Starting /dee2/code/volunteer_pipeline.sh SRR12671038 current disk space = 3049901936640 free memory = 1470638404 SRR12671038 SRAfilesize 8990793dbd1b07db161aeb0edd524bb0 SRR12671038.sra SRR12671038.sra file validated SRR12671038 is paired end SRR12671038 is conventional basespace SRR12671038 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671038_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.38225 37.0 37.0 37.0 37.0 37.0 2 36.4245 37.0 37.0 37.0 37.0 37.0 3 36.602 37.0 37.0 37.0 37.0 37.0 4 36.5655 37.0 37.0 37.0 37.0 37.0 5 36.579 37.0 37.0 37.0 37.0 37.0 6 36.6075 37.0 37.0 37.0 37.0 37.0 7 36.624 37.0 37.0 37.0 37.0 37.0 8 36.4845 37.0 37.0 37.0 37.0 37.0 9 36.603 37.0 37.0 37.0 37.0 37.0 10-14 36.579699999999995 37.0 37.0 37.0 37.0 37.0 15-19 36.5961 37.0 37.0 37.0 37.0 37.0 20-24 36.57520000000001 37.0 37.0 37.0 37.0 37.0 25-29 36.4734 37.0 37.0 37.0 37.0 37.0 30-34 36.45550000000001 37.0 37.0 37.0 37.0 37.0 35-39 36.4711 37.0 37.0 37.0 37.0 37.0 40-44 36.448299999999996 37.0 37.0 37.0 37.0 37.0 45-49 36.4217 37.0 37.0 37.0 37.0 37.0 50-54 36.368100000000005 37.0 37.0 37.0 37.0 37.0 55-59 36.3628 37.0 37.0 37.0 37.0 37.0 60-64 36.3679 37.0 37.0 37.0 37.0 37.0 65-69 36.2442 37.0 37.0 37.0 37.0 37.0 70-74 36.284000000000006 37.0 37.0 37.0 37.0 37.0 75-79 36.2671 37.0 37.0 37.0 37.0 37.0 80-84 36.2247 37.0 37.0 37.0 37.0 37.0 85-89 36.24849999999999 37.0 37.0 37.0 37.0 37.0 90-94 36.1854 37.0 37.0 37.0 37.0 37.0 95-99 36.11900000000001 37.0 37.0 37.0 37.0 37.0 100-104 36.1923 37.0 37.0 37.0 37.0 37.0 105-109 36.150999999999996 37.0 37.0 37.0 37.0 37.0 110-114 36.052499999999995 37.0 37.0 37.0 37.0 37.0 115-119 36.0341 37.0 37.0 37.0 37.0 37.0 120-124 36.022000000000006 37.0 37.0 37.0 37.0 37.0 125-129 36.0162 37.0 37.0 37.0 37.0 37.0 130-134 35.831999999999994 37.0 37.0 37.0 37.0 37.0 135-139 35.883 37.0 37.0 37.0 37.0 37.0 140-144 35.768 37.0 37.0 37.0 37.0 37.0 145-149 35.6856 37.0 37.0 37.0 37.0 37.0 150-151 35.53375 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 3.0 21 0.0 22 2.0 23 4.0 24 3.0 25 3.0 26 6.0 27 9.0 28 10.0 29 19.0 30 30.0 31 36.0 32 54.0 33 78.0 34 127.0 35 307.0 36 2721.0 37 587.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 48.687171792948234 11.802950737684421 5.976494123530883 33.53338334583646 2 20.7 10.9 37.15 31.25 3 17.925 16.35 28.249999999999996 37.475 4 22.5 23.0 23.799999999999997 30.7 5 23.474999999999998 30.4 25.724999999999998 20.4 6 21.2 33.125 23.75 21.925 7 15.049999999999999 27.425 41.675000000000004 15.85 8 16.0 26.125 33.775 24.099999999999998 9 16.925 24.275 36.325 22.475 10-14 19.755 30.17 28.03 22.045 15-19 19.5 28.705000000000002 28.34 23.455000000000002 20-24 19.545 28.895 28.105000000000004 23.455000000000002 25-29 19.64 28.52 27.91 23.93 30-34 19.63 28.71 27.525 24.135 35-39 19.585 28.425 28.299999999999997 23.69 40-44 19.71 28.384999999999998 28.255000000000003 23.65 45-49 19.465 28.455000000000002 28.26 23.82 50-54 19.52 28.294999999999998 28.46 23.724999999999998 55-59 19.945 28.705000000000002 27.894999999999996 23.455000000000002 60-64 20.28 28.139999999999997 28.199999999999996 23.380000000000003 65-69 20.465 28.09 27.985 23.46 70-74 19.885 29.060000000000002 27.534999999999997 23.52 75-79 20.805 28.345 27.839999999999996 23.01 80-84 19.855 28.884999999999998 27.779999999999998 23.48 85-89 20.235 28.349999999999998 28.24 23.175 90-94 19.67 28.505000000000003 27.794999999999998 24.03 95-99 19.955000000000002 28.33 27.92 23.794999999999998 100-104 20.3 28.389999999999997 27.705000000000002 23.605 105-109 20.255000000000003 28.585 27.215 23.945 110-114 20.19 28.720000000000002 27.685 23.405 115-119 20.885 28.115000000000002 27.894999999999996 23.105 120-124 20.21 28.415000000000003 27.694999999999997 23.68 125-129 20.724999999999998 28.315 27.88 23.080000000000002 130-134 20.665 27.915 28.199999999999996 23.22 135-139 20.125 28.439999999999998 27.83 23.605 140-144 20.405 28.09 27.584999999999997 23.919999999999998 145-149 20.1020102010201 28.70787078707871 27.277727772777276 23.912391239123913 150-151 20.3375 28.6375 26.0625 24.962500000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 1.0 3 1.0 4 0.5 5 0.5 6 1.0 7 1.5 8 0.5 9 0.0 10 0.0 11 0.5 12 0.5 13 1.0 14 1.5 15 0.5 16 0.0 17 0.5 18 0.5 19 1.0 20 2.0 21 1.5 22 1.5 23 2.5 24 2.5 25 5.0 26 7.5 27 8.5 28 12.0 29 15.0 30 17.0 31 21.5 32 29.5 33 39.0 34 56.0 35 72.5 36 91.5 37 111.0 38 136.5 39 163.0 40 182.5 41 217.5 42 243.5 43 262.5 44 270.0 45 268.0 46 270.0 47 253.5 48 218.5 49 186.5 50 176.5 51 163.5 52 120.0 53 92.0 54 74.5 55 50.5 56 40.0 57 28.5 58 23.5 59 20.0 60 10.5 61 6.0 62 6.5 63 3.0 64 1.5 65 1.5 66 0.5 67 0.5 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.01 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.65 #Duplication Level Percentage of deduplicated Percentage of total 1 92.60658391797085 85.8 2 6.853750674581758 12.7 3 0.5396654074473827 1.5 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.1375 0.0 0.0 0.0 0.0 92-93 0.1875 0.0 0.0 0.0 0.0 94-95 0.2 0.0 0.0 0.0 0.0 96-97 0.2375 0.0 0.0 0.0 0.0 98-99 0.2875 0.0 0.0 0.0 0.0 100-101 0.3875 0.0 0.0 0.0 0.0 102-103 0.475 0.0 0.0 0.0 0.0 104-105 0.525 0.0 0.0 0.0 0.0 106-107 0.5375000000000001 0.0 0.0 0.0 0.0 108-109 0.5625 0.0 0.0 0.0 0.0 110-111 0.75 0.0 0.0 0.0 0.0 112-113 0.875 0.0 0.0 0.0 0.0 114-115 0.9375 0.0 0.0 0.0 0.0 116-117 1.025 0.0 0.0 0.0 0.0 118-119 1.0875 0.0 0.0 0.0 0.0 120-121 1.15 0.0 0.0 0.0 0.0 122-123 1.2625 0.0 0.0 0.0 0.0 124-125 1.3375 0.0 0.0 0.0 0.0 126-127 1.525 0.0 0.0 0.0 0.0 128-129 1.5625 0.0 0.0 0.0 0.0 130-131 1.7625000000000002 0.0 0.0 0.0 0.0 132-133 1.9 0.0 0.0 0.0 0.0 134-135 2.0875 0.0 0.0 0.0 0.0 136-137 2.3 0.0 0.0 0.0 0.0 138-139 2.55 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12671038 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671038_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.185 37.0 37.0 37.0 37.0 37.0 2 36.275 37.0 37.0 37.0 37.0 37.0 3 36.21 37.0 37.0 37.0 37.0 37.0 4 36.3195 37.0 37.0 37.0 37.0 37.0 5 36.428 37.0 37.0 37.0 37.0 37.0 6 36.317 37.0 37.0 37.0 37.0 37.0 7 36.3105 37.0 37.0 37.0 37.0 37.0 8 36.413 37.0 37.0 37.0 37.0 37.0 9 36.3515 37.0 37.0 37.0 37.0 37.0 10-14 36.3937 37.0 37.0 37.0 37.0 37.0 15-19 36.412099999999995 37.0 37.0 37.0 37.0 37.0 20-24 36.3689 37.0 37.0 37.0 37.0 37.0 25-29 36.3094 37.0 37.0 37.0 37.0 37.0 30-34 36.2943 37.0 37.0 37.0 37.0 37.0 35-39 36.2724 37.0 37.0 37.0 37.0 37.0 40-44 36.267700000000005 37.0 37.0 37.0 37.0 37.0 45-49 36.235 37.0 37.0 37.0 37.0 37.0 50-54 36.1555 37.0 37.0 37.0 37.0 37.0 55-59 36.1706 37.0 37.0 37.0 37.0 37.0 60-64 36.139199999999995 37.0 37.0 37.0 37.0 37.0 65-69 36.0779 37.0 37.0 37.0 37.0 37.0 70-74 36.1494 37.0 37.0 37.0 37.0 37.0 75-79 36.075 37.0 37.0 37.0 37.0 37.0 80-84 36.06719999999999 37.0 37.0 37.0 37.0 37.0 85-89 35.9588 37.0 37.0 37.0 37.0 37.0 90-94 36.0258 37.0 37.0 37.0 37.0 37.0 95-99 35.966899999999995 37.0 37.0 37.0 37.0 37.0 100-104 35.9966 37.0 37.0 37.0 37.0 37.0 105-109 35.8908 37.0 37.0 37.0 37.0 37.0 110-114 35.8856 37.0 37.0 37.0 37.0 37.0 115-119 35.8036 37.0 37.0 37.0 37.0 37.0 120-124 35.7641 37.0 37.0 37.0 37.0 37.0 125-129 35.7221 37.0 37.0 37.0 37.0 37.0 130-134 35.731100000000005 37.0 37.0 37.0 37.0 37.0 135-139 35.6284 37.0 37.0 37.0 37.0 37.0 140-144 35.58284999999999 37.0 37.0 37.0 37.0 37.0 145-149 35.4898 37.0 37.0 37.0 37.0 37.0 150-151 35.118750000000006 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 2.0 16 2.0 17 0.0 18 2.0 19 1.0 20 2.0 21 1.0 22 3.0 23 4.0 24 3.0 25 4.0 26 13.0 27 14.0 28 18.0 29 27.0 30 29.0 31 46.0 32 66.0 33 69.0 34 158.0 35 381.0 36 2646.0 37 508.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.5 23.799999999999997 9.525 23.175 2 25.85 24.75 32.05 17.349999999999998 3 19.1 26.950000000000003 34.775 19.175 4 24.474999999999998 33.425 23.575 18.525 5 25.025 38.05 20.05 16.875 6 20.974999999999998 41.449999999999996 20.25 17.325 7 19.775000000000002 23.275000000000002 38.775 18.175 8 19.325 25.95 29.775000000000002 24.95 9 21.349999999999998 23.974999999999998 31.65 23.025000000000002 10-14 23.235 29.23 27.029999999999998 20.505000000000003 15-19 22.655 27.76 28.02 21.565 20-24 22.509999999999998 27.939999999999998 27.68 21.87 25-29 22.185 28.975 27.915 20.925 30-34 22.515 27.839999999999996 28.194999999999997 21.45 35-39 22.465 28.720000000000002 27.465 21.349999999999998 40-44 22.465 28.444999999999997 28.035 21.055 45-49 22.7 28.185 28.055000000000003 21.060000000000002 50-54 23.285 28.33 27.425 20.96 55-59 23.265 27.400000000000002 27.485 21.85 60-64 22.405 28.155 27.994999999999997 21.445 65-69 22.725 27.825 28.525 20.925 70-74 23.185 27.82 27.655 21.34 75-79 22.81 28.03 27.6 21.560000000000002 80-84 23.66 27.805000000000003 28.015 20.52 85-89 23.835 27.87 27.505000000000003 20.79 90-94 23.51 28.255000000000003 27.22 21.015 95-99 23.064999999999998 28.34 28.360000000000003 20.235 100-104 23.465 28.225 27.439999999999998 20.87 105-109 23.135 28.59 27.700000000000003 20.575 110-114 22.39 28.689999999999998 28.205000000000002 20.715 115-119 23.75237523752375 28.337833783378336 27.137713771377136 20.77207720772077 120-124 23.885 27.655 27.74 20.72 125-129 23.31 27.810000000000002 27.779999999999998 21.099999999999998 130-134 23.18 28.025 28.275 20.52 135-139 23.825 27.884999999999998 28.09 20.200000000000003 140-144 23.581179058952948 28.651432571628582 27.2013600680034 20.56602830141507 145-149 24.529999999999998 27.97 27.01 20.49 150-151 23.4625 27.325 28.6875 20.525 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.5 9 0.5 10 0.5 11 0.5 12 0.0 13 0.5 14 1.5 15 1.0 16 0.5 17 0.5 18 1.0 19 1.5 20 1.0 21 0.5 22 1.5 23 3.5 24 2.5 25 2.5 26 5.0 27 9.0 28 13.0 29 16.0 30 23.0 31 23.0 32 30.0 33 41.5 34 50.5 35 74.5 36 85.0 37 94.0 38 133.5 39 164.5 40 192.0 41 223.0 42 229.0 43 256.5 44 279.5 45 264.0 46 265.5 47 265.5 48 222.0 49 207.5 50 174.0 51 124.0 52 121.5 53 94.5 54 74.0 55 64.0 56 43.0 57 31.5 58 21.5 59 18.0 60 15.5 61 7.5 62 7.0 63 6.0 64 2.0 65 0.5 66 1.0 67 0.5 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 1.0 84 1.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.5 97 0.5 98 0.0 99 1.0 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.01 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.005 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.5 #Duplication Level Percentage of deduplicated Percentage of total 1 92.48648648648648 85.55 2 6.918918918918919 12.8 3 0.5945945945945946 1.6500000000000001 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.1375 0.0 0.0 0.0 0.0 92-93 0.1875 0.0 0.0 0.0 0.0 94-95 0.2 0.0 0.0 0.0 0.0 96-97 0.2375 0.0 0.0 0.0 0.0 98-99 0.275 0.0 0.0 0.0 0.0 100-101 0.3625 0.0 0.0 0.0 0.0 102-103 0.45 0.0 0.0 0.0 0.0 104-105 0.5 0.0 0.0 0.0 0.0 106-107 0.5125 0.0 0.0 0.0 0.0 108-109 0.5375000000000001 0.0 0.0 0.0 0.0 110-111 0.725 0.0 0.0 0.0 0.0 112-113 0.85 0.0 0.0 0.0 0.0 114-115 0.9125 0.0 0.0 0.0 0.0 116-117 1.0 0.0 0.0 0.0 0.0 118-119 1.0625 0.0 0.0 0.0 0.0 120-121 1.125 0.0 0.0 0.0 0.0 122-123 1.2375 0.0 0.0 0.0 0.0 124-125 1.3125 0.0 0.0 0.0 0.0 126-127 1.5 0.0 0.0 0.0 0.0 128-129 1.5375 0.0 0.0 0.0 0.0 130-131 1.7374999999999998 0.0 0.0 0.0 0.0 132-133 1.875 0.0 0.0 0.0 0.0 134-135 2.0625 0.0 0.0 0.0 0.0 136-137 2.2750000000000004 0.0 0.0 0.0 0.0 138-139 2.525 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTCTTTC 10 0.006830828 145.0 6 GGGGGGG 40 0.0076550315 18.125 140-144 >>END_MODULE Read 1092884 spots for SRR12671038.sra Written 1092884 spots for SRR12671038.sra Read 1092884 spots for SRR12671038.sra Written 1092884 spots for SRR12671038.sra Read 1092884 spots for SRR12671038.sra Written 1092884 spots for SRR12671038.sra Read 1092884 spots for SRR12671038.sra Written 1092884 spots for SRR12671038.sra Read 1092884 spots for SRR12671038.sra Written 1092884 spots for SRR12671038.sra Read 1092884 spots for SRR12671038.sra Written 1092884 spots for SRR12671038.sra Read 1092884 spots for SRR12671038.sra Written 1092884 spots for SRR12671038.sra Read 1092884 spots for SRR12671038.sra Written 1092884 spots for SRR12671038.sra Read 1092884 spots for SRR12671038.sra Written 1092884 spots for SRR12671038.sra Read 1092884 spots for SRR12671038.sra Written 1092884 spots for SRR12671038.sra Read 1092884 spots for SRR12671038.sra Written 1092884 spots for SRR12671038.sra Read 1092884 spots for SRR12671038.sra Written 1092884 spots for SRR12671038.sra Read 1092884 spots for SRR12671038.sra Written 1092884 spots for SRR12671038.sra Read 1092884 spots for SRR12671038.sra Written 1092884 spots for SRR12671038.sra Read 1092884 spots for SRR12671038.sra Written 1092884 spots for SRR12671038.sra Read 1092903 spots for SRR12671038.sra Written 1092903 spots for SRR12671038.sra Read 1092884 spots for SRR12671038.sra Written 1092884 spots for SRR12671038.sra Read 1092884 spots for SRR12671038.sra Written 1092884 spots for SRR12671038.sra Read 1092884 spots for SRR12671038.sra Written 1092884 spots for SRR12671038.sra Read 1092884 spots for SRR12671038.sra Written 1092884 spots for SRR12671038.sra SRR ids: ['SRR12671038.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_j0qoc2z3 SRR12671038.sra spots: 21857699 blocks: [[1, 1092884], [1092885, 2185768], [2185769, 3278652], [3278653, 4371536], [4371537, 5464420], [5464421, 6557304], [6557305, 7650188], [7650189, 8743072], [8743073, 9835956], [9835957, 10928840], [10928841, 12021724], [12021725, 13114608], [13114609, 14207492], [14207493, 15300376], [15300377, 16393260], [16393261, 17486144], [17486145, 18579028], [18579029, 19671912], [19671913, 20764796], [20764797, 21857699]] SRR12671038 file size 7406502 SRR12671038 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671038 SRR12671038_1.fastq SRR12671038_2.fastq Input file: SRR12671038_1.fastq Paired file: SRR12671038_2.fastq trimmed: SRR12671038-trimmed-pair1.fastq, SRR12671038-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 15:00:02 2025 >> started Tue Feb 11 15:00:39 2025 >> done (36.861s) 21857699 read pairs processed; of these: 101 ( 0.00%) short read pairs filtered out after trimming by size control 2245 ( 0.01%) empty read pairs filtered out after trimming by size control 21855353 (99.99%) read pairs available; of these: 985867 ( 4.51%) trimmed read pairs available after processing 20869486 (95.49%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 11 0.00% 19 13 0.00% 20 19 0.00% 21 9 0.00% 22 10 0.00% 23 14 0.00% 24 19 0.00% 25 9 0.00% 26 14 0.00% 27 21 0.00% 28 21 0.00% 29 7 0.00% 30 18 0.00% 31 16 0.00% 32 18 0.00% 33 17 0.00% 34 23 0.00% 35 24 0.00% 36 22 0.00% 37 17 0.00% 38 22 0.00% 39 32 0.00% 40 25 0.00% 41 18 0.00% 42 13 0.00% 43 30 0.00% 44 27 0.00% 45 28 0.00% 46 17 0.00% 47 26 0.00% 48 28 0.00% 49 53 0.00% 50 51 0.00% 51 51 0.00% 52 52 0.00% 53 59 0.00% 54 60 0.00% 55 69 0.00% 56 70 0.00% 57 103 0.00% 58 108 0.00% 59 135 0.00% 60 155 0.00% 61 138 0.00% 62 191 0.00% 63 172 0.00% 64 218 0.00% 65 243 0.00% 66 284 0.00% 67 312 0.00% 68 385 0.00% 69 382 0.00% 70 418 0.00% 71 478 0.00% 72 586 0.00% 73 701 0.00% 74 731 0.00% 75 785 0.00% 76 990 0.00% 77 1030 0.00% 78 1073 0.00% 79 1163 0.01% 80 1410 0.01% 81 1590 0.01% 82 1725 0.01% 83 1961 0.01% 84 2132 0.01% 85 2349 0.01% 86 2465 0.01% 87 2672 0.01% 88 2886 0.01% 89 2920 0.01% 90 3414 0.02% 91 3668 0.02% 92 3794 0.02% 93 4093 0.02% 94 4438 0.02% 95 4721 0.02% 96 4948 0.02% 97 5157 0.02% 98 5498 0.03% 99 5663 0.03% 100 6186 0.03% 101 6246 0.03% 102 6743 0.03% 103 7075 0.03% 104 7654 0.04% 105 7728 0.04% 106 8264 0.04% 107 8792 0.04% 108 8902 0.04% 109 9265 0.04% 110 9382 0.04% 111 9837 0.05% 112 10513 0.05% 113 10843 0.05% 114 11209 0.05% 115 11623 0.05% 116 12399 0.06% 117 12931 0.06% 118 13086 0.06% 119 13369 0.06% 120 14075 0.06% 121 14527 0.07% 122 14951 0.07% 123 15582 0.07% 124 16574 0.08% 125 16679 0.08% 126 17706 0.08% 127 17854 0.08% 128 18467 0.08% 129 19097 0.09% 130 19725 0.09% 131 19941 0.09% 132 20908 0.10% 133 21211 0.10% 134 21725 0.10% 135 22667 0.10% 136 23108 0.11% 137 23650 0.11% 138 24276 0.11% 139 25379 0.12% 140 25871 0.12% 141 26730 0.12% 142 27642 0.13% 143 27741 0.13% 144 29103 0.13% 145 29503 0.13% 146 30366 0.14% 147 31225 0.14% 148 32170 0.15% 149 32411 0.15% 150 33618 0.15% 151 20869486 95.49% 21855353 reads passed initial QC criterion=sequence-density sequence-density=0.56 sequence-density-rank=1 fanout-score=1.97 fanout-score-rank=25 prefix-density=0.57 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTTCGAGCGAAGAAGGT criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=29.49 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=4.0 sequence=TCAAATATATCGGTGACATCTAAGTTCAATGGGTGGTTTTTGTACATAGCAACAGCACTCTATGAGAAATCATAACGATCAGAGACATTACAAGTTCTAGTGATGATACAAAGGTTGCATCGACAAATACAAATATTTCAAGCTCCTTCCTTGATTAGGCAAGCATGTTCACCAGTGTTCCTCACTTGGGGGTGAAAGCAGAAAAAACGGTGGCATGACCAGGATCTGCAAGGTGAGCAAAGAGGTTGTCGATAGGACCAGTGCCAGTGTAAATGTGTTGGAACCAAGCACCCATGACAGCCAACATAGCCAA criterion=sequence-density sequence-density=0.65 sequence-density-rank=1 fanout-score=2.18 fanout-score-rank=26 prefix-density=0.67 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=48.49 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=4.9 sequence=AAACAAGAGCGCGGTGGATAGGAGGAGAGCATAACCATGTTAGTCACATATATTTCCAAGATGAAGGCCTTTCTTATCGCATGCATTCTCTTAGCTACCATCGTCTTCTCTCCCCT SRR12671038 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 15:01:31 Started mapping on | Feb 11 15:01:31 Finished on | Feb 11 15:05:27 Mapping speed, Million of reads per hour | 333.39 Number of input reads | 21855353 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 20373348 Uniquely mapped reads % | 93.22% Average mapped length | 298.41 Number of splices: Total | 20630678 Number of splices: Annotated (sjdb) | 20185016 Number of splices: GT/AG | 20221051 Number of splices: GC/AG | 340884 Number of splices: AT/AC | 12907 Number of splices: Non-canonical | 55836 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.90 Insertion rate per base | 0.02% Insertion average length | 2.28 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 490676 % of reads mapped to multiple loci | 2.25% Number of reads mapped to too many loci | 52590 % of reads mapped to too many loci | 0.24% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.20% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 991329 991329 991329 N_multimapping 490676 490676 490676 N_noFeature 772087 20090570 863913 N_ambiguous 318679 1157 127112 UnstrandedReadsAssigned:19282582 PositiveStrandReadsAssigned:281621 NegativeStrandReadsAssigned:19382323 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671038 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671038-trimmed-pair1.fastq SRR12671038-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,855,353 reads, 19,336,378 reads pseudoaligned [quant] estimated average fragment length: 297.816 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,091 rounds 52401 SRR12671038.ke.tsv 34699 SRR12671038.se.tsv 87100 total ==> SRR12671038.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1721.18 627 17.0968 Potri.005G024800.1.v4.1 1035 738.184 215 13.6693 Potri.004G059700.1.v4.1 961 664.514 22 1.55379 Potri.007G009000.2.v4.1 1416 1119.18 0 0 Potri.003G141000.2.v4.1 2943 2646.18 1060 18.8001 Potri.016G087400.1.v4.1 270 70.8046 777.176 515.147 Potri.015G069301.1.v4.1 564 289.031 0 0 Potri.010G195200.1.v4.1 1773 1476.18 65 2.06655 Potri.012G127500.1.v4.1 977 680.403 121 8.34628 ==> SRR12671038.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 528 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 237 Potri.001G212900.v4.1 27 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 12 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 5 SRR12671038 completed mapping pipeline successfully