Starting /dee2/code/volunteer_pipeline.sh SRR12671037 current disk space = 3049942306816 free memory = 1469729400 SRR12671037 SRAfilesize 3999a0550d10cf222205f055a67e8c3e SRR12671037.sra SRR12671037.sra file validated SRR12671037 is paired end SRR12671037 is conventional basespace SRR12671037 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671037_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.458 37.0 37.0 37.0 37.0 37.0 2 36.4295 37.0 37.0 37.0 37.0 37.0 3 36.5725 37.0 37.0 37.0 37.0 37.0 4 36.5515 37.0 37.0 37.0 37.0 37.0 5 36.597 37.0 37.0 37.0 37.0 37.0 6 36.649 37.0 37.0 37.0 37.0 37.0 7 36.5075 37.0 37.0 37.0 37.0 37.0 8 36.6255 37.0 37.0 37.0 37.0 37.0 9 36.619 37.0 37.0 37.0 37.0 37.0 10-14 36.6709 37.0 37.0 37.0 37.0 37.0 15-19 36.608799999999995 37.0 37.0 37.0 37.0 37.0 20-24 36.567 37.0 37.0 37.0 37.0 37.0 25-29 36.6051 37.0 37.0 37.0 37.0 37.0 30-34 36.5141 37.0 37.0 37.0 37.0 37.0 35-39 36.5586 37.0 37.0 37.0 37.0 37.0 40-44 36.540600000000005 37.0 37.0 37.0 37.0 37.0 45-49 36.5116 37.0 37.0 37.0 37.0 37.0 50-54 36.51690000000001 37.0 37.0 37.0 37.0 37.0 55-59 36.4774 37.0 37.0 37.0 37.0 37.0 60-64 36.4393 37.0 37.0 37.0 37.0 37.0 65-69 36.4085 37.0 37.0 37.0 37.0 37.0 70-74 36.407799999999995 37.0 37.0 37.0 37.0 37.0 75-79 36.3626 37.0 37.0 37.0 37.0 37.0 80-84 36.364999999999995 37.0 37.0 37.0 37.0 37.0 85-89 36.317600000000006 37.0 37.0 37.0 37.0 37.0 90-94 36.3014 37.0 37.0 37.0 37.0 37.0 95-99 36.3022 37.0 37.0 37.0 37.0 37.0 100-104 36.239 37.0 37.0 37.0 37.0 37.0 105-109 36.2032 37.0 37.0 37.0 37.0 37.0 110-114 36.197799999999994 37.0 37.0 37.0 37.0 37.0 115-119 36.149 37.0 37.0 37.0 37.0 37.0 120-124 36.118100000000005 37.0 37.0 37.0 37.0 37.0 125-129 36.0809 37.0 37.0 37.0 37.0 37.0 130-134 35.964299999999994 37.0 37.0 37.0 37.0 37.0 135-139 35.986599999999996 37.0 37.0 37.0 37.0 37.0 140-144 35.9089 37.0 37.0 37.0 37.0 37.0 145-149 35.8243 37.0 37.0 37.0 37.0 37.0 150-151 35.65525 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 0.0 22 1.0 23 0.0 24 1.0 25 5.0 26 4.0 27 9.0 28 14.0 29 23.0 30 26.0 31 32.0 32 41.0 33 77.0 34 92.0 35 248.0 36 2735.0 37 691.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.95 11.475 5.7 38.875 2 17.75 12.4 36.975 32.875 3 17.5 15.5 28.549999999999997 38.45 4 22.875 22.075 24.75 30.3 5 23.775 30.675 23.45 22.1 6 20.575 32.574999999999996 23.35 23.5 7 15.55 26.05 41.925000000000004 16.475 8 16.950000000000003 26.025 33.2 23.825 9 17.224999999999998 23.150000000000002 36.25 23.375 10-14 18.905 30.035 28.360000000000003 22.7 15-19 20.205000000000002 28.075 28.854999999999997 22.865 20-24 19.470000000000002 28.685 28.21 23.635 25-29 19.915 28.910000000000004 28.060000000000002 23.115 30-34 19.895 28.33 27.800000000000004 23.974999999999998 35-39 20.18 28.244999999999997 27.775 23.799999999999997 40-44 19.725 29.585 27.534999999999997 23.155 45-49 20.3 28.444999999999997 27.955000000000002 23.3 50-54 20.11 28.555000000000003 27.865000000000002 23.47 55-59 19.86 28.315 28.144999999999996 23.68 60-64 20.4 28.244999999999997 27.500000000000004 23.855 65-69 20.325 28.7 27.634999999999998 23.34 70-74 20.19 28.455000000000002 27.73 23.625 75-79 20.4 27.88 27.76 23.96 80-84 20.294999999999998 28.794999999999998 27.534999999999997 23.375 85-89 19.84 28.865000000000002 27.375 23.919999999999998 90-94 20.235 27.884999999999998 27.944999999999997 23.935000000000002 95-99 20.41 28.194999999999997 27.884999999999998 23.51 100-104 21.075 29.28 27.07 22.575 105-109 20.765 27.975 27.82 23.44 110-114 20.560000000000002 28.305000000000003 27.560000000000002 23.575 115-119 20.005 28.435 28.599999999999998 22.96 120-124 20.44 28.065 28.13 23.365 125-129 20.535 27.805000000000003 28.215 23.445 130-134 20.605 28.265 27.985 23.145 135-139 20.825 28.17 28.125 22.88 140-144 20.45 28.935 27.325 23.29 145-149 20.84 28.525 27.245 23.39 150-151 20.9 27.575 28.0875 23.4375 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 1.0 21 0.5 22 2.0 23 4.5 24 5.0 25 3.5 26 5.0 27 6.5 28 8.0 29 12.0 30 13.5 31 21.5 32 34.0 33 49.0 34 67.0 35 70.0 36 83.0 37 110.5 38 133.5 39 168.5 40 193.0 41 206.0 42 229.5 43 267.0 44 263.0 45 232.0 46 238.5 47 249.0 48 239.5 49 220.0 50 200.5 51 165.0 52 123.0 53 95.0 54 80.5 55 60.5 56 38.0 57 24.0 58 19.5 59 18.5 60 13.5 61 8.0 62 3.0 63 2.5 64 2.5 65 2.0 66 1.5 67 1.0 68 0.5 69 0.5 70 1.0 71 0.5 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.425 #Duplication Level Percentage of deduplicated Percentage of total 1 89.40452893486162 79.95 2 9.421302767682416 16.85 3 1.118255521386637 3.0 4 0.05591277606933184 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.225 0.0 0.0 0.0 0.0 96-97 0.30000000000000004 0.0 0.0 0.0 0.0 98-99 0.3875 0.0 0.0 0.0 0.0 100-101 0.4 0.0 0.0 0.0 0.0 102-103 0.47500000000000003 0.0 0.0 0.0 0.0 104-105 0.6375 0.0 0.0 0.0 0.0 106-107 0.725 0.0 0.0 0.0 0.0 108-109 0.8500000000000001 0.0 0.0 0.0 0.0 110-111 0.9125000000000001 0.0 0.0 0.0 0.0 112-113 1.075 0.0 0.0 0.0 0.0 114-115 1.275 0.0 0.0 0.0 0.0 116-117 1.375 0.0 0.0 0.0 0.0 118-119 1.5125000000000002 0.0 0.0 0.0 0.0 120-121 1.75 0.0 0.0 0.0 0.0 122-123 1.9249999999999998 0.0 0.0 0.0 0.0 124-125 2.0125 0.0 0.0 0.0 0.0 126-127 2.0625 0.0 0.0 0.0 0.0 128-129 2.2 0.0 0.0 0.0 0.0 130-131 2.4125 0.0 0.0 0.0 0.0 132-133 2.5999999999999996 0.0 0.0 0.0 0.0 134-135 2.8875 0.0 0.0 0.0 0.0 136-137 3.0875 0.0 0.0 0.0 0.0 138-139 3.375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12671037 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671037_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.239 37.0 37.0 37.0 37.0 37.0 2 36.357 37.0 37.0 37.0 37.0 37.0 3 36.3675 37.0 37.0 37.0 37.0 37.0 4 36.425 37.0 37.0 37.0 37.0 37.0 5 36.477 37.0 37.0 37.0 37.0 37.0 6 36.4945 37.0 37.0 37.0 37.0 37.0 7 36.467 37.0 37.0 37.0 37.0 37.0 8 36.4965 37.0 37.0 37.0 37.0 37.0 9 36.393 37.0 37.0 37.0 37.0 37.0 10-14 36.472899999999996 37.0 37.0 37.0 37.0 37.0 15-19 36.4317 37.0 37.0 37.0 37.0 37.0 20-24 36.4157 37.0 37.0 37.0 37.0 37.0 25-29 36.3712 37.0 37.0 37.0 37.0 37.0 30-34 36.3453 37.0 37.0 37.0 37.0 37.0 35-39 36.33519999999999 37.0 37.0 37.0 37.0 37.0 40-44 36.3255 37.0 37.0 37.0 37.0 37.0 45-49 36.3231 37.0 37.0 37.0 37.0 37.0 50-54 36.2608 37.0 37.0 37.0 37.0 37.0 55-59 36.2385 37.0 37.0 37.0 37.0 37.0 60-64 36.251999999999995 37.0 37.0 37.0 37.0 37.0 65-69 36.2631 37.0 37.0 37.0 37.0 37.0 70-74 36.199 37.0 37.0 37.0 37.0 37.0 75-79 36.1625 37.0 37.0 37.0 37.0 37.0 80-84 36.1449 37.0 37.0 37.0 37.0 37.0 85-89 36.062599999999996 37.0 37.0 37.0 37.0 37.0 90-94 36.0458 37.0 37.0 37.0 37.0 37.0 95-99 36.0667 37.0 37.0 37.0 37.0 37.0 100-104 36.12179999999999 37.0 37.0 37.0 37.0 37.0 105-109 36.01030000000001 37.0 37.0 37.0 37.0 37.0 110-114 36.0106 37.0 37.0 37.0 37.0 37.0 115-119 35.9478 37.0 37.0 37.0 37.0 37.0 120-124 35.876 37.0 37.0 37.0 37.0 37.0 125-129 35.8768 37.0 37.0 37.0 37.0 37.0 130-134 35.846399999999996 37.0 37.0 37.0 37.0 37.0 135-139 35.8464 37.0 37.0 37.0 37.0 37.0 140-144 35.8 37.0 37.0 37.0 37.0 37.0 145-149 35.5721 37.0 37.0 37.0 37.0 37.0 150-151 35.3515 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 2.0 14 0.0 15 1.0 16 2.0 17 2.0 18 0.0 19 1.0 20 0.0 21 2.0 22 3.0 23 5.0 24 3.0 25 8.0 26 13.0 27 14.0 28 9.0 29 10.0 30 27.0 31 36.0 32 45.0 33 74.0 34 129.0 35 380.0 36 2665.0 37 568.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.725 22.125 9.950000000000001 25.2 2 26.25 25.324999999999996 31.874999999999996 16.55 3 21.825 25.374999999999996 33.25 19.55 4 25.025 33.775 24.224999999999998 16.975 5 25.1 36.275 21.625 17.0 6 19.925 40.8 22.125 17.150000000000002 7 20.05 23.425 38.425 18.099999999999998 8 18.725 26.724999999999998 30.9 23.65 9 22.1 24.325 29.675 23.9 10-14 22.805 29.84 26.31 21.044999999999998 15-19 22.705000000000002 28.665000000000003 27.805000000000003 20.825 20-24 22.39 28.99 27.41 21.21 25-29 22.66 28.725 27.88 20.735 30-34 22.82 28.360000000000003 27.88 20.94 35-39 22.855 27.284999999999997 28.110000000000003 21.75 40-44 22.655 28.000000000000004 28.389999999999997 20.955 45-49 22.470000000000002 27.935 28.46 21.135 50-54 22.0 28.754999999999995 27.839999999999996 21.404999999999998 55-59 23.195 27.83 28.465 20.51 60-64 22.665 28.01 28.525 20.8 65-69 22.325 27.845 28.465 21.365000000000002 70-74 22.545 28.51 27.565 21.38 75-79 22.605 28.265 28.005000000000003 21.125 80-84 23.189999999999998 28.235 27.63 20.945 85-89 22.62 28.360000000000003 27.57 21.45 90-94 23.085 27.87 28.025 21.02 95-99 23.29 28.175 28.144999999999996 20.39 100-104 24.0 27.71 27.195000000000004 21.095 105-109 23.565 27.694999999999997 28.015 20.724999999999998 110-114 23.04 28.389999999999997 28.199999999999996 20.369999999999997 115-119 23.73 28.065 28.005000000000003 20.200000000000003 120-124 23.724999999999998 28.52 27.389999999999997 20.365 125-129 23.945 28.395 27.07 20.59 130-134 23.669999999999998 28.345 27.375 20.61 135-139 23.925 27.894999999999996 28.21 19.97 140-144 23.89 27.58 28.060000000000002 20.47 145-149 24.94 28.425 27.169999999999998 19.465 150-151 24.2875 27.6 27.9375 20.175 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 1.5 12 1.0 13 1.0 14 2.0 15 1.0 16 0.5 17 1.0 18 0.5 19 0.5 20 1.5 21 3.5 22 2.5 23 1.5 24 3.0 25 5.5 26 7.0 27 10.0 28 13.0 29 12.5 30 17.5 31 21.5 32 28.5 33 50.0 34 58.0 35 72.5 36 100.0 37 124.5 38 146.0 39 183.0 40 206.0 41 204.0 42 221.0 43 251.0 44 281.0 45 280.5 46 270.0 47 248.5 48 226.5 49 196.0 50 138.5 51 116.5 52 104.5 53 84.0 54 71.0 55 59.5 56 50.0 57 33.0 58 18.0 59 13.5 60 13.0 61 9.5 62 7.5 63 5.0 64 3.0 65 1.5 66 1.0 67 1.0 68 0.5 69 1.0 70 1.0 71 0.0 72 0.0 73 0.0 74 0.5 75 1.0 76 0.5 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.5 96 0.5 97 0.0 98 0.5 99 0.5 100 3.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 88.925 #Duplication Level Percentage of deduplicated Percentage of total 1 89.20438571830194 79.325 2 9.474276075344392 16.85 3 1.0964295754849593 2.9250000000000003 4 0.1967950520101209 0.7000000000000001 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.028113578858588697 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 8 0.2 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.225 0.0 0.0 0.0 0.0 96-97 0.30000000000000004 0.0 0.0 0.0 0.0 98-99 0.3875 0.0 0.0 0.0 0.0 100-101 0.4 0.0 0.0 0.0 0.0 102-103 0.47500000000000003 0.0 0.0 0.0 0.0 104-105 0.6375 0.0 0.0 0.0 0.0 106-107 0.725 0.0 0.0 0.0 0.0 108-109 0.8500000000000001 0.0 0.0 0.0 0.0 110-111 0.925 0.0 0.0 0.0 0.0 112-113 1.1 0.0 0.0 0.0 0.0 114-115 1.2999999999999998 0.0 0.0 0.0 0.0 116-117 1.4 0.0 0.0 0.0 0.0 118-119 1.5375 0.0 0.0 0.0 0.0 120-121 1.775 0.0 0.0 0.0 0.0 122-123 1.9500000000000002 0.0 0.0 0.0 0.0 124-125 2.0374999999999996 0.0 0.0 0.0 0.0 126-127 2.0875000000000004 0.0 0.0 0.0 0.0 128-129 2.225 0.0 0.0 0.0 0.0 130-131 2.4375 0.0 0.0 0.0 0.0 132-133 2.625 0.0 0.0 0.0 0.0 134-135 2.9125 0.0 0.0 0.0 0.0 136-137 3.1125 0.0 0.0 0.0 0.0 138-139 3.4 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTTCAAC 10 0.006830828 145.0 1 ATGGCCA 10 0.006830828 145.0 4 GGCTGAA 10 0.006830828 145.0 4 CATGGCT 10 0.006830828 145.0 1 >>END_MODULE Read 754247 spots for SRR12671037.sra Written 754247 spots for SRR12671037.sra Read 754247 spots for SRR12671037.sra Written 754247 spots for SRR12671037.sra Read 754247 spots for SRR12671037.sra Written 754247 spots for SRR12671037.sra Read 754247 spots for SRR12671037.sra Written 754247 spots for SRR12671037.sra Read 754247 spots for SRR12671037.sra Written 754247 spots for SRR12671037.sra Read 754247 spots for SRR12671037.sra Written 754247 spots for SRR12671037.sra Read 754247 spots for SRR12671037.sra Written 754247 spots for SRR12671037.sra Read 754247 spots for SRR12671037.sra Written 754247 spots for SRR12671037.sra Read 754247 spots for SRR12671037.sra Written 754247 spots for SRR12671037.sra Read 754247 spots for SRR12671037.sra Written 754247 spots for SRR12671037.sra Read 754247 spots for SRR12671037.sra Written 754247 spots for SRR12671037.sra Read 754247 spots for SRR12671037.sra Written 754247 spots for SRR12671037.sra Read 754247 spots for SRR12671037.sra Written 754247 spots for SRR12671037.sra Read 754247 spots for SRR12671037.sra Written 754247 spots for SRR12671037.sra Read 754247 spots for SRR12671037.sra Written 754247 spots for SRR12671037.sra Read 754247 spots for SRR12671037.sra Written 754247 spots for SRR12671037.sra Read 754247 spots for SRR12671037.sra Written 754247 spots for SRR12671037.sra Read 754247 spots for SRR12671037.sra Written 754247 spots for SRR12671037.sra Read 754252 spots for SRR12671037.sra Written 754252 spots for SRR12671037.sra Read 754247 spots for SRR12671037.sra Written 754247 spots for SRR12671037.sra SRR ids: ['SRR12671037.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_f0_fukak SRR12671037.sra spots: 15084945 blocks: [[1, 754247], [754248, 1508494], [1508495, 2262741], [2262742, 3016988], [3016989, 3771235], [3771236, 4525482], [4525483, 5279729], [5279730, 6033976], [6033977, 6788223], [6788224, 7542470], [7542471, 8296717], [8296718, 9050964], [9050965, 9805211], [9805212, 10559458], [10559459, 11313705], [11313706, 12067952], [12067953, 12822199], [12822200, 13576446], [13576447, 14330693], [14330694, 15084945]] SRR12671037 file size 5104823 SRR12671037 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671037 SRR12671037_1.fastq SRR12671037_2.fastq Input file: SRR12671037_1.fastq Paired file: SRR12671037_2.fastq trimmed: SRR12671037-trimmed-pair1.fastq, SRR12671037-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 14:40:20 2025 >> started Tue Feb 11 14:40:35 2025 >> done (15.957s) 15084945 read pairs processed; of these: 57 ( 0.00%) short read pairs filtered out after trimming by size control 1800 ( 0.01%) empty read pairs filtered out after trimming by size control 15083088 (99.99%) read pairs available; of these: 781537 ( 5.18%) trimmed read pairs available after processing 14301551 (94.82%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 3 0.00% 20 3 0.00% 21 9 0.00% 22 4 0.00% 23 5 0.00% 24 9 0.00% 25 5 0.00% 26 12 0.00% 27 7 0.00% 28 6 0.00% 29 14 0.00% 30 5 0.00% 31 8 0.00% 32 11 0.00% 33 7 0.00% 34 4 0.00% 35 13 0.00% 36 7 0.00% 37 11 0.00% 38 7 0.00% 39 13 0.00% 40 12 0.00% 41 17 0.00% 42 19 0.00% 43 14 0.00% 44 21 0.00% 45 9 0.00% 46 15 0.00% 47 21 0.00% 48 18 0.00% 49 27 0.00% 50 39 0.00% 51 53 0.00% 52 45 0.00% 53 50 0.00% 54 41 0.00% 55 44 0.00% 56 57 0.00% 57 69 0.00% 58 66 0.00% 59 85 0.00% 60 111 0.00% 61 88 0.00% 62 122 0.00% 63 128 0.00% 64 154 0.00% 65 146 0.00% 66 207 0.00% 67 205 0.00% 68 239 0.00% 69 258 0.00% 70 315 0.00% 71 368 0.00% 72 380 0.00% 73 456 0.00% 74 503 0.00% 75 564 0.00% 76 650 0.00% 77 720 0.00% 78 776 0.01% 79 875 0.01% 80 939 0.01% 81 1072 0.01% 82 1175 0.01% 83 1277 0.01% 84 1413 0.01% 85 1557 0.01% 86 1741 0.01% 87 1877 0.01% 88 2035 0.01% 89 2187 0.01% 90 2321 0.02% 91 2484 0.02% 92 2701 0.02% 93 2928 0.02% 94 3256 0.02% 95 3424 0.02% 96 3691 0.02% 97 3950 0.03% 98 4152 0.03% 99 4491 0.03% 100 4581 0.03% 101 4558 0.03% 102 5037 0.03% 103 5324 0.04% 104 5792 0.04% 105 5892 0.04% 106 6270 0.04% 107 6767 0.04% 108 7023 0.05% 109 7237 0.05% 110 7262 0.05% 111 7550 0.05% 112 8023 0.05% 113 8211 0.05% 114 8695 0.06% 115 9096 0.06% 116 9535 0.06% 117 10044 0.07% 118 10376 0.07% 119 10891 0.07% 120 11338 0.08% 121 11675 0.08% 122 11844 0.08% 123 12454 0.08% 124 12609 0.08% 125 13209 0.09% 126 13733 0.09% 127 14200 0.09% 128 14708 0.10% 129 15456 0.10% 130 15752 0.10% 131 15938 0.11% 132 16556 0.11% 133 17190 0.11% 134 17513 0.12% 135 18332 0.12% 136 18614 0.12% 137 19176 0.13% 138 19822 0.13% 139 20689 0.14% 140 21250 0.14% 141 21743 0.14% 142 22509 0.15% 143 22888 0.15% 144 23440 0.16% 145 24017 0.16% 146 24519 0.16% 147 25017 0.17% 148 26261 0.17% 149 26508 0.18% 150 27589 0.18% 151 14301551 94.82% 15083088 reads passed initial QC criterion=sequence-density sequence-density=0.48 sequence-density-rank=1 fanout-score=2.23 fanout-score-rank=31 prefix-density=0.50 prefix-fanout=2.1 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=37 fanout-score=162.15 fanout-score-rank=1 prefix-density=0.16 prefix-fanout=10.3 sequence=TCTCCAAAAACCCAATAAAAAAGGAAGAGGTAAAGCATTTTGCCAAGGTCTAAGTACAATTTAAACAAACCACCCCTAAGGCCCTAACAGATATAGCTAGGGACACATCAAGTTCTGGGACGACTTAGACACCTTTCGGCTTGGCGGCAATAAAGCTGATGCACTGCACTTGACG criterion=sequence-density sequence-density=0.64 sequence-density-rank=1 fanout-score=2.32 fanout-score-rank=29 prefix-density=0.67 prefix-fanout=2.2 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=85.57 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=8.4 sequence=AAGGATGGTAGAGTAGCATCCTTAGCGTTGCTGGTTTACTTTCCTAACAATCCTCAAAACCATTCTTCTTAGACTCTCTATACATTCCAAATAACCTAATTTGTACTGTATAGATATATAGTCTACGTCAAGCTTAAATAAATCCTCATTAACATGGCCCCAGGAGTGCCTATAGATGGGAATATTTTGGGTACCGGGAAGGTTTCCACAGTTAACACTGGCTATTCTAAGAGGGCCTACGTGACATTTTTAGCCGGCAACGGGGATTATGTTAAAGGGGTAGTTGGGTTGGCTAAGGGTTTGCGCAAGGTGAAGAGTGCATACCCTCTTGTCGTAGCAATCTTGCCGGATGTGCCCGAGGAACACCGTGACATTTTGAGGTCTCAAGGTTGCATTGTTCGTGAGATCGAGCCTATTTATCCACCTGAGAACCAGATTCAGTTTGCCATGGCCTACTACGTGATCAACTACTCCAAGCTCCGAATTTGGAATTTTGAGGAGTACAGCAAGA SRR12671037 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 14:41:18 Started mapping on | Feb 11 14:41:18 Finished on | Feb 11 14:42:50 Mapping speed, Million of reads per hour | 590.21 Number of input reads | 15083088 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 14329825 Uniquely mapped reads % | 95.01% Average mapped length | 298.43 Number of splices: Total | 14741227 Number of splices: Annotated (sjdb) | 14445722 Number of splices: GT/AG | 14444442 Number of splices: GC/AG | 249223 Number of splices: AT/AC | 8302 Number of splices: Non-canonical | 39260 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.86 Insertion rate per base | 0.02% Insertion average length | 2.33 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 336363 % of reads mapped to multiple loci | 2.23% Number of reads mapped to too many loci | 38292 % of reads mapped to too many loci | 0.25% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.42% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 416900 416900 416900 N_multimapping 336363 336363 336363 N_noFeature 585289 14138998 656734 N_ambiguous 206537 836 86721 UnstrandedReadsAssigned:13537999 PositiveStrandReadsAssigned:189991 NegativeStrandReadsAssigned:13586370 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671037 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671037-trimmed-pair1.fastq SRR12671037-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,083,088 reads, 13,561,449 reads pseudoaligned [quant] estimated average fragment length: 281.21 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,047 rounds 52401 SRR12671037.ke.tsv 34699 SRR12671037.se.tsv 87100 total ==> SRR12671037.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1737.79 468 18.2776 Potri.005G024800.1.v4.1 1035 754.79 239 21.4903 Potri.004G059700.1.v4.1 961 681.01 7 0.697615 Potri.007G009000.2.v4.1 1416 1135.79 0 0 Potri.003G141000.2.v4.1 2943 2662.79 787.57 20.0735 Potri.016G087400.1.v4.1 270 71.821 521 492.331 Potri.015G069301.1.v4.1 564 299.104 0 0 Potri.010G195200.1.v4.1 1773 1492.79 34 1.54579 Potri.012G127500.1.v4.1 977 696.933 80 7.79059 ==> SRR12671037.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 163 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 187 Potri.001G212900.v4.1 3 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 5 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 10 SRR12671037 completed mapping pipeline successfully