197719771977198 20.757075707570756 145-149 24.595 28.49 26.834999999999997 20.080000000000002 150-151 24.7875 28.299999999999997 26.5875 20.325 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.5 7 0.5 8 0.5 9 0.5 10 0.0 11 0.5 12 1.5 13 2.0 14 1.5 15 0.5 16 0.0 17 0.5 18 1.0 19 1.5 20 3.0 21 4.5 22 3.5 23 2.5 24 3.0 25 4.0 26 6.0 27 6.0 28 7.5 29 13.0 30 17.0 31 22.0 32 29.5 33 38.5 34 44.5 35 60.0 36 79.0 37 106.0 38 127.0 39 148.0 40 184.5 41 218.0 42 233.5 43 248.5 44 256.0 45 267.5 46 288.0 47 256.5 48 215.5 49 213.5 50 188.5 51 141.0 52 105.0 53 95.0 54 96.5 55 66.0 56 43.5 57 35.0 58 27.5 59 19.0 60 15.0 61 12.0 62 8.5 63 6.5 64 2.5 65 1.0 66 1.0 67 0.5 68 0.0 69 0.0 70 0.5 71 1.5 72 1.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.5 87 0.5 88 0.0 89 0.5 90 0.5 91 0.5 92 0.5 93 0.0 94 0.5 95 0.5 96 1.0 97 1.5 98 1.0 99 0.5 100 3.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.005 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.01 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.01 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 88.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 88.98616210110139 78.77499999999999 2 9.65828861903417 17.1 3 1.0731431798926856 2.85 4 0.16944365998305563 0.6 5 0.02824060999717594 0.125 6 0.05648121999435188 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02824060999717594 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 10 0.25 No Hit AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 6 0.15 No Hit ACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCC 6 0.15 No Hit CAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.0625 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.2 0.0 0.0 0.0 0.0 96-97 0.21250000000000002 0.0 0.0 0.0 0.0 98-99 0.225 0.0 0.0 0.0 0.0 100-101 0.325 0.0 0.0 0.0 0.0 102-103 0.425 0.0 0.0 0.0 0.0 104-105 0.4875 0.0 0.0 0.0 0.0 106-107 0.5875 0.0 0.0 0.0 0.0 108-109 0.625 0.0 0.0 0.0 0.0 110-111 0.6875 0.0 0.0 0.0 0.0 112-113 0.8500000000000001 0.0 0.0 0.0 0.0 114-115 1.075 0.0 0.0 0.0 0.0 116-117 1.1875 0.0 0.0 0.0 0.0 118-119 1.3125 0.0 0.0 0.0 0.0 120-121 1.475 0.0 0.0 0.0 0.0 122-123 1.775 0.0 0.0 0.0 0.0 124-125 2.05 0.0 0.0 0.0 0.0 126-127 2.4125 0.0 0.0 0.0 0.0 128-129 2.7375 0.0 0.0 0.0 0.0 130-131 2.9375 0.0 0.0 0.0 0.0 132-133 3.2 0.0 0.0 0.0 0.0 134-135 3.4875 0.0 0.0 0.0 0.0 136-137 3.8125 0.0 0.0 0.0 0.0 138-139 4.2125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGAGAAT 10 0.006830828 145.0 1 AAAAAAA 80 0.0020131238 12.6875 10-14 >>END_MODULE Read 910002 spots for SRR12671035.sra Written 910002 spots for SRR12671035.sra Read 910002 spots for SRR12671035.sra Written 910002 spots for SRR12671035.sra Read 910002 spots for SRR12671035.sra Written 910002 spots for SRR12671035.sra Read 910002 spots for SRR12671035.sra Written 910002 spots for SRR12671035.sra Read 910002 spots for SRR12671035.sra Written 910002 spots for SRR12671035.sra Read 910002 spots for SRR12671035.sra Written 910002 spots for SRR12671035.sra Read 910002 spots for SRR12671035.sra Written 910002 spots for SRR12671035.sra Read 910002 spots for SRR12671035.sra Written 910002 spots for SRR12671035.sra Read 910002 spots for SRR12671035.sra Written 910002 spots for SRR12671035.sra Read 910002 spots for SRR12671035.sra Written 910002 spots for SRR12671035.sra Read 910002 spots for SRR12671035.sra Written 910002 spots for SRR12671035.sra Read 910002 spots for SRR12671035.sra Written 910002 spots for SRR12671035.sra Read 910002 spots for SRR12671035.sra Written 910002 spots for SRR12671035.sra Read 910002 spots for SRR12671035.sra Written 910002 spots for SRR12671035.sra Read 910002 spots for SRR12671035.sra Written 910002 spots for SRR12671035.sra Read 910002 spots for SRR12671035.sra Written 910002 spots for SRR12671035.sra Read 910002 spots for SRR12671035.sra Written 910002 spots for SRR12671035.sra Read 910007 spots for SRR12671035.sra Written 910007 spots for SRR12671035.sra Read 910002 spots for SRR12671035.sra Written 910002 spots for SRR12671035.sra Read 910002 spots for SRR12671035.sra Written 910002 spots for SRR12671035.sra SRR ids: ['SRR12671035.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_qobpzg6m SRR12671035.sra spots: 18200045 blocks: [[1, 910002], [910003, 1820004], [1820005, 2730006], [2730007, 3640008], [3640009, 4550010], [4550011, 5460012], [5460013, 6370014], [6370015, 7280016], [7280017, 8190018], [8190019, 9100020], [9100021, 10010022], [10010023, 10920024], [10920025, 11830026], [11830027, 12740028], [12740029, 13650030], [13650031, 14560032], [14560033, 15470034], [15470035, 16380036], [16380037, 17290038], [17290039, 18200045]] SRR12671035 file size 6163471 SRR12671035 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671035 SRR12671035_1.fastq SRR12671035_2.fastq Input file: SRR12671035_1.fastq Paired file: SRR12671035_2.fastq trimmed: SRR12671035-trimmed-pair1.fastq, SRR12671035-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 15:22:25 2025 >> started Tue Feb 11 15:22:51 2025 >> done (26.543s) 18200045 read pairs processed; of these: 61 ( 0.00%) short read pairs filtered out after trimming by size control 8804 ( 0.05%) empty read pairs filtered out after trimming by size control 18191180 (99.95%) read pairs available; of these: 1132584 ( 6.23%) trimmed read pairs available after processing 17058596 (93.77%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 11 0.00% 19 11 0.00% 20 4 0.00% 21 6 0.00% 22 9 0.00% 23 12 0.00% 24 7 0.00% 25 12 0.00% 26 18 0.00% 27 15 0.00% 28 19 0.00% 29 22 0.00% 30 16 0.00% 31 12 0.00% 32 24 0.00% 33 15 0.00% 34 22 0.00% 35 19 0.00% 36 20 0.00% 37 15 0.00% 38 23 0.00% 39 17 0.00% 40 21 0.00% 41 25 0.00% 42 25 0.00% 43 17 0.00% 44 24 0.00% 45 22 0.00% 46 13 0.00% 47 22 0.00% 48 37 0.00% 49 40 0.00% 50 40 0.00% 51 39 0.00% 52 50 0.00% 53 45 0.00% 54 68 0.00% 55 69 0.00% 56 72 0.00% 57 73 0.00% 58 76 0.00% 59 115 0.00% 60 116 0.00% 61 143 0.00% 62 179 0.00% 63 161 0.00% 64 229 0.00% 65 245 0.00% 66 238 0.00% 67 244 0.00% 68 328 0.00% 69 366 0.00% 70 447 0.00% 71 491 0.00% 72 565 0.00% 73 662 0.00% 74 727 0.00% 75 809 0.00% 76 886 0.00% 77 990 0.01% 78 1150 0.01% 79 1238 0.01% 80 1387 0.01% 81 1510 0.01% 82 1773 0.01% 83 1925 0.01% 84 2104 0.01% 85 2387 0.01% 86 2472 0.01% 87 2740 0.02% 88 2839 0.02% 89 3225 0.02% 90 3496 0.02% 91 3742 0.02% 92 3899 0.02% 93 4289 0.02% 94 4620 0.03% 95 4983 0.03% 96 5270 0.03% 97 5522 0.03% 98 5819 0.03% 99 6215 0.03% 100 6424 0.04% 101 6829 0.04% 102 7349 0.04% 103 7680 0.04% 104 8181 0.04% 105 8619 0.05% 106 9067 0.05% 107 9305 0.05% 108 9826 0.05% 109 10299 0.06% 110 10378 0.06% 111 11139 0.06% 112 11552 0.06% 113 11957 0.07% 114 12627 0.07% 115 13045 0.07% 116 13896 0.08% 117 14447 0.08% 118 14845 0.08% 119 15349 0.08% 120 16090 0.09% 121 16443 0.09% 122 17392 0.10% 123 18010 0.10% 124 19116 0.11% 125 19298 0.11% 126 20507 0.11% 127 20845 0.11% 128 21365 0.12% 129 21916 0.12% 130 22334 0.12% 131 23378 0.13% 132 23982 0.13% 133 24444 0.13% 134 25655 0.14% 135 26743 0.15% 136 27422 0.15% 137 27848 0.15% 138 28807 0.16% 139 30302 0.17% 140 30490 0.17% 141 31583 0.17% 142 32574 0.18% 143 32843 0.18% 144 34262 0.19% 145 35348 0.19% 146 35586 0.20% 147 36967 0.20% 148 37708 0.21% 149 38398 0.21% 150 40461 0.22% 151 17058596 93.77% 18191180 reads passed initial QC criterion=sequence-density sequence-density=0.75 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=23 prefix-density=0.75 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=25 fanout-score=62.59 fanout-score-rank=1 prefix-density=0.20 prefix-fanout=3.5 sequence=AAAGCAGAATCAAGCTTCCGATTAAAGATACATAATTCCATGGAATGGAACCAACAAAGCAGCAGGAAATACAAGACACTTACAGATTACTAGCCATCAAATGAGATCCTGTAGAAAGGATTTGAGGAGGCCATGGCTAGCTAACTGTACTTTAATTTACAGCAAATACTATATTAGACAAACATGGAGTGACCAGACTTCTTCTTTTTATTTATTATAGTTCCATAAAACTGCTTGGTTGGAGCCATGCGGCGACGTTTTCTCATTTGCAGGAGCATGGATCACAGGTGCAGTTTGATCCACATTTGCAGCCATTCTCAGCACCAAAGTTCATCTCAGAGCTCTCGTAGAACATCCTAACTGGAGCTACACCAGCAATGATTGTCTGACTTGTGGTGGTCTCGGAGAAACTCAAGTCTGGGTACATGCTGCATCCATTGCAGCCACTGCCGCACTTGCA criterion=sequence-density sequence-density=0.89 sequence-density-rank=1 fanout-score=2.09 fanout-score-rank=23 prefix-density=0.90 prefix-fanout=2.1 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGT criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=23.05 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=3.2 sequence=GCAAAACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCATCGGCGGCCGTTGCCACAGTTAACCGCACCCC SRR12671035 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 15:23:35 Started mapping on | Feb 11 15:23:36 Finished on | Feb 11 15:26:26 Mapping speed, Million of reads per hour | 385.22 Number of input reads | 18191180 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 16878572 Uniquely mapped reads % | 92.78% Average mapped length | 297.84 Number of splices: Total | 17341785 Number of splices: Annotated (sjdb) | 17027130 Number of splices: GT/AG | 16980194 Number of splices: GC/AG | 308990 Number of splices: AT/AC | 9096 Number of splices: Non-canonical | 43505 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.74 Insertion rate per base | 0.02% Insertion average length | 2.24 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 420484 % of reads mapped to multiple loci | 2.31% Number of reads mapped to too many loci | 65595 % of reads mapped to too many loci | 0.36% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.37% % of reads unmapped: other | 0.18% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 892124 892124 892124 N_multimapping 420484 420484 420484 N_noFeature 568362 16619480 642220 N_ambiguous 300779 1094 115040 UnstrandedReadsAssigned:16009431 PositiveStrandReadsAssigned:257998 NegativeStrandReadsAssigned:16121312 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671035 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671035-trimmed-pair1.fastq SRR12671035-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,191,180 reads, 16,163,874 reads pseudoaligned [quant] estimated average fragment length: 269.862 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,058 rounds 52401 SRR12671035.ke.tsv 34699 SRR12671035.se.tsv 87100 total ==> SRR12671035.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1749.14 528 15.2941 Potri.005G024800.1.v4.1 1035 766.138 357 23.6089 Potri.004G059700.1.v4.1 961 692.259 3 0.219567 Potri.007G009000.2.v4.1 1416 1147.14 0 0 Potri.003G141000.2.v4.1 2943 2674.14 861.613 16.3246 Potri.016G087400.1.v4.1 270 74.8325 751 508.469 Potri.015G069301.1.v4.1 564 307.743 0 0 Potri.010G195200.1.v4.1 1773 1504.14 43 1.44842 Potri.012G127500.1.v4.1 977 708.194 92 6.58188 ==> SRR12671035.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 191 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 282 Potri.001G212900.v4.1 4 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 13 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 7 SRR12671035 completed mapping pipeline successfully