Starting /dee2/code/volunteer_pipeline.sh SRR12671326 current disk space = 3049431818240 free memory = 1506534588 SRR12671326 SRAfilesize b462538cbe20628b27fd101c22480af3 SRR12671326.sra SRR12671326.sra file validated SRR12671326 is paired end SRR12671326 is conventional basespace SRR12671326 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671326_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.605 37.0 37.0 37.0 37.0 37.0 2 36.4145 37.0 37.0 37.0 37.0 37.0 3 36.656 37.0 37.0 37.0 37.0 37.0 4 36.675 37.0 37.0 37.0 37.0 37.0 5 36.625 37.0 37.0 37.0 37.0 37.0 6 36.5295 37.0 37.0 37.0 37.0 37.0 7 36.5335 37.0 37.0 37.0 37.0 37.0 8 36.6495 37.0 37.0 37.0 37.0 37.0 9 36.606 37.0 37.0 37.0 37.0 37.0 10-14 36.6563 37.0 37.0 37.0 37.0 37.0 15-19 36.6389 37.0 37.0 37.0 37.0 37.0 20-24 36.6144 37.0 37.0 37.0 37.0 37.0 25-29 36.6073 37.0 37.0 37.0 37.0 37.0 30-34 36.568400000000004 37.0 37.0 37.0 37.0 37.0 35-39 36.5014 37.0 37.0 37.0 37.0 37.0 40-44 36.5253 37.0 37.0 37.0 37.0 37.0 45-49 36.505100000000006 37.0 37.0 37.0 37.0 37.0 50-54 36.50320000000001 37.0 37.0 37.0 37.0 37.0 55-59 36.492900000000006 37.0 37.0 37.0 37.0 37.0 60-64 36.517399999999995 37.0 37.0 37.0 37.0 37.0 65-69 36.46 37.0 37.0 37.0 37.0 37.0 70-74 36.437200000000004 37.0 37.0 37.0 37.0 37.0 75-79 36.409800000000004 37.0 37.0 37.0 37.0 37.0 80-84 36.3904 37.0 37.0 37.0 37.0 37.0 85-89 36.3429 37.0 37.0 37.0 37.0 37.0 90-94 36.370999999999995 37.0 37.0 37.0 37.0 37.0 95-99 36.3211 37.0 37.0 37.0 37.0 37.0 100-104 36.2826 37.0 37.0 37.0 37.0 37.0 105-109 36.295 37.0 37.0 37.0 37.0 37.0 110-114 36.2318 37.0 37.0 37.0 37.0 37.0 115-119 36.2112 37.0 37.0 37.0 37.0 37.0 120-124 36.198 37.0 37.0 37.0 37.0 37.0 125-129 36.19160000000001 37.0 37.0 37.0 37.0 37.0 130-134 36.1365 37.0 37.0 37.0 37.0 37.0 135-139 36.1404 37.0 37.0 37.0 37.0 37.0 140-144 35.9854 37.0 37.0 37.0 37.0 37.0 145-149 36.0265 37.0 37.0 37.0 37.0 37.0 150-151 35.920249999999996 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 3.0 23 0.0 24 0.0 25 4.0 26 4.0 27 1.0 28 7.0 29 16.0 30 14.0 31 27.0 32 45.0 33 48.0 34 100.0 35 264.0 36 2992.0 37 475.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.675000000000004 11.575000000000001 5.45 39.300000000000004 2 20.07024586051179 11.314601103863522 36.026091319618665 32.58906171600602 3 18.75 17.525 26.3 37.425000000000004 4 23.25 25.45 23.025000000000002 28.275 5 24.55 31.574999999999996 23.150000000000002 20.724999999999998 6 19.775000000000002 33.800000000000004 23.95 22.475 7 16.1 25.224999999999998 42.575 16.1 8 16.175 25.2 32.625 26.0 9 17.2 23.775 34.150000000000006 24.875 10-14 19.13 30.675 27.415 22.78 15-19 19.509999999999998 28.449999999999996 28.225 23.815 20-24 19.425 28.4 27.96 24.215 25-29 19.39 28.749999999999996 27.55 24.310000000000002 30-34 20.14 29.085 26.985 23.79 35-39 19.925 28.285 27.860000000000003 23.93 40-44 20.875 28.7 27.250000000000004 23.175 45-49 20.145 28.435 28.075 23.345 50-54 20.13 28.189999999999998 27.439999999999998 24.240000000000002 55-59 19.715 29.154999999999998 27.77 23.36 60-64 20.085 28.965000000000003 26.99 23.96 65-69 20.265 28.13 28.325 23.28 70-74 20.294999999999998 28.810000000000002 27.389999999999997 23.505000000000003 75-79 19.975 27.865000000000002 27.88 24.279999999999998 80-84 19.98 28.42 27.305 24.295 85-89 20.14 28.67 27.43 23.76 90-94 20.91 28.67 27.505000000000003 22.915 95-99 19.82 28.134999999999998 27.644999999999996 24.4 100-104 20.125 28.28 27.57 24.025 105-109 20.165 28.38 27.51 23.945 110-114 20.645 27.589999999999996 27.705000000000002 24.060000000000002 115-119 20.06 28.225 27.779999999999998 23.935000000000002 120-124 20.28 27.985 27.615000000000002 24.12 125-129 20.765 28.044999999999998 27.41 23.78 130-134 20.315 27.91 27.544999999999998 24.23 135-139 20.865000000000002 28.050000000000004 26.955000000000002 24.13 140-144 20.995 27.445000000000004 27.750000000000004 23.810000000000002 145-149 20.674999999999997 29.07 27.065 23.189999999999998 150-151 21.425 27.800000000000004 26.150000000000002 24.625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.5 19 1.0 20 1.5 21 3.5 22 3.5 23 2.0 24 1.5 25 1.5 26 3.5 27 7.0 28 8.0 29 12.0 30 18.0 31 26.0 32 34.5 33 38.0 34 52.0 35 67.0 36 80.0 37 106.5 38 141.5 39 183.5 40 206.5 41 219.5 42 244.0 43 246.5 44 243.5 45 264.0 46 257.5 47 218.5 48 213.0 49 201.0 50 166.5 51 149.0 52 133.0 53 103.5 54 79.0 55 64.0 56 46.0 57 34.5 58 29.5 59 26.0 60 17.5 61 8.0 62 7.0 63 10.0 64 9.0 65 5.5 66 2.0 67 1.0 68 0.5 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.35000000000000003 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 85.0 #Duplication Level Percentage of deduplicated Percentage of total 1 85.97058823529412 73.075 2 11.382352941176471 19.35 3 1.9411764705882355 4.95 4 0.5294117647058824 1.7999999999999998 5 0.1176470588235294 0.5 6 0.02941176470588235 0.15 7 0.02941176470588235 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTGCGGCCCAGGGCCCTGGTACATGTTGAGGGAGAGGGTGAGGTTGGTGT 7 0.17500000000000002 No Hit ATCGGGGCATGCAAACTCCTTCTCACCATCAGGAGTGATGAGCTTCACCG 6 0.15 No Hit GGCATGACGAGACACGAAGCAGAAATATGTCAAACTTGCATGAGCATTGG 5 0.125 No Hit CCGGTCACGAGAAAAGAAAACATTCAACACAGTTTAAACAGAAGAAAATA 5 0.125 No Hit ACTGATTTTGTAAAATGTCTAAGCATATACTTCCATCTGCATAAATATTT 5 0.125 No Hit GTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.23750000000000002 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.30000000000000004 0.0 0.0 0.0 0.0 92-93 0.325 0.0 0.0 0.0 0.0 94-95 0.3375 0.0 0.0 0.0 0.0 96-97 0.3625 0.0 0.0 0.0 0.0 98-99 0.55 0.0 0.0 0.0 0.0 100-101 0.6375 0.0 0.0 0.0 0.0 102-103 0.7124999999999999 0.0 0.0 0.0 0.0 104-105 0.7625 0.0 0.0 0.0 0.0 106-107 0.8374999999999999 0.0 0.0 0.0 0.0 108-109 1.0 0.0 0.0 0.0 0.0 110-111 1.025 0.0 0.0 0.0 0.0 112-113 1.075 0.0 0.0 0.0 0.0 114-115 1.1124999999999998 0.0 0.0 0.0 0.0 116-117 1.2375 0.0 0.0 0.0 0.0 118-119 1.35 0.0 0.0 0.0 0.0 120-121 1.4625 0.0 0.0 0.0 0.0 122-123 1.5625 0.0 0.0 0.0 0.0 124-125 1.725 0.0 0.0 0.0 0.0 126-127 1.9875 0.0 0.0 0.0 0.0 128-129 2.175 0.0 0.0 0.0 0.0 130-131 2.3625 0.0 0.0 0.0 0.0 132-133 2.5875 0.0 0.0 0.0 0.0 134-135 2.775 0.0 0.0 0.0 0.0 136-137 3.025 0.0 0.0 0.0 0.0 138-139 3.325 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12671326 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671326_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3 37.0 37.0 37.0 37.0 37.0 2 36.217 37.0 37.0 37.0 37.0 37.0 3 36.336 37.0 37.0 37.0 37.0 37.0 4 36.418 37.0 37.0 37.0 37.0 37.0 5 36.3655 37.0 37.0 37.0 37.0 37.0 6 36.4255 37.0 37.0 37.0 37.0 37.0 7 36.231 37.0 37.0 37.0 37.0 37.0 8 36.33 37.0 37.0 37.0 37.0 37.0 9 36.4095 37.0 37.0 37.0 37.0 37.0 10-14 36.3798 37.0 37.0 37.0 37.0 37.0 15-19 36.3772 37.0 37.0 37.0 37.0 37.0 20-24 36.32710000000001 37.0 37.0 37.0 37.0 37.0 25-29 36.30159999999999 37.0 37.0 37.0 37.0 37.0 30-34 36.2827 37.0 37.0 37.0 37.0 37.0 35-39 36.2379 37.0 37.0 37.0 37.0 37.0 40-44 36.2446 37.0 37.0 37.0 37.0 37.0 45-49 36.1744 37.0 37.0 37.0 37.0 37.0 50-54 36.156 37.0 37.0 37.0 37.0 37.0 55-59 36.1116 37.0 37.0 37.0 37.0 37.0 60-64 36.1235 37.0 37.0 37.0 37.0 37.0 65-69 36.0883 37.0 37.0 37.0 37.0 37.0 70-74 36.086200000000005 37.0 37.0 37.0 37.0 37.0 75-79 36.10940000000001 37.0 37.0 37.0 37.0 37.0 80-84 36.0518 37.0 37.0 37.0 37.0 37.0 85-89 36.04780000000001 37.0 37.0 37.0 37.0 37.0 90-94 36.0226 37.0 37.0 37.0 37.0 37.0 95-99 36.0237 37.0 37.0 37.0 37.0 37.0 100-104 35.966899999999995 37.0 37.0 37.0 37.0 37.0 105-109 35.9379 37.0 37.0 37.0 37.0 37.0 110-114 35.8959 37.0 37.0 37.0 37.0 37.0 115-119 35.9354 37.0 37.0 37.0 37.0 37.0 120-124 35.843300000000006 37.0 37.0 37.0 37.0 37.0 125-129 35.8583 37.0 37.0 37.0 37.0 37.0 130-134 35.790499999999994 37.0 37.0 37.0 37.0 37.0 135-139 35.6764 37.0 37.0 37.0 37.0 37.0 140-144 35.7405 37.0 37.0 37.0 37.0 37.0 145-149 35.663700000000006 37.0 37.0 37.0 37.0 37.0 150-151 35.39125 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 2.0 14 3.0 15 1.0 16 1.0 17 2.0 18 0.0 19 0.0 20 2.0 21 4.0 22 3.0 23 6.0 24 1.0 25 6.0 26 6.0 27 13.0 28 8.0 29 14.0 30 18.0 31 21.0 32 48.0 33 84.0 34 167.0 35 476.0 36 2806.0 37 307.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.55 22.375 9.425 25.650000000000002 2 23.549999999999997 26.650000000000002 33.975 15.825 3 20.849999999999998 27.474999999999998 33.2 18.475 4 24.775 34.925 21.925 18.375 5 24.675 37.875 21.475 15.975 6 18.65 39.75 23.175 18.425 7 21.45 22.0 37.125 19.425 8 19.900000000000002 25.525 28.875 25.7 9 21.875 24.75 29.875 23.5 10-14 22.86 29.494999999999997 26.6 21.044999999999998 15-19 22.865 27.91 27.955000000000002 21.27 20-24 22.400000000000002 28.810000000000002 27.845 20.945 25-29 22.86 28.189999999999998 27.33 21.62 30-34 23.41 27.875 27.415 21.3 35-39 23.215 27.775 28.110000000000003 20.9 40-44 23.115 27.58 28.33 20.974999999999998 45-49 23.32 27.3 28.155 21.224999999999998 50-54 22.785 27.93 28.115000000000002 21.17 55-59 23.52 27.375 27.439999999999998 21.665 60-64 22.96 28.075 27.99 20.974999999999998 65-69 23.015 27.62 28.139999999999997 21.224999999999998 70-74 23.16 27.79 28.01 21.04 75-79 24.279999999999998 27.779999999999998 27.615000000000002 20.325 80-84 23.080000000000002 27.54 27.894999999999996 21.485000000000003 85-89 23.01 28.02 27.415 21.555 90-94 23.575 28.015 27.145000000000003 21.265 95-99 23.080000000000002 28.975 27.275 20.669999999999998 100-104 23.275000000000002 27.755000000000003 27.634999999999998 21.335 105-109 23.29 27.73 28.025 20.955 110-114 23.22 28.345 27.565 20.87 115-119 23.775 28.325 27.250000000000004 20.65 120-124 23.465 28.470000000000002 27.87 20.195 125-129 23.54 27.815 28.28 20.365 130-134 24.46 26.695 28.305000000000003 20.54 135-139 24.38 28.155 27.525 19.939999999999998 140-144 23.849999999999998 28.38 27.58 20.19 145-149 25.12251225122512 27.607760776077605 26.997699769976997 20.27202720272027 150-151 25.424999999999997 28.262500000000003 26.237500000000004 20.075000000000003 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.5 12 1.0 13 1.0 14 1.0 15 0.5 16 0.0 17 0.5 18 1.5 19 2.0 20 1.5 21 1.0 22 0.5 23 0.5 24 3.0 25 3.5 26 4.0 27 9.5 28 13.5 29 16.0 30 19.5 31 26.5 32 31.0 33 41.0 34 57.0 35 69.0 36 85.5 37 93.5 38 115.5 39 153.5 40 176.0 41 196.5 42 227.5 43 262.0 44 294.5 45 292.0 46 262.0 47 245.5 48 226.5 49 203.0 50 171.5 51 140.0 52 126.0 53 99.0 54 76.5 55 61.0 56 39.0 57 31.5 58 26.0 59 25.5 60 22.0 61 13.5 62 8.0 63 4.5 64 2.5 65 0.0 66 1.5 67 2.0 68 0.5 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.5 77 0.5 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 1.0 84 1.0 85 0.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.5 94 0.5 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.01 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 84.875 #Duplication Level Percentage of deduplicated Percentage of total 1 85.97938144329898 72.975 2 11.22238586156112 19.05 3 2.091310751104565 5.325 4 0.5301914580265096 1.7999999999999998 5 0.08836524300441827 0.375 6 0.05891016200294551 0.3 7 0.029455081001472753 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGAAGGACCCCGACTATGATCGAAGCTATGACAGGTATATGCAAAGATTT 7 0.17500000000000002 No Hit AGAGAACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 6 0.15 No Hit GAGAGAGAGAGACAGAGAGAATGGCCACCACAGCAGCCCTCTCCAGCGCC 6 0.15 No Hit CATGCCAAGCGTGTCACTATCATGCCCAAGGATATCCAGCTGGCTAGGAG 5 0.125 No Hit AAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATG 5 0.125 No Hit AAAGAAAAGGCAAGCCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.23750000000000002 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.30000000000000004 0.0 0.0 0.0 0.0 92-93 0.325 0.0 0.0 0.0 0.0 94-95 0.3375 0.0 0.0 0.0 0.0 96-97 0.3625 0.0 0.0 0.0 0.0 98-99 0.55 0.0 0.0 0.0 0.0 100-101 0.6375 0.0 0.0 0.0 0.0 102-103 0.7124999999999999 0.0 0.0 0.0 0.0 104-105 0.7625 0.0 0.0 0.0 0.0 106-107 0.8374999999999999 0.0 0.0 0.0 0.0 108-109 1.0 0.0 0.0 0.0 0.0 110-111 1.025 0.0 0.0 0.0 0.0 112-113 1.075 0.0 0.0 0.0 0.0 114-115 1.1124999999999998 0.0 0.0 0.0 0.0 116-117 1.2375 0.0 0.0 0.0 0.0 118-119 1.35 0.0 0.0 0.0 0.0 120-121 1.4625 0.0 0.0 0.0 0.0 122-123 1.5625 0.0 0.0 0.0 0.0 124-125 1.725 0.0 0.0 0.0 0.0 126-127 1.9875 0.0 0.0 0.0 0.0 128-129 2.175 0.0 0.0 0.0 0.0 130-131 2.3625 0.0 0.0 0.0 0.0 132-133 2.5875 0.0 0.0 0.0 0.0 134-135 2.775 0.0 0.0 0.0 0.0 136-137 3.025 0.0 0.0 0.0 0.0 138-139 3.325 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACTTGTA 10 0.006830828 145.0 145 CGTAAGT 10 0.006830828 145.0 9 TCGTAAG 10 0.006830828 145.0 8 >>END_MODULE Read 1216891 spots for SRR12671326.sra Written 1216891 spots for SRR12671326.sra Read 1216880 spots for SRR12671326.sra Written 1216880 spots for SRR12671326.sra Read 1216880 spots for SRR12671326.sra Written 1216880 spots for SRR12671326.sra Read 1216880 spots for SRR12671326.sra Written 1216880 spots for SRR12671326.sra Read 1216880 spots for SRR12671326.sra Written 1216880 spots for SRR12671326.sra Read 1216880 spots for SRR12671326.sra Written 1216880 spots for SRR12671326.sra Read 1216880 spots for SRR12671326.sra Written 1216880 spots for SRR12671326.sra Read 1216880 spots for SRR12671326.sra Written 1216880 spots for SRR12671326.sra Read 1216880 spots for SRR12671326.sra Written 1216880 spots for SRR12671326.sra Read 1216880 spots for SRR12671326.sra Written 1216880 spots for SRR12671326.sra Read 1216880 spots for SRR12671326.sra Written 1216880 spots for SRR12671326.sra Read 1216880 spots for SRR12671326.sra Written 1216880 spots for SRR12671326.sra Read 1216880 spots for SRR12671326.sra Written 1216880 spots for SRR12671326.sra Read 1216880 spots for SRR12671326.sra Written 1216880 spots for SRR12671326.sra Read 1216880 spots for SRR12671326.sra Written 1216880 spots for SRR12671326.sra Read 1216880 spots for SRR12671326.sra Written 1216880 spots for SRR12671326.sra Read 1216880 spots for SRR12671326.sra Written 1216880 spots for SRR12671326.sra Read 1216880 spots for SRR12671326.sra Written 1216880 spots for SRR12671326.sra Read 1216880 spots for SRR12671326.sra Written 1216880 spots for SRR12671326.sra Read 1216880 spots for SRR12671326.sra Written 1216880 spots for SRR12671326.sra SRR ids: ['SRR12671326.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_hskjp7lo SRR12671326.sra spots: 24337611 blocks: [[1, 1216880], [1216881, 2433760], [2433761, 3650640], [3650641, 4867520], [4867521, 6084400], [6084401, 7301280], [7301281, 8518160], [8518161, 9735040], [9735041, 10951920], [10951921, 12168800], [12168801, 13385680], [13385681, 14602560], [14602561, 15819440], [15819441, 17036320], [17036321, 18253200], [18253201, 19470080], [19470081, 20686960], [20686961, 21903840], [21903841, 23120720], [23120721, 24337611]] SRR12671326 file size 8249284 SRR12671326 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671326 SRR12671326_1.fastq SRR12671326_2.fastq Input file: SRR12671326_1.fastq Paired file: SRR12671326_2.fastq trimmed: SRR12671326-trimmed-pair1.fastq, SRR12671326-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 15:42:36 2025 >> started Tue Feb 11 15:43:08 2025 >> done (31.495s) 24337611 read pairs processed; of these: 82 ( 0.00%) short read pairs filtered out after trimming by size control 4503 ( 0.02%) empty read pairs filtered out after trimming by size control 24333026 (99.98%) read pairs available; of these: 1096104 ( 4.50%) trimmed read pairs available after processing 23236922 (95.50%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 12 0.00% 20 8 0.00% 21 6 0.00% 22 7 0.00% 23 12 0.00% 24 11 0.00% 25 10 0.00% 26 8 0.00% 27 8 0.00% 28 7 0.00% 29 16 0.00% 30 16 0.00% 31 17 0.00% 32 21 0.00% 33 13 0.00% 34 18 0.00% 35 29 0.00% 36 23 0.00% 37 23 0.00% 38 25 0.00% 39 24 0.00% 40 31 0.00% 41 22 0.00% 42 26 0.00% 43 36 0.00% 44 31 0.00% 45 44 0.00% 46 34 0.00% 47 51 0.00% 48 60 0.00% 49 78 0.00% 50 84 0.00% 51 87 0.00% 52 97 0.00% 53 104 0.00% 54 130 0.00% 55 115 0.00% 56 151 0.00% 57 175 0.00% 58 207 0.00% 59 220 0.00% 60 288 0.00% 61 311 0.00% 62 368 0.00% 63 402 0.00% 64 439 0.00% 65 479 0.00% 66 587 0.00% 67 632 0.00% 68 736 0.00% 69 860 0.00% 70 979 0.00% 71 1079 0.00% 72 1199 0.00% 73 1354 0.01% 74 1506 0.01% 75 1682 0.01% 76 1863 0.01% 77 2136 0.01% 78 2164 0.01% 79 2458 0.01% 80 2647 0.01% 81 2938 0.01% 82 3121 0.01% 83 3532 0.01% 84 3774 0.02% 85 4101 0.02% 86 4305 0.02% 87 4678 0.02% 88 4842 0.02% 89 5017 0.02% 90 5359 0.02% 91 5741 0.02% 92 5857 0.02% 93 6331 0.03% 94 6798 0.03% 95 7023 0.03% 96 7603 0.03% 97 7879 0.03% 98 8129 0.03% 99 8436 0.03% 100 8691 0.04% 101 8737 0.04% 102 9286 0.04% 103 9655 0.04% 104 9770 0.04% 105 10227 0.04% 106 11218 0.05% 107 11411 0.05% 108 11378 0.05% 109 11891 0.05% 110 11995 0.05% 111 12508 0.05% 112 12914 0.05% 113 12839 0.05% 114 13593 0.06% 115 14402 0.06% 116 14485 0.06% 117 15022 0.06% 118 15695 0.06% 119 15899 0.07% 120 16475 0.07% 121 16608 0.07% 122 16691 0.07% 123 17594 0.07% 124 17702 0.07% 125 17989 0.07% 126 18977 0.08% 127 19443 0.08% 128 19621 0.08% 129 20325 0.08% 130 20801 0.09% 131 20961 0.09% 132 21392 0.09% 133 21892 0.09% 134 22255 0.09% 135 23137 0.10% 136 23085 0.09% 137 24099 0.10% 138 24866 0.10% 139 25596 0.11% 140 25526 0.10% 141 26319 0.11% 142 26789 0.11% 143 26730 0.11% 144 27962 0.11% 145 28113 0.12% 146 28880 0.12% 147 29397 0.12% 148 30964 0.13% 149 30547 0.13% 150 32017 0.13% 151 23236922 95.50% 24333026 reads passed initial QC criterion=sequence-density sequence-density=0.46 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=23 prefix-density=0.46 prefix-fanout=2.0 sequence=GTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGG criterion=fanout-score sequence-density=0.11 sequence-density-rank=19 fanout-score=11.80 fanout-score-rank=1 prefix-density=0.21 prefix-fanout=5.9 sequence=AGCTCTCCATACTTTTAAGCA criterion=sequence-density sequence-density=0.89 sequence-density-rank=1 fanout-score=2.09 fanout-score-rank=32 prefix-density=0.90 prefix-fanout=2.1 sequence=CCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=83.03 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=10.1 sequence=AAACCCAAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTCCTCCCCTTCGCTAGCCGGAAAGGCGGTGAAGCTCAACCCCTCCTCCTCTGAGATCATGGGCAATGGCCGTGTCTCCATGAGGAAAACCACCAAGCCTGTTCCCTCCGGGAGCCCATGGTACGGACCAGACCGTGTTAAATACTTGGGCCCGTTCTCTGGTGAGCCCCCATCCTACTTGACTGGTGAGTTCCCTGGTGACTACGGCTGGGACACTGCTGGCCTCTCTGCTGACCCAGAGACCTTTGCCAAGAACCGTGAGCTTGAAGTCATCCATTCCAGGTGGGCCATGCTTGGAGCTCTTGGATGCGTCTTCCCCGAGCTCTTGTCCCGCAACGGTGTCAAGTTCGGCGAGGCTGTATGGTTCAAGGCTGGAGCCCAGATCTTCAGCGAGGGTGGACTTGACTACTTGGGCAACCCAAGCTTGATCCACGCACAAAG SRR12671326 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 15:43:54 Started mapping on | Feb 11 15:43:54 Finished on | Feb 11 15:46:41 Mapping speed, Million of reads per hour | 524.54 Number of input reads | 24333026 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 22687463 Uniquely mapped reads % | 93.24% Average mapped length | 298.28 Number of splices: Total | 23100861 Number of splices: Annotated (sjdb) | 22634033 Number of splices: GT/AG | 22666509 Number of splices: GC/AG | 355418 Number of splices: AT/AC | 13814 Number of splices: Non-canonical | 65120 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.95 Insertion rate per base | 0.02% Insertion average length | 2.23 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 578725 % of reads mapped to multiple loci | 2.38% Number of reads mapped to too many loci | 72303 % of reads mapped to too many loci | 0.30% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.99% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1066838 1066838 1066838 N_multimapping 578725 578725 578725 N_noFeature 798107 22288955 918896 N_ambiguous 422157 1809 143433 UnstrandedReadsAssigned:21467199 PositiveStrandReadsAssigned:396699 NegativeStrandReadsAssigned:21625134 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671326 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671326-trimmed-pair1.fastq SRR12671326-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 24,333,026 reads, 21,526,325 reads pseudoaligned [quant] estimated average fragment length: 304.727 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,164 rounds 52401 SRR12671326.ke.tsv 34699 SRR12671326.se.tsv 87100 total ==> SRR12671326.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1714.27 771 17.2885 Potri.005G024800.1.v4.1 1035 731.273 375 19.7122 Potri.004G059700.1.v4.1 961 657.489 2 0.11693 Potri.007G009000.2.v4.1 1416 1112.27 0 0 Potri.003G141000.2.v4.1 2943 2639.27 1202.84 17.5189 Potri.016G087400.1.v4.1 270 70.3643 1214.6 663.535 Potri.015G069301.1.v4.1 564 279.757 0 0 Potri.010G195200.1.v4.1 1773 1469.27 308 8.05807 Potri.012G127500.1.v4.1 977 673.42 80 4.56654 ==> SRR12671326.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 285 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 402 Potri.001G212900.v4.1 38 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 11 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 5 SRR12671326 completed mapping pipeline successfully