Starting /dee2/code/volunteer_pipeline.sh SRR12671039 current disk space = 3049881980928 free memory = 1465655512 SRR12671039 SRAfilesize 54cb59c8e807b2007264d7d8f2aaa9f4 SRR12671039.sra SRR12671039.sra file validated SRR12671039 is paired end SRR12671039 is conventional basespace SRR12671039 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671039_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.39 37.0 37.0 37.0 37.0 37.0 2 36.4895 37.0 37.0 37.0 37.0 37.0 3 36.4625 37.0 37.0 37.0 37.0 37.0 4 36.5835 37.0 37.0 37.0 37.0 37.0 5 36.6345 37.0 37.0 37.0 37.0 37.0 6 36.597 37.0 37.0 37.0 37.0 37.0 7 36.5645 37.0 37.0 37.0 37.0 37.0 8 36.5525 37.0 37.0 37.0 37.0 37.0 9 36.5875 37.0 37.0 37.0 37.0 37.0 10-14 36.6267 37.0 37.0 37.0 37.0 37.0 15-19 36.5908 37.0 37.0 37.0 37.0 37.0 20-24 36.567899999999995 37.0 37.0 37.0 37.0 37.0 25-29 36.5558 37.0 37.0 37.0 37.0 37.0 30-34 36.4705 37.0 37.0 37.0 37.0 37.0 35-39 36.4615 37.0 37.0 37.0 37.0 37.0 40-44 36.4379 37.0 37.0 37.0 37.0 37.0 45-49 36.13870000000001 37.0 37.0 37.0 37.0 37.0 50-54 36.2393 37.0 37.0 37.0 37.0 37.0 55-59 36.01090000000001 37.0 37.0 37.0 37.0 37.0 60-64 35.9597 37.0 37.0 37.0 37.0 37.0 65-69 35.924699999999994 37.0 37.0 37.0 37.0 37.0 70-74 36.1284 37.0 37.0 37.0 37.0 37.0 75-79 36.2914 37.0 37.0 37.0 37.0 37.0 80-84 36.2331 37.0 37.0 37.0 37.0 37.0 85-89 36.2101 37.0 37.0 37.0 37.0 37.0 90-94 36.256899999999995 37.0 37.0 37.0 37.0 37.0 95-99 36.1719 37.0 37.0 37.0 37.0 37.0 100-104 36.1919 37.0 37.0 37.0 37.0 37.0 105-109 36.1161 37.0 37.0 37.0 37.0 37.0 110-114 36.1039 37.0 37.0 37.0 37.0 37.0 115-119 36.039300000000004 37.0 37.0 37.0 37.0 37.0 120-124 36.0002 37.0 37.0 37.0 37.0 37.0 125-129 36.0689 37.0 37.0 37.0 37.0 37.0 130-134 35.8098 37.0 37.0 37.0 37.0 37.0 135-139 35.8625 37.0 37.0 37.0 37.0 37.0 140-144 35.81400000000001 37.0 37.0 37.0 37.0 37.0 145-149 35.6734 37.0 37.0 37.0 37.0 37.0 150-151 35.4765 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 1.0 21 1.0 22 2.0 23 1.0 24 3.0 25 2.0 26 7.0 27 5.0 28 13.0 29 19.0 30 40.0 31 49.0 32 49.0 33 101.0 34 157.0 35 297.0 36 2696.0 37 556.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.475 10.575 4.9 41.05 2 16.525000000000002 13.225000000000001 39.975 30.275000000000002 3 16.7 13.200000000000001 30.2 39.900000000000006 4 20.8 20.9 24.55 33.75 5 25.575 28.425 25.35 20.65 6 21.375 31.974999999999998 23.625 23.025000000000002 7 15.2 28.075 40.699999999999996 16.025 8 16.025 27.425 34.125 22.425 9 18.15 23.200000000000003 35.125 23.525 10-14 19.395 30.06 28.294999999999998 22.25 15-19 19.72 27.74 27.83 24.709999999999997 20-24 19.950000000000003 27.705000000000002 27.915 24.43 25-29 19.495 28.27 27.544999999999998 24.69 30-34 18.970000000000002 29.065 27.950000000000003 24.015 35-39 19.53 27.625 28.189999999999998 24.654999999999998 40-44 19.515 27.900000000000002 27.825 24.759999999999998 45-49 20.34 27.889999999999997 28.15 23.62 50-54 20.515 27.1 27.775 24.610000000000003 55-59 19.355 27.76 28.849999999999998 24.035 60-64 20.115 27.605 28.744999999999997 23.535 65-69 20.200000000000003 28.38 27.675 23.745 70-74 21.415 27.800000000000004 27.395000000000003 23.39 75-79 20.880000000000003 28.09 27.42 23.61 80-84 22.185 27.365000000000002 26.995 23.455000000000002 85-89 21.98 28.144999999999996 26.650000000000002 23.225 90-94 22.245 27.73 27.189999999999998 22.835 95-99 22.38 27.32 27.16 23.14 100-104 22.555 27.584999999999997 26.889999999999997 22.97 105-109 22.3 27.900000000000002 26.955000000000002 22.845 110-114 21.995 27.694999999999997 27.38 22.93 115-119 22.134999999999998 27.87 26.985 23.01 120-124 22.55 27.750000000000004 27.21 22.49 125-129 22.509999999999998 27.36 27.13 23.0 130-134 22.08 28.175 26.790000000000003 22.955000000000002 135-139 22.855 28.405 25.89 22.85 140-144 22.515 27.51 26.87 23.105 145-149 22.05 28.444999999999997 26.265 23.24 150-151 21.9375 27.6125 26.6625 23.7875 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 1.0 5 0.5 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.5 16 0.5 17 0.5 18 0.5 19 0.5 20 0.5 21 0.5 22 1.0 23 1.0 24 1.5 25 4.0 26 5.0 27 7.0 28 14.0 29 16.0 30 18.0 31 22.0 32 28.5 33 41.5 34 59.0 35 76.5 36 84.5 37 102.5 38 125.5 39 142.0 40 161.5 41 184.0 42 213.5 43 232.5 44 257.5 45 286.0 46 269.0 47 257.0 48 241.0 49 213.0 50 180.0 51 137.0 52 115.0 53 96.5 54 78.0 55 60.5 56 46.5 57 37.5 58 28.0 59 24.5 60 19.5 61 6.5 62 1.5 63 4.0 64 6.5 65 15.5 66 23.0 67 20.5 68 16.5 69 7.0 70 2.0 71 1.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.275 #Duplication Level Percentage of deduplicated Percentage of total 1 91.12293475217027 81.35 2 7.896947633716047 14.099999999999998 3 0.7560907308877065 2.025 4 0.08401008120974517 0.3 5 0.08401008120974517 0.375 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.05600672080649678 1.8499999999999999 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTCTCTTCCATCTCGTAT 48 1.2 TruSeq Adapter, Index 8 (97% over 36bp) GATCGGAAGAGCACACGTCTGAACTCCAGTCACTCTCTTCCATCGCGTAT 26 0.65 TruSeq Adapter, Index 8 (97% over 36bp) GATCGGAAGAGCACACGTCTGAACTCCAGTCACTCTCTTCCATCTCGTTT 5 0.125 TruSeq Adapter, Index 8 (97% over 36bp) GTTACCCTCTCTGGTGTAAAACTTCACTGCAAATCCACGTGGATCCCTCA 5 0.125 No Hit GTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.1875 0.0 0.0 0.0 0.0 84-85 0.3 0.0 0.0 0.0 0.0 86-87 0.3 0.0 0.0 0.0 0.0 88-89 0.3 0.0 0.0 0.0 0.0 90-91 0.3125 0.0 0.0 0.0 0.0 92-93 0.3375 0.0 0.0 0.0 0.0 94-95 0.35 0.0 0.0 0.0 0.0 96-97 0.4125 0.0 0.0 0.0 0.0 98-99 0.45 0.0 0.0 0.0 0.0 100-101 0.5875 0.0 0.0 0.0 0.0 102-103 0.675 0.0 0.0 0.0 0.0 104-105 0.725 0.0 0.0 0.0 0.0 106-107 0.8625 0.0 0.0 0.0 0.0 108-109 0.925 0.0 0.0 0.0 0.0 110-111 0.975 0.0 0.0 0.0 0.0 112-113 1.125 0.0 0.0 0.0 0.0 114-115 1.2 0.0 0.0 0.0 0.0 116-117 1.225 0.0 0.0 0.0 0.0 118-119 1.4874999999999998 0.0 0.0 0.0 0.0 120-121 1.6 0.0 0.0 0.0 0.0 122-123 1.7875 0.0 0.0 0.0 0.0 124-125 1.9249999999999998 0.0 0.0 0.0 0.0 126-127 2.1 0.0 0.0 0.0 0.0 128-129 2.2375 0.0 0.0 0.0 0.0 130-131 2.3625 0.0 0.0 0.0 0.0 132-133 2.6875 0.0 0.0 0.0 0.0 134-135 2.9625000000000004 0.0 0.0 0.0 0.0 136-137 3.425 0.0 0.0 0.0 0.0 138-139 3.7 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GATGAGA 10 0.006830828 145.0 5 >>END_MODULE SRR12671039 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671039_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.305 37.0 37.0 37.0 37.0 37.0 2 36.3795 37.0 37.0 37.0 37.0 37.0 3 36.28 37.0 37.0 37.0 37.0 37.0 4 36.3425 37.0 37.0 37.0 37.0 37.0 5 36.4155 37.0 37.0 37.0 37.0 37.0 6 36.425 37.0 37.0 37.0 37.0 37.0 7 36.411 37.0 37.0 37.0 37.0 37.0 8 36.3435 37.0 37.0 37.0 37.0 37.0 9 36.221 37.0 37.0 37.0 37.0 37.0 10-14 36.2253 37.0 37.0 37.0 37.0 37.0 15-19 36.17909999999999 37.0 37.0 37.0 37.0 37.0 20-24 36.118900000000004 37.0 37.0 37.0 37.0 37.0 25-29 35.9064 37.0 37.0 37.0 37.0 37.0 30-34 35.835699999999996 37.0 37.0 37.0 37.0 37.0 35-39 35.8115 37.0 37.0 37.0 37.0 37.0 40-44 35.7773 37.0 37.0 37.0 37.0 37.0 45-49 35.8035 37.0 37.0 37.0 37.0 37.0 50-54 35.779999999999994 37.0 37.0 37.0 37.0 37.0 55-59 35.8192 37.0 37.0 37.0 37.0 37.0 60-64 35.763099999999994 37.0 37.0 37.0 37.0 37.0 65-69 35.7188 37.0 37.0 37.0 37.0 37.0 70-74 35.7432 37.0 37.0 37.0 37.0 37.0 75-79 35.668 37.0 37.0 37.0 37.0 37.0 80-84 35.7004 37.0 37.0 37.0 37.0 37.0 85-89 35.7725 37.0 37.0 37.0 37.0 37.0 90-94 35.8867 37.0 37.0 37.0 37.0 37.0 95-99 35.924400000000006 37.0 37.0 37.0 37.0 37.0 100-104 35.9824 37.0 37.0 37.0 37.0 37.0 105-109 35.9578 37.0 37.0 37.0 37.0 37.0 110-114 35.9889 37.0 37.0 37.0 37.0 37.0 115-119 35.9587 37.0 37.0 37.0 37.0 37.0 120-124 35.874900000000004 37.0 37.0 37.0 37.0 37.0 125-129 35.8016 37.0 37.0 37.0 37.0 37.0 130-134 35.8413 37.0 37.0 37.0 37.0 37.0 135-139 35.823499999999996 37.0 37.0 37.0 37.0 37.0 140-144 35.793 37.0 37.0 37.0 37.0 37.0 145-149 35.636900000000004 37.0 37.0 37.0 37.0 37.0 150-151 35.347750000000005 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 2.0 15 3.0 16 5.0 17 4.0 18 5.0 19 5.0 20 4.0 21 8.0 22 7.0 23 14.0 24 23.0 25 15.0 26 12.0 27 10.0 28 22.0 29 22.0 30 22.0 31 34.0 32 43.0 33 74.0 34 137.0 35 350.0 36 2610.0 37 569.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.925 25.424999999999997 9.0 27.650000000000002 2 25.825 25.374999999999996 34.825 13.975000000000001 3 19.575 28.000000000000004 34.225 18.2 4 24.075 32.800000000000004 24.125 19.0 5 26.6 35.375 21.224999999999998 16.8 6 21.7 38.95 22.375 16.975 7 21.349999999999998 21.775 38.875 18.0 8 20.5 23.875 31.35 24.275 9 23.150000000000002 22.975 31.1 22.775000000000002 10-14 24.54 28.27 27.16 20.03 15-19 23.990000000000002 27.57 27.665 20.775 20-24 23.94 28.33 27.534999999999997 20.195 25-29 24.05 27.27 27.765 20.915 30-34 24.27 27.365000000000002 28.1 20.265 35-39 23.225 28.405 28.194999999999997 20.175 40-44 22.965 28.015 28.48 20.54 45-49 23.195 27.74 28.555000000000003 20.51 50-54 23.59 28.52 27.445000000000004 20.445 55-59 24.54 26.945000000000004 28.065 20.45 60-64 24.685000000000002 27.595 27.36 20.36 65-69 24.355 26.974999999999998 27.250000000000004 21.42 70-74 24.0 27.810000000000002 27.339999999999996 20.849999999999998 75-79 23.630000000000003 28.185 27.175 21.01 80-84 24.13 27.735 27.250000000000004 20.885 85-89 24.86 27.169999999999998 27.205000000000002 20.765 90-94 25.085 27.560000000000002 26.784999999999997 20.57 95-99 24.785 27.755000000000003 27.61 19.85 100-104 24.86 28.03 26.805 20.305 105-109 24.57 27.49 27.465 20.474999999999998 110-114 25.45 27.37 27.275 19.905 115-119 25.56 27.644999999999996 27.005000000000003 19.79 120-124 25.665 26.900000000000002 27.935 19.5 125-129 25.44 27.565 27.12 19.875 130-134 25.14 27.474999999999998 27.175 20.21 135-139 25.240000000000002 28.065 27.075 19.62 140-144 26.05 27.810000000000002 26.595000000000002 19.545 145-149 26.135 27.54 26.97 19.355 150-151 26.05 27.325 26.724999999999998 19.900000000000002 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.5 11 0.5 12 0.0 13 0.5 14 1.0 15 1.0 16 1.0 17 0.5 18 0.0 19 0.5 20 1.5 21 1.5 22 1.5 23 1.5 24 2.0 25 4.0 26 7.0 27 10.0 28 14.0 29 18.0 30 19.0 31 23.0 32 32.0 33 42.5 34 48.0 35 61.5 36 95.5 37 125.0 38 141.5 39 161.5 40 192.5 41 216.5 42 248.0 43 271.0 44 281.0 45 283.0 46 257.0 47 234.5 48 195.0 49 170.5 50 169.0 51 137.5 52 99.5 53 71.5 54 65.0 55 58.5 56 41.0 57 33.0 58 20.5 59 13.0 60 17.0 61 11.0 62 4.0 63 3.0 64 2.0 65 2.5 66 2.0 67 2.5 68 2.0 69 1.0 70 1.0 71 0.5 72 0.0 73 1.0 74 1.5 75 0.5 76 0.0 77 1.0 78 2.0 79 1.5 80 1.0 81 1.5 82 2.0 83 2.0 84 3.0 85 2.5 86 2.0 87 3.0 88 2.5 89 3.0 90 3.0 91 1.5 92 3.0 93 4.0 94 3.0 95 2.0 96 4.0 97 5.5 98 4.0 99 6.5 100 7.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 91.10251450676982 82.425 2 7.764575849682233 14.05 3 0.8842221608179055 2.4 4 0.11052777010223819 0.4 5 0.11052777010223819 0.5 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.027631942525559547 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 9 0.22499999999999998 No Hit AGAGAACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 5 0.125 No Hit AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 5 0.125 No Hit GTTTGGAACAACAACTCGTCTTTGACCGTTGGATCTAGAGGTCCAATCCT 5 0.125 No Hit GGAGAATTTTGGGTCGAAGAAGAGTAAGTTTGTTATGGCTCATGATTCAA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.1875 0.0 0.0 0.0 0.0 84-85 0.3 0.0 0.0 0.0 0.0 86-87 0.3 0.0 0.0 0.0 0.0 88-89 0.3 0.0 0.0 0.0 0.0 90-91 0.3125 0.0 0.0 0.0 0.0 92-93 0.3375 0.0 0.0 0.0 0.0 94-95 0.35 0.0 0.0 0.0 0.0 96-97 0.4125 0.0 0.0 0.0 0.0 98-99 0.45 0.0 0.0 0.0 0.0 100-101 0.5875 0.0 0.0 0.0 0.0 102-103 0.675 0.0 0.0 0.0 0.0 104-105 0.725 0.0 0.0 0.0 0.0 106-107 0.8625 0.0 0.0 0.0 0.0 108-109 0.925 0.0 0.0 0.0 0.0 110-111 0.975 0.0 0.0 0.0 0.0 112-113 1.125 0.0 0.0 0.0 0.0 114-115 1.2 0.0 0.0 0.0 0.0 116-117 1.225 0.0 0.0 0.0 0.0 118-119 1.4375 0.0 0.0 0.0 0.0 120-121 1.5499999999999998 0.0 0.0 0.0 0.0 122-123 1.7375 0.0 0.0 0.0 0.0 124-125 1.875 0.0 0.0 0.0 0.0 126-127 2.05 0.0 0.0 0.0 0.0 128-129 2.1875 0.0 0.0 0.0 0.0 130-131 2.3125 0.0 0.0 0.0 0.0 132-133 2.6375 0.0 0.0 0.0 0.0 134-135 2.9124999999999996 0.0 0.0 0.0 0.0 136-137 3.35 0.0 0.0 0.0 0.0 138-139 3.625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 599132 spots for SRR12671039.sra Written 599132 spots for SRR12671039.sra Read 599132 spots for SRR12671039.sra Written 599132 spots for SRR12671039.sra Read 599132 spots for SRR12671039.sra Written 599132 spots for SRR12671039.sra Read 599132 spots for SRR12671039.sra Written 599132 spots for SRR12671039.sra Read 599132 spots for SRR12671039.sra Written 599132 spots for SRR12671039.sra Read 599132 spots for SRR12671039.sra Written 599132 spots for SRR12671039.sra Read 599132 spots for SRR12671039.sra Written 599132 spots for SRR12671039.sra Read 599132 spots for SRR12671039.sra Written 599132 spots for SRR12671039.sra Read 599132 spots for SRR12671039.sra Written 599132 spots for SRR12671039.sra Read 599132 spots for SRR12671039.sra Written 599132 spots for SRR12671039.sra Read 599132 spots for SRR12671039.sra Written 599132 spots for SRR12671039.sra Read 599132 spots for SRR12671039.sra Written 599132 spots for SRR12671039.sra Read 599132 spots for SRR12671039.sra Written 599132 spots for SRR12671039.sra Read 599132 spots for SRR12671039.sra Written 599132 spots for SRR12671039.sra Read 599132 spots for SRR12671039.sra Written 599132 spots for SRR12671039.sra Read 599132 spots for SRR12671039.sra Written 599132 spots for SRR12671039.sra Read 599132 spots for SRR12671039.sra Written 599132 spots for SRR12671039.sra Read 599132 spots for SRR12671039.sra Written 599132 spots for SRR12671039.sra Read 599138 spots for SRR12671039.sra Written 599138 spots for SRR12671039.sra Read 599132 spots for SRR12671039.sra Written 599132 spots for SRR12671039.sra SRR ids: ['SRR12671039.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__etfzzgp SRR12671039.sra spots: 11982646 blocks: [[1, 599132], [599133, 1198264], [1198265, 1797396], [1797397, 2396528], [2396529, 2995660], [2995661, 3594792], [3594793, 4193924], [4193925, 4793056], [4793057, 5392188], [5392189, 5991320], [5991321, 6590452], [6590453, 7189584], [7189585, 7788716], [7788717, 8387848], [8387849, 8986980], [8986981, 9586112], [9586113, 10185244], [10185245, 10784376], [10784377, 11383508], [11383509, 11982646]] SRR12671039 file size 4050526 SRR12671039 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671039 SRR12671039_1.fastq SRR12671039_2.fastq Input file: SRR12671039_1.fastq Paired file: SRR12671039_2.fastq trimmed: SRR12671039-trimmed-pair1.fastq, SRR12671039-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 14:59:20 2025 >> started Tue Feb 11 14:59:34 2025 >> done (13.541s) 11982646 read pairs processed; of these: 66 ( 0.00%) short read pairs filtered out after trimming by size control 184359 ( 1.54%) empty read pairs filtered out after trimming by size control 11798221 (98.46%) read pairs available; of these: 688873 ( 5.84%) trimmed read pairs available after processing 11109348 (94.16%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 5 0.00% 20 5 0.00% 21 2 0.00% 22 9 0.00% 23 11 0.00% 24 3 0.00% 25 5 0.00% 26 7 0.00% 27 13 0.00% 28 18 0.00% 29 10 0.00% 30 10 0.00% 31 13 0.00% 32 14 0.00% 33 16 0.00% 34 11 0.00% 35 16 0.00% 36 20 0.00% 37 14 0.00% 38 21 0.00% 39 16 0.00% 40 20 0.00% 41 21 0.00% 42 17 0.00% 43 25 0.00% 44 21 0.00% 45 19 0.00% 46 22 0.00% 47 23 0.00% 48 22 0.00% 49 33 0.00% 50 36 0.00% 51 41 0.00% 52 55 0.00% 53 39 0.00% 54 44 0.00% 55 71 0.00% 56 49 0.00% 57 64 0.00% 58 80 0.00% 59 108 0.00% 60 109 0.00% 61 116 0.00% 62 144 0.00% 63 153 0.00% 64 181 0.00% 65 170 0.00% 66 171 0.00% 67 268 0.00% 68 249 0.00% 69 335 0.00% 70 337 0.00% 71 373 0.00% 72 429 0.00% 73 495 0.00% 74 531 0.00% 75 638 0.01% 76 690 0.01% 77 783 0.01% 78 794 0.01% 79 948 0.01% 80 1008 0.01% 81 1182 0.01% 82 1313 0.01% 83 1428 0.01% 84 1521 0.01% 85 1755 0.01% 86 1758 0.01% 87 1997 0.02% 88 2170 0.02% 89 2284 0.02% 90 2467 0.02% 91 2647 0.02% 92 2763 0.02% 93 2952 0.03% 94 3299 0.03% 95 3519 0.03% 96 3736 0.03% 97 3967 0.03% 98 4118 0.03% 99 4253 0.04% 100 4500 0.04% 101 4692 0.04% 102 4955 0.04% 103 5224 0.04% 104 5597 0.05% 105 5657 0.05% 106 5915 0.05% 107 6221 0.05% 108 6305 0.05% 109 6735 0.06% 110 6914 0.06% 111 7135 0.06% 112 7473 0.06% 113 7711 0.07% 114 7888 0.07% 115 8554 0.07% 116 8897 0.08% 117 9072 0.08% 118 9383 0.08% 119 9695 0.08% 120 10167 0.09% 121 10450 0.09% 122 10778 0.09% 123 11072 0.09% 124 11550 0.10% 125 11566 0.10% 126 12308 0.10% 127 12539 0.11% 128 13006 0.11% 129 13153 0.11% 130 13534 0.11% 131 14204 0.12% 132 14362 0.12% 133 14614 0.12% 134 15039 0.13% 135 15518 0.13% 136 15976 0.14% 137 16356 0.14% 138 16828 0.14% 139 17573 0.15% 140 17451 0.15% 141 18324 0.16% 142 18922 0.16% 143 18912 0.16% 144 19421 0.16% 145 19882 0.17% 146 20394 0.17% 147 20772 0.18% 148 21810 0.18% 149 21865 0.19% 150 22901 0.19% 151 11109348 94.16% 11798221 reads passed initial QC criterion=sequence-density sequence-density=0.51 sequence-density-rank=1 fanout-score=1.95 fanout-score-rank=30 prefix-density=0.52 prefix-fanout=1.9 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTTCGAGCGAAGAAGGTAATCAATTTCCTTGGCCAATTCCTCCTCTGTGAGATCTGGAAGGTAAGAAAGAGTCTCGAACTTCTTCAATCCAGTTGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=14.64 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=2.2 sequence=GACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGG criterion=sequence-density sequence-density=0.86 sequence-density-rank=1 fanout-score=2.18 fanout-score-rank=28 prefix-density=0.87 prefix-fanout=2.1 sequence=CCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTG criterion=fanout-score sequence-density=0.09 sequence-density-rank=31 fanout-score=70.83 fanout-score-rank=1 prefix-density=0.70 prefix-fanout=9.3 sequence=AAAAGAAAAGAAAA SRR12671039 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 15:00:17 Started mapping on | Feb 11 15:00:17 Finished on | Feb 11 15:01:41 Mapping speed, Million of reads per hour | 505.64 Number of input reads | 11798221 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 11076015 Uniquely mapped reads % | 93.88% Average mapped length | 297.83 Number of splices: Total | 11474203 Number of splices: Annotated (sjdb) | 11242356 Number of splices: GT/AG | 11243934 Number of splices: GC/AG | 189470 Number of splices: AT/AC | 6678 Number of splices: Non-canonical | 34121 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.82 Insertion rate per base | 0.02% Insertion average length | 2.39 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 265756 % of reads mapped to multiple loci | 2.25% Number of reads mapped to too many loci | 46452 % of reads mapped to too many loci | 0.39% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.34% % of reads unmapped: other | 0.14% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 456450 456450 456450 N_multimapping 265756 265756 265756 N_noFeature 430162 10914471 474104 N_ambiguous 191685 690 73708 UnstrandedReadsAssigned:10454168 PositiveStrandReadsAssigned:160854 NegativeStrandReadsAssigned:10528203 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671039 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671039-trimmed-pair1.fastq SRR12671039-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,798,221 reads, 10,476,931 reads pseudoaligned [quant] estimated average fragment length: 283.177 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,060 rounds 52401 SRR12671039.ke.tsv 34699 SRR12671039.se.tsv 87100 total ==> SRR12671039.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1735.82 433 20.29 Potri.005G024800.1.v4.1 1035 752.823 224 24.2022 Potri.004G059700.1.v4.1 961 679.105 8 0.958191 Potri.007G009000.2.v4.1 1416 1133.82 0 0 Potri.003G141000.2.v4.1 2943 2660.82 668 20.4202 Potri.016G087400.1.v4.1 270 74.0855 484 531.388 Potri.015G069301.1.v4.1 564 299.247 0 0 Potri.010G195200.1.v4.1 1773 1490.82 103 5.61967 Potri.012G127500.1.v4.1 977 694.957 152 17.7904 ==> SRR12671039.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 130 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 180 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 18 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR12671039 completed mapping pipeline successfully