Starting /dee2/code/volunteer_pipeline.sh SRR12671036 current disk space = 3050270511104 free memory = 1437054296 SRR12671036 SRAfilesize 0a66d52d79df46450e7d72bb68a4221f SRR12671036.sra SRR12671036.sra file validated SRR12671036 is paired end SRR12671036 is conventional basespace SRR12671036 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671036_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5105 37.0 37.0 37.0 37.0 37.0 2 36.3395 37.0 37.0 37.0 37.0 37.0 3 36.587 37.0 37.0 37.0 37.0 37.0 4 36.588 37.0 37.0 37.0 37.0 37.0 5 36.584 37.0 37.0 37.0 37.0 37.0 6 36.6025 37.0 37.0 37.0 37.0 37.0 7 36.599 37.0 37.0 37.0 37.0 37.0 8 36.659 37.0 37.0 37.0 37.0 37.0 9 36.6155 37.0 37.0 37.0 37.0 37.0 10-14 36.643299999999996 37.0 37.0 37.0 37.0 37.0 15-19 36.6213 37.0 37.0 37.0 37.0 37.0 20-24 36.5679 37.0 37.0 37.0 37.0 37.0 25-29 36.528499999999994 37.0 37.0 37.0 37.0 37.0 30-34 36.46640000000001 37.0 37.0 37.0 37.0 37.0 35-39 36.4645 37.0 37.0 37.0 37.0 37.0 40-44 36.50429999999999 37.0 37.0 37.0 37.0 37.0 45-49 36.4168 37.0 37.0 37.0 37.0 37.0 50-54 36.423 37.0 37.0 37.0 37.0 37.0 55-59 36.3741 37.0 37.0 37.0 37.0 37.0 60-64 36.3271 37.0 37.0 37.0 37.0 37.0 65-69 36.314 37.0 37.0 37.0 37.0 37.0 70-74 36.2983 37.0 37.0 37.0 37.0 37.0 75-79 36.323299999999996 37.0 37.0 37.0 37.0 37.0 80-84 36.272800000000004 37.0 37.0 37.0 37.0 37.0 85-89 36.2975 37.0 37.0 37.0 37.0 37.0 90-94 36.2513 37.0 37.0 37.0 37.0 37.0 95-99 36.1936 37.0 37.0 37.0 37.0 37.0 100-104 36.2221 37.0 37.0 37.0 37.0 37.0 105-109 36.1632 37.0 37.0 37.0 37.0 37.0 110-114 36.1547 37.0 37.0 37.0 37.0 37.0 115-119 36.1174 37.0 37.0 37.0 37.0 37.0 120-124 36.065200000000004 37.0 37.0 37.0 37.0 37.0 125-129 36.052899999999994 37.0 37.0 37.0 37.0 37.0 130-134 35.8812 37.0 37.0 37.0 37.0 37.0 135-139 35.9358 37.0 37.0 37.0 37.0 37.0 140-144 35.890100000000004 37.0 37.0 37.0 37.0 37.0 145-149 35.8014 37.0 37.0 37.0 37.0 37.0 150-151 35.6035 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 0.0 21 1.0 22 1.0 23 3.0 24 3.0 25 4.0 26 3.0 27 8.0 28 12.0 29 20.0 30 28.0 31 40.0 32 49.0 33 71.0 34 130.0 35 265.0 36 2684.0 37 677.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 51.10055027513757 11.380690345172587 5.402701350675337 32.1160580290145 2 19.325 10.45 37.3 32.925 3 17.424999999999997 15.225 30.375000000000004 36.975 4 20.875 24.05 25.474999999999998 29.599999999999998 5 24.025 31.025000000000002 23.45 21.5 6 21.025 33.85 23.3 21.825 7 15.375 26.674999999999997 41.825 16.125 8 16.425 26.900000000000002 32.975 23.7 9 16.85 22.900000000000002 36.775000000000006 23.474999999999998 10-14 19.495 29.455 28.810000000000002 22.24 15-19 19.485 28.335 28.189999999999998 23.990000000000002 20-24 19.895 28.43 28.205000000000002 23.47 25-29 19.900000000000002 28.689999999999998 28.375 23.035 30-34 19.900000000000002 28.73 27.815 23.555 35-39 19.91 28.860000000000003 27.589999999999996 23.64 40-44 19.794999999999998 29.26 27.72 23.225 45-49 20.205000000000002 29.354999999999997 26.974999999999998 23.465 50-54 20.015 28.939999999999998 27.975 23.07 55-59 19.435 28.87 28.275 23.419999999999998 60-64 20.19 28.595 27.88 23.335 65-69 20.275000000000002 28.939999999999998 27.97 22.814999999999998 70-74 19.905 28.82 27.255000000000003 24.02 75-79 20.16 28.205000000000002 27.544999999999998 24.09 80-84 20.69 29.459999999999997 27.24 22.61 85-89 20.44 28.615000000000002 27.150000000000002 23.794999999999998 90-94 20.395 28.305000000000003 27.650000000000002 23.65 95-99 20.07 28.105000000000004 28.015 23.810000000000002 100-104 20.380000000000003 27.935 28.315 23.369999999999997 105-109 19.905 28.48 27.98 23.635 110-114 20.625 28.050000000000004 27.584999999999997 23.74 115-119 21.21 27.905 28.110000000000003 22.775000000000002 120-124 20.03 28.37 27.93 23.669999999999998 125-129 20.810000000000002 28.084999999999997 27.565 23.54 130-134 20.775 28.134999999999998 27.845 23.244999999999997 135-139 20.61 28.01 28.02 23.36 140-144 21.46 28.15 26.575 23.815 145-149 20.945 27.47 28.044999999999998 23.54 150-151 19.787499999999998 28.225 27.224999999999998 24.762500000000003 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 1.0 7 1.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.5 14 1.0 15 0.5 16 0.0 17 0.5 18 1.0 19 1.5 20 2.0 21 1.5 22 3.0 23 5.0 24 5.0 25 3.5 26 3.0 27 8.5 28 15.0 29 20.5 30 18.5 31 23.0 32 36.0 33 39.0 34 52.5 35 73.0 36 90.5 37 114.0 38 142.5 39 166.0 40 194.0 41 221.5 42 228.5 43 255.5 44 267.5 45 253.5 46 256.0 47 248.5 48 235.5 49 208.0 50 160.5 51 131.5 52 119.0 53 94.0 54 70.5 55 52.5 56 40.0 57 33.0 58 24.5 59 22.5 60 19.5 61 12.0 62 4.5 63 2.5 64 3.0 65 3.0 66 4.5 67 3.0 68 0.5 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.425 #Duplication Level Percentage of deduplicated Percentage of total 1 91.6051408258135 83.75 2 7.6018594476346735 13.900000000000002 3 0.7109652720809406 1.95 4 0.05468963631391851 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.027344818156959255 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTAGTCCATCTCGTAT 8 0.2 TruSeq Adapter, Index 22 (97% over 37bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.2375 0.0 0.0 0.0 0.0 94-95 0.275 0.0 0.0 0.0 0.0 96-97 0.4 0.0 0.0 0.0 0.0 98-99 0.45 0.0 0.0 0.0 0.0 100-101 0.4875 0.0 0.0 0.0 0.0 102-103 0.6375 0.0 0.0 0.0 0.0 104-105 0.7 0.0 0.0 0.0 0.0 106-107 0.7875 0.0 0.0 0.0 0.0 108-109 0.8875 0.0 0.0 0.0 0.0 110-111 1.0125 0.0 0.0 0.0 0.0 112-113 1.1625 0.0 0.0 0.0 0.0 114-115 1.2625 0.0 0.0 0.0 0.0 116-117 1.3375 0.0 0.0 0.0 0.0 118-119 1.5125 0.0 0.0 0.0 0.0 120-121 1.7625 0.0 0.0 0.0 0.0 122-123 1.9625 0.0 0.0 0.0 0.0 124-125 2.2125 0.0 0.0 0.0 0.0 126-127 2.5625 0.0 0.0 0.0 0.0 128-129 2.8375000000000004 0.0 0.0 0.0 0.0 130-131 3.1375 0.0 0.0 0.0 0.0 132-133 3.3625 0.0 0.0 0.0 0.0 134-135 3.5625 0.0 0.0 0.0 0.0 136-137 3.875 0.0 0.0 0.0 0.0 138-139 4.2125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCATAA 10 0.006830828 145.0 7 GTTCTCG 10 0.006830828 145.0 1 AGTGATG 10 0.006830828 145.0 5 >>END_MODULE SRR12671036 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671036_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.208 37.0 37.0 37.0 37.0 37.0 2 36.343 37.0 37.0 37.0 37.0 37.0 3 36.3515 37.0 37.0 37.0 37.0 37.0 4 36.357 37.0 37.0 37.0 37.0 37.0 5 36.4155 37.0 37.0 37.0 37.0 37.0 6 36.5245 37.0 37.0 37.0 37.0 37.0 7 36.448 37.0 37.0 37.0 37.0 37.0 8 36.469 37.0 37.0 37.0 37.0 37.0 9 36.4515 37.0 37.0 37.0 37.0 37.0 10-14 36.4452 37.0 37.0 37.0 37.0 37.0 15-19 36.423 37.0 37.0 37.0 37.0 37.0 20-24 36.410700000000006 37.0 37.0 37.0 37.0 37.0 25-29 36.2941 37.0 37.0 37.0 37.0 37.0 30-34 36.2881 37.0 37.0 37.0 37.0 37.0 35-39 36.276700000000005 37.0 37.0 37.0 37.0 37.0 40-44 36.250600000000006 37.0 37.0 37.0 37.0 37.0 45-49 36.2579 37.0 37.0 37.0 37.0 37.0 50-54 36.232299999999995 37.0 37.0 37.0 37.0 37.0 55-59 36.2442 37.0 37.0 37.0 37.0 37.0 60-64 36.2318 37.0 37.0 37.0 37.0 37.0 65-69 36.240700000000004 37.0 37.0 37.0 37.0 37.0 70-74 36.177 37.0 37.0 37.0 37.0 37.0 75-79 36.130100000000006 37.0 37.0 37.0 37.0 37.0 80-84 36.1627 37.0 37.0 37.0 37.0 37.0 85-89 36.146899999999995 37.0 37.0 37.0 37.0 37.0 90-94 36.126 37.0 37.0 37.0 37.0 37.0 95-99 36.1368 37.0 37.0 37.0 37.0 37.0 100-104 36.1553 37.0 37.0 37.0 37.0 37.0 105-109 36.026399999999995 37.0 37.0 37.0 37.0 37.0 110-114 36.0658 37.0 37.0 37.0 37.0 37.0 115-119 36.071600000000004 37.0 37.0 37.0 37.0 37.0 120-124 35.982000000000006 37.0 37.0 37.0 37.0 37.0 125-129 35.9379 37.0 37.0 37.0 37.0 37.0 130-134 35.9025 37.0 37.0 37.0 37.0 37.0 135-139 35.8663 37.0 37.0 37.0 37.0 37.0 140-144 35.842 37.0 37.0 37.0 37.0 37.0 145-149 35.6275 37.0 37.0 37.0 37.0 37.0 150-151 35.442750000000004 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 2.0 14 5.0 15 2.0 16 4.0 17 0.0 18 1.0 19 1.0 20 2.0 21 2.0 22 2.0 23 5.0 24 6.0 25 9.0 26 10.0 27 6.0 28 11.0 29 14.0 30 24.0 31 24.0 32 36.0 33 76.0 34 145.0 35 324.0 36 2650.0 37 639.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.775 26.025 7.6499999999999995 20.549999999999997 2 28.625 25.224999999999998 30.375000000000004 15.775 3 21.65 26.75 34.825 16.775000000000002 4 25.174999999999997 32.375 24.775 17.675 5 25.8 36.6 21.5 16.1 6 22.175 40.699999999999996 19.975 17.150000000000002 7 20.925 22.875 38.025 18.175 8 20.974999999999998 25.474999999999998 29.625 23.925 9 22.175 23.549999999999997 30.0 24.275 10-14 23.3 29.509999999999998 26.255 20.935000000000002 15-19 23.345 28.335 27.6 20.72 20-24 23.375 29.189999999999998 26.700000000000003 20.735 25-29 22.895 27.915 28.645 20.544999999999998 30-34 22.93 28.63 27.93 20.51 35-39 23.175 28.27 28.044999999999998 20.51 40-44 23.095 28.005000000000003 27.755000000000003 21.145 45-49 22.99 28.804999999999996 27.855 20.349999999999998 50-54 23.16 28.28 28.075 20.485 55-59 23.595 27.685 27.495000000000005 21.224999999999998 60-64 23.435 28.28 27.435 20.849999999999998 65-69 22.685 27.800000000000004 28.24 21.275 70-74 23.865 27.13 28.02 20.985 75-79 23.200000000000003 28.12 27.43 21.25 80-84 23.599999999999998 28.365000000000002 26.724999999999998 21.310000000000002 85-89 23.46 28.384999999999998 27.37 20.785 90-94 23.46 28.13 27.439999999999998 20.97 95-99 23.095 28.299999999999997 27.51 21.095 100-104 24.13 28.175 26.995 20.7 105-109 23.849999999999998 27.744999999999997 27.91 20.495 110-114 23.315 28.01 28.005000000000003 20.669999999999998 115-119 23.7 28.08 27.755000000000003 20.465 120-124 23.494999999999997 28.505000000000003 27.155 20.845 125-129 24.215 28.060000000000002 27.115000000000002 20.61 130-134 24.654999999999998 27.765 27.08 20.5 135-139 24.025 27.975 27.46 20.54 140-144 24.435000000000002 28.345 27.365000000000002 19.855 145-149 25.35 27.950000000000003 26.924999999999997 19.775000000000002 150-151 24.2 27.725 27.287499999999998 20.7875 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 1.0 4 1.0 5 0.5 6 0.5 7 0.0 8 0.5 9 0.5 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 1.0 16 1.5 17 0.5 18 0.5 19 1.0 20 2.0 21 2.5 22 1.5 23 1.5 24 2.5 25 4.5 26 5.5 27 10.0 28 17.0 29 16.0 30 13.0 31 16.5 32 30.0 33 39.0 34 47.5 35 61.0 36 78.5 37 111.5 38 148.5 39 174.5 40 197.5 41 218.0 42 254.0 43 260.0 44 257.0 45 270.5 46 267.5 47 245.5 48 209.5 49 187.0 50 168.5 51 146.5 52 122.0 53 97.5 54 66.5 55 54.5 56 48.5 57 36.0 58 23.0 59 16.5 60 13.0 61 8.5 62 8.0 63 5.5 64 3.5 65 1.5 66 1.0 67 1.0 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.5 79 0.5 80 0.5 81 0.5 82 0.0 83 0.0 84 0.5 85 1.0 86 0.5 87 0.5 88 0.5 89 0.0 90 0.5 91 1.0 92 1.0 93 0.5 94 0.5 95 1.0 96 1.0 97 0.5 98 1.0 99 1.5 100 3.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.975 #Duplication Level Percentage of deduplicated Percentage of total 1 91.56361637812586 83.3 2 7.529541082715031 13.700000000000001 3 0.6595218466611706 1.7999999999999998 4 0.10992030777686176 0.4 5 0.08244023083264633 0.375 6 0.0 0.0 7 0.0 0.0 8 0.02748007694421544 0.2 9 0.02748007694421544 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 9 0.22499999999999998 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 8 0.2 No Hit CTGCATAGCTTATAAGCTTGTAAGAGATGGCTTCCTCCTCTATGATCTCA 5 0.125 No Hit GGGAGCACTGCATAGCTTATAAGCTTGTAAGAGATGGCTTCCTCCTCTAT 5 0.125 No Hit AACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.2375 0.0 0.0 0.0 0.0 94-95 0.275 0.0 0.0 0.0 0.0 96-97 0.4 0.0 0.0 0.0 0.0 98-99 0.45 0.0 0.0 0.0 0.0 100-101 0.4875 0.0 0.0 0.0 0.0 102-103 0.6375 0.0 0.0 0.0 0.0 104-105 0.725 0.0 0.0 0.0 0.0 106-107 0.8125 0.0 0.0 0.0 0.0 108-109 0.9125 0.0 0.0 0.0 0.0 110-111 1.0375 0.0 0.0 0.0 0.0 112-113 1.1875 0.0 0.0 0.0 0.0 114-115 1.2875 0.0 0.0 0.0 0.0 116-117 1.3625 0.0 0.0 0.0 0.0 118-119 1.5375 0.0 0.0 0.0 0.0 120-121 1.7875 0.0 0.0 0.0 0.0 122-123 2.0125 0.0 0.0 0.0 0.0 124-125 2.2750000000000004 0.0 0.0 0.0 0.0 126-127 2.6375 0.0 0.0 0.0 0.0 128-129 2.9124999999999996 0.0 0.0 0.0 0.0 130-131 3.2375 0.0 0.0 0.0 0.0 132-133 3.4125 0.0 0.0 0.0 0.0 134-135 3.6125 0.0 0.0 0.0 0.0 136-137 3.925 0.0 0.0 0.0 0.0 138-139 4.2625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 791489 spots for SRR12671036.sra Written 791489 spots for SRR12671036.sra Read 791489 spots for SRR12671036.sra Written 791489 spots for SRR12671036.sra Read 791489 spots for SRR12671036.sra Written 791489 spots for SRR12671036.sra Read 791489 spots for SRR12671036.sra Written 791489 spots for SRR12671036.sra Read 791489 spots for SRR12671036.sra Written 791489 spots for SRR12671036.sra Read 791489 spots for SRR12671036.sra Written 791489 spots for SRR12671036.sra Read 791489 spots for SRR12671036.sra Written 791489 spots for SRR12671036.sra Read 791489 spots for SRR12671036.sra Written 791489 spots for SRR12671036.sra Read 791489 spots for SRR12671036.sra Written 791489 spots for SRR12671036.sra Read 791489 spots for SRR12671036.sra Written 791489 spots for SRR12671036.sra Read 791489 spots for SRR12671036.sra Written 791489 spots for SRR12671036.sra Read 791489 spots for SRR12671036.sra Written 791489 spots for SRR12671036.sra Read 791489 spots for SRR12671036.sra Written 791489 spots for SRR12671036.sra Read 791489 spots for SRR12671036.sra Written 791489 spots for SRR12671036.sra Read 791489 spots for SRR12671036.sra Written 791489 spots for SRR12671036.sra Read 791489 spots for SRR12671036.sra Written 791489 spots for SRR12671036.sra Read 791489 spots for SRR12671036.sra Written 791489 spots for SRR12671036.sra Read 791489 spots for SRR12671036.sra Written 791489 spots for SRR12671036.sra Read 791489 spots for SRR12671036.sra Written 791489 spots for SRR12671036.sra Read 791489 spots for SRR12671036.sra Written 791489 spots for SRR12671036.sra SRR ids: ['SRR12671036.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_wgnm1t9_ SRR12671036.sra spots: 15829780 blocks: [[1, 791489], [791490, 1582978], [1582979, 2374467], [2374468, 3165956], [3165957, 3957445], [3957446, 4748934], [4748935, 5540423], [5540424, 6331912], [6331913, 7123401], [7123402, 7914890], [7914891, 8706379], [8706380, 9497868], [9497869, 10289357], [10289358, 11080846], [11080847, 11872335], [11872336, 12663824], [12663825, 13455313], [13455314, 14246802], [14246803, 15038291], [15038292, 15829780]] SRR12671036 file size 5357951 SRR12671036 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671036 SRR12671036_1.fastq SRR12671036_2.fastq Input file: SRR12671036_1.fastq Paired file: SRR12671036_2.fastq trimmed: SRR12671036-trimmed-pair1.fastq, SRR12671036-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 14:26:36 2025 >> started Tue Feb 11 14:26:53 2025 >> done (16.687s) 15829780 read pairs processed; of these: 122 ( 0.00%) short read pairs filtered out after trimming by size control 37594 ( 0.24%) empty read pairs filtered out after trimming by size control 15792064 (99.76%) read pairs available; of these: 940177 ( 5.95%) trimmed read pairs available after processing 14851887 (94.05%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 13 0.00% 20 13 0.00% 21 21 0.00% 22 15 0.00% 23 21 0.00% 24 22 0.00% 25 18 0.00% 26 32 0.00% 27 17 0.00% 28 28 0.00% 29 36 0.00% 30 30 0.00% 31 27 0.00% 32 22 0.00% 33 39 0.00% 34 27 0.00% 35 37 0.00% 36 19 0.00% 37 21 0.00% 38 25 0.00% 39 30 0.00% 40 27 0.00% 41 25 0.00% 42 23 0.00% 43 37 0.00% 44 21 0.00% 45 26 0.00% 46 27 0.00% 47 27 0.00% 48 33 0.00% 49 52 0.00% 50 41 0.00% 51 70 0.00% 52 60 0.00% 53 63 0.00% 54 72 0.00% 55 59 0.00% 56 90 0.00% 57 106 0.00% 58 94 0.00% 59 122 0.00% 60 145 0.00% 61 184 0.00% 62 177 0.00% 63 215 0.00% 64 201 0.00% 65 277 0.00% 66 267 0.00% 67 312 0.00% 68 344 0.00% 69 344 0.00% 70 494 0.00% 71 543 0.00% 72 564 0.00% 73 636 0.00% 74 752 0.00% 75 854 0.01% 76 914 0.01% 77 968 0.01% 78 1110 0.01% 79 1343 0.01% 80 1250 0.01% 81 1501 0.01% 82 1790 0.01% 83 1864 0.01% 84 2097 0.01% 85 2316 0.01% 86 2452 0.02% 87 2605 0.02% 88 2808 0.02% 89 2861 0.02% 90 3154 0.02% 91 3415 0.02% 92 3698 0.02% 93 4018 0.03% 94 4369 0.03% 95 4647 0.03% 96 4786 0.03% 97 5235 0.03% 98 5290 0.03% 99 5536 0.04% 100 5790 0.04% 101 6069 0.04% 102 6329 0.04% 103 6837 0.04% 104 7292 0.05% 105 7585 0.05% 106 7893 0.05% 107 8354 0.05% 108 8199 0.05% 109 8930 0.06% 110 8987 0.06% 111 9432 0.06% 112 9827 0.06% 113 10101 0.06% 114 10975 0.07% 115 11303 0.07% 116 11836 0.07% 117 12104 0.08% 118 12715 0.08% 119 12949 0.08% 120 13504 0.09% 121 13848 0.09% 122 14291 0.09% 123 14752 0.09% 124 15715 0.10% 125 15859 0.10% 126 16788 0.11% 127 16898 0.11% 128 17631 0.11% 129 18144 0.11% 130 18650 0.12% 131 18995 0.12% 132 19919 0.13% 133 20295 0.13% 134 20698 0.13% 135 21747 0.14% 136 21602 0.14% 137 22865 0.14% 138 23208 0.15% 139 24520 0.16% 140 24407 0.15% 141 25374 0.16% 142 25562 0.16% 143 26515 0.17% 144 27734 0.18% 145 27938 0.18% 146 28574 0.18% 147 29683 0.19% 148 30801 0.20% 149 30413 0.19% 150 31810 0.20% 151 14851887 94.05% 15792064 reads passed initial QC criterion=sequence-density sequence-density=0.52 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=20 prefix-density=0.52 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=23 fanout-score=491.72 fanout-score-rank=1 prefix-density=0.26 prefix-fanout=17.1 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTG criterion=sequence-density sequence-density=0.70 sequence-density-rank=1 fanout-score=2.04 fanout-score-rank=28 prefix-density=0.70 prefix-fanout=2.0 sequence=AACCGCACCCCGGCACA criterion=fanout-score sequence-density=0.21 sequence-density-rank=20 fanout-score=10.64 fanout-score-rank=1 prefix-density=0.39 prefix-fanout=5.8 sequence=AAGAAAGCTTACCCTAAC SRR12671036 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 14:28:04 Started mapping on | Feb 11 14:28:04 Finished on | Feb 11 14:29:50 Mapping speed, Million of reads per hour | 536.33 Number of input reads | 15792064 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 14716174 Uniquely mapped reads % | 93.19% Average mapped length | 297.69 Number of splices: Total | 14880246 Number of splices: Annotated (sjdb) | 14566765 Number of splices: GT/AG | 14582769 Number of splices: GC/AG | 246797 Number of splices: AT/AC | 8612 Number of splices: Non-canonical | 42068 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.78 Insertion rate per base | 0.02% Insertion average length | 2.26 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 376177 % of reads mapped to multiple loci | 2.38% Number of reads mapped to too many loci | 52820 % of reads mapped to too many loci | 0.33% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.97% % of reads unmapped: other | 0.13% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 699713 699713 699713 N_multimapping 376177 376177 376177 N_noFeature 595260 14474002 667201 N_ambiguous 266285 905 95585 UnstrandedReadsAssigned:13854629 PositiveStrandReadsAssigned:241267 NegativeStrandReadsAssigned:13953388 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671036 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671036-trimmed-pair1.fastq SRR12671036-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,792,064 reads, 13,884,405 reads pseudoaligned [quant] estimated average fragment length: 276.428 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,073 rounds 52401 SRR12671036.ke.tsv 34699 SRR12671036.se.tsv 87100 total ==> SRR12671036.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1742.57 397 13.7685 Potri.005G024800.1.v4.1 1035 759.572 447 35.5651 Potri.004G059700.1.v4.1 961 685.788 3 0.264373 Potri.007G009000.2.v4.1 1416 1140.57 0 0 Potri.003G141000.2.v4.1 2943 2667.57 1016 23.0178 Potri.016G087400.1.v4.1 270 74.1407 565 460.551 Potri.015G069301.1.v4.1 564 303.14 0 0 Potri.010G195200.1.v4.1 1773 1497.57 69 2.7845 Potri.012G127500.1.v4.1 977 701.657 83 7.14889 ==> SRR12671036.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 217 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 190 Potri.001G212900.v4.1 4 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 10 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR12671036 completed mapping pipeline successfully