Starting /dee2/code/volunteer_pipeline.sh SRR12671329 current disk space = 3049972801536 free memory = 1397640300 SRR12671329 SRAfilesize d15928073adbd2d29829e8289fd95462 SRR12671329.sra SRR12671329.sra file validated SRR12671329 is paired end SRR12671329 is conventional basespace SRR12671329 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671329_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.566 37.0 37.0 37.0 37.0 37.0 2 36.4615 37.0 37.0 37.0 37.0 37.0 3 36.6555 37.0 37.0 37.0 37.0 37.0 4 36.7325 37.0 37.0 37.0 37.0 37.0 5 36.667 37.0 37.0 37.0 37.0 37.0 6 36.672 37.0 37.0 37.0 37.0 37.0 7 36.6095 37.0 37.0 37.0 37.0 37.0 8 36.734 37.0 37.0 37.0 37.0 37.0 9 36.7265 37.0 37.0 37.0 37.0 37.0 10-14 36.6935 37.0 37.0 37.0 37.0 37.0 15-19 36.6772 37.0 37.0 37.0 37.0 37.0 20-24 36.624900000000004 37.0 37.0 37.0 37.0 37.0 25-29 36.594500000000004 37.0 37.0 37.0 37.0 37.0 30-34 36.5873 37.0 37.0 37.0 37.0 37.0 35-39 36.5733 37.0 37.0 37.0 37.0 37.0 40-44 36.6082 37.0 37.0 37.0 37.0 37.0 45-49 36.5376 37.0 37.0 37.0 37.0 37.0 50-54 36.5236 37.0 37.0 37.0 37.0 37.0 55-59 36.5326 37.0 37.0 37.0 37.0 37.0 60-64 36.48790000000001 37.0 37.0 37.0 37.0 37.0 65-69 36.4722 37.0 37.0 37.0 37.0 37.0 70-74 36.4415 37.0 37.0 37.0 37.0 37.0 75-79 36.4688 37.0 37.0 37.0 37.0 37.0 80-84 36.414300000000004 37.0 37.0 37.0 37.0 37.0 85-89 36.3626 37.0 37.0 37.0 37.0 37.0 90-94 36.3486 37.0 37.0 37.0 37.0 37.0 95-99 36.3315 37.0 37.0 37.0 37.0 37.0 100-104 36.337300000000006 37.0 37.0 37.0 37.0 37.0 105-109 36.3802 37.0 37.0 37.0 37.0 37.0 110-114 36.213300000000004 37.0 37.0 37.0 37.0 37.0 115-119 36.26700000000001 37.0 37.0 37.0 37.0 37.0 120-124 36.2085 37.0 37.0 37.0 37.0 37.0 125-129 36.2457 37.0 37.0 37.0 37.0 37.0 130-134 36.1896 37.0 37.0 37.0 37.0 37.0 135-139 36.183 37.0 37.0 37.0 37.0 37.0 140-144 36.098600000000005 37.0 37.0 37.0 37.0 37.0 145-149 36.127300000000005 37.0 37.0 37.0 37.0 37.0 150-151 35.98825 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 1.0 23 1.0 24 3.0 25 1.0 26 1.0 27 6.0 28 10.0 29 6.0 30 14.0 31 30.0 32 28.0 33 61.0 34 89.0 35 230.0 36 2996.0 37 522.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.949999999999996 13.025 6.175 39.85 2 20.741482965931866 11.89879759519038 35.921843687374746 31.437875751503007 3 18.95 15.174999999999999 27.55 38.324999999999996 4 22.2 23.375 23.474999999999998 30.95 5 25.650000000000002 28.95 23.575 21.825 6 19.650000000000002 34.175 24.125 22.05 7 13.125 28.499999999999996 42.075 16.3 8 16.425 26.025 34.5 23.05 9 16.575 24.6 34.675 24.15 10-14 18.66 31.035 28.84 21.465 15-19 18.92 28.46 28.775000000000002 23.845 20-24 18.995 28.65 28.105000000000004 24.25 25-29 19.645000000000003 28.965000000000003 27.439999999999998 23.95 30-34 19.145 29.189999999999998 27.97 23.695 35-39 18.685 29.15 27.794999999999998 24.37 40-44 19.93 29.42 27.400000000000002 23.25 45-49 19.49 28.994999999999997 27.665 23.849999999999998 50-54 19.665 28.660000000000004 27.845 23.830000000000002 55-59 19.950000000000003 28.825 28.225 23.0 60-64 19.18 28.865000000000002 27.66 24.295 65-69 19.744999999999997 28.64 27.6 24.015 70-74 19.869999999999997 28.77 28.115000000000002 23.244999999999997 75-79 20.24 28.64 27.315 23.805 80-84 19.17 29.015 28.115000000000002 23.7 85-89 20.23 28.76 27.284999999999997 23.724999999999998 90-94 20.055 28.63 27.305 24.01 95-99 19.689999999999998 28.48 28.42 23.41 100-104 19.505 29.325000000000003 27.62 23.549999999999997 105-109 19.86 28.215 27.915 24.01 110-114 19.175 28.689999999999998 27.57 24.565 115-119 19.794999999999998 28.98 27.189999999999998 24.035 120-124 20.27 29.115000000000002 26.235000000000003 24.38 125-129 20.345 28.470000000000002 27.47 23.715 130-134 20.21 28.199999999999996 27.51 24.08 135-139 20.54 28.000000000000004 26.875 24.585 140-144 19.835 27.58 27.515 25.069999999999997 145-149 20.625 28.854999999999997 26.314999999999998 24.205 150-151 19.950000000000003 28.275 27.1 24.675 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 1.0 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.5 14 0.5 15 0.0 16 0.0 17 0.5 18 1.0 19 1.0 20 0.5 21 0.0 22 2.5 23 3.5 24 4.5 25 6.0 26 7.0 27 12.0 28 16.5 29 18.5 30 22.0 31 34.5 32 40.0 33 48.0 34 69.5 35 95.5 36 105.0 37 110.0 38 130.0 39 155.5 40 181.5 41 218.0 42 232.5 43 224.5 44 238.5 45 244.0 46 257.5 47 258.0 48 239.0 49 207.5 50 169.0 51 155.5 52 133.0 53 95.5 54 64.5 55 53.0 56 46.5 57 26.5 58 13.0 59 17.5 60 15.5 61 7.5 62 6.0 63 4.0 64 1.5 65 1.0 66 1.5 67 0.5 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.2 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 84.375 #Duplication Level Percentage of deduplicated Percentage of total 1 85.15555555555555 71.85000000000001 2 11.792592592592593 19.900000000000002 3 2.488888888888889 6.3 4 0.5037037037037037 1.7000000000000002 5 0.05925925925925926 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ATCAGATTCTTGTTTCACTGTTACCAGCTCATGCACTTGCAATGTTGGAG 5 0.125 No Hit GTGCCAACAAATTTAATATTATCTCGTAGAGCACAATGTACTCGAATTCG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.037500000000000006 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.07500000000000001 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.3 0.0 0.0 0.0 0.0 94-95 0.35 0.0 0.0 0.0 0.0 96-97 0.44999999999999996 0.0 0.0 0.0 0.0 98-99 0.525 0.0 0.0 0.0 0.0 100-101 0.5625 0.0 0.0 0.0 0.0 102-103 0.575 0.0 0.0 0.0 0.0 104-105 0.65 0.0 0.0 0.0 0.0 106-107 0.7749999999999999 0.0 0.0 0.0 0.0 108-109 0.8625 0.0 0.0 0.0 0.0 110-111 0.9625 0.0 0.0 0.0 0.0 112-113 1.0875 0.0 0.0 0.0 0.0 114-115 1.2374999999999998 0.0 0.0 0.0 0.0 116-117 1.4625 0.0 0.0 0.0 0.0 118-119 1.775 0.0 0.0 0.0 0.0 120-121 2.0 0.0 0.0 0.0 0.0 122-123 2.2 0.0 0.0 0.0 0.0 124-125 2.4625000000000004 0.0 0.0 0.0 0.0 126-127 2.8 0.0 0.0 0.0 0.0 128-129 3.1125 0.0 0.0 0.0 0.0 130-131 3.425 0.0 0.0 0.0 0.0 132-133 3.7875 0.0 0.0 0.0 0.0 134-135 4.0125 0.0 0.0 0.0 0.0 136-137 4.275 0.0 0.0 0.0 0.0 138-139 4.65 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTGCATT 10 0.006830828 145.0 9 TGCTTGT 10 0.006830828 145.0 4 GCTTGTG 10 0.006830828 145.0 5 CTGCTTG 10 0.006830828 145.0 3 TGTGCAT 10 0.006830828 145.0 8 >>END_MODULE SRR12671329 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671329_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.461 37.0 37.0 37.0 37.0 37.0 2 36.111 37.0 37.0 37.0 37.0 37.0 3 36.3225 37.0 37.0 37.0 37.0 37.0 4 36.3505 37.0 37.0 37.0 37.0 37.0 5 36.325 37.0 37.0 37.0 37.0 37.0 6 36.428 37.0 37.0 37.0 37.0 37.0 7 36.2015 37.0 37.0 37.0 37.0 37.0 8 36.388 37.0 37.0 37.0 37.0 37.0 9 36.371 37.0 37.0 37.0 37.0 37.0 10-14 36.3234 37.0 37.0 37.0 37.0 37.0 15-19 36.3308 37.0 37.0 37.0 37.0 37.0 20-24 36.2581 37.0 37.0 37.0 37.0 37.0 25-29 36.2192 37.0 37.0 37.0 37.0 37.0 30-34 36.1753 37.0 37.0 37.0 37.0 37.0 35-39 36.196000000000005 37.0 37.0 37.0 37.0 37.0 40-44 36.1916 37.0 37.0 37.0 37.0 37.0 45-49 36.2178 37.0 37.0 37.0 37.0 37.0 50-54 36.105599999999995 37.0 37.0 37.0 37.0 37.0 55-59 36.15050000000001 37.0 37.0 37.0 37.0 37.0 60-64 36.0861 37.0 37.0 37.0 37.0 37.0 65-69 36.1385 37.0 37.0 37.0 37.0 37.0 70-74 35.997299999999996 37.0 37.0 37.0 37.0 37.0 75-79 36.0179 37.0 37.0 37.0 37.0 37.0 80-84 36.0111 37.0 37.0 37.0 37.0 37.0 85-89 36.0724 37.0 37.0 37.0 37.0 37.0 90-94 35.9618 37.0 37.0 37.0 37.0 37.0 95-99 35.939 37.0 37.0 37.0 37.0 37.0 100-104 35.9073 37.0 37.0 37.0 37.0 37.0 105-109 35.881299999999996 37.0 37.0 37.0 37.0 37.0 110-114 35.814800000000005 37.0 37.0 37.0 37.0 37.0 115-119 35.9394 37.0 37.0 37.0 37.0 37.0 120-124 35.8956 37.0 37.0 37.0 37.0 37.0 125-129 35.846799999999995 37.0 37.0 37.0 37.0 37.0 130-134 35.7518 37.0 37.0 37.0 37.0 37.0 135-139 35.6223 37.0 37.0 37.0 37.0 37.0 140-144 35.6841 37.0 37.0 37.0 37.0 37.0 145-149 35.7303 37.0 37.0 37.0 37.0 37.0 150-151 35.4745 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 4.0 14 4.0 15 2.0 16 1.0 17 2.0 18 3.0 19 3.0 20 4.0 21 2.0 22 3.0 23 4.0 24 6.0 25 7.0 26 7.0 27 4.0 28 9.0 29 9.0 30 23.0 31 23.0 32 35.0 33 79.0 34 141.0 35 484.0 36 2854.0 37 286.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.900000000000006 25.55 10.299999999999999 24.25 2 27.075 25.924999999999997 31.7 15.299999999999999 3 21.275 27.200000000000003 33.900000000000006 17.625 4 24.45 33.95 23.775 17.825 5 27.975 35.525 21.075 15.425 6 21.875 39.825 22.075 16.225 7 21.325 21.75 37.425000000000004 19.5 8 21.15 24.4 29.425 25.025 9 23.25 26.125 28.749999999999996 21.875 10-14 24.245 28.895 26.634999999999998 20.225 15-19 23.685000000000002 27.92 27.48 20.915 20-24 23.48 28.665000000000003 27.62 20.235 25-29 24.46 28.965000000000003 26.755000000000003 19.82 30-34 23.215 28.425 28.18 20.18 35-39 24.255 27.865000000000002 27.665 20.215 40-44 23.275000000000002 28.115000000000002 27.96 20.65 45-49 23.425 28.23 27.700000000000003 20.645 50-54 23.185 28.07 27.485 21.26 55-59 23.215 28.499999999999996 27.560000000000002 20.724999999999998 60-64 22.99 27.675 28.585 20.75 65-69 24.135 28.46 27.565 19.84 70-74 23.64 27.85 27.77 20.74 75-79 23.68 28.63 27.27 20.419999999999998 80-84 23.135 28.499999999999996 27.555000000000003 20.810000000000002 85-89 24.19 28.375 26.99 20.445 90-94 23.919999999999998 28.18 27.47 20.43 95-99 23.28 27.865000000000002 28.244999999999997 20.61 100-104 23.845 27.68 27.925 20.549999999999997 105-109 23.695 28.084999999999997 27.994999999999997 20.225 110-114 24.310000000000002 28.015 27.985 19.689999999999998 115-119 24.535 27.97 27.045 20.45 120-124 23.990000000000002 28.044999999999998 27.384999999999998 20.580000000000002 125-129 24.355 27.495000000000005 27.61 20.54 130-134 24.755 27.85 27.275 20.119999999999997 135-139 24.905 27.905 27.450000000000003 19.74 140-144 24.95 27.62 27.665 19.765 145-149 25.85 27.82 26.87 19.46 150-151 25.5 27.55 27.5625 19.3875 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 1.0 10 0.5 11 0.5 12 0.5 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 1.0 21 1.5 22 1.0 23 1.5 24 4.5 25 4.5 26 4.5 27 8.0 28 10.0 29 15.5 30 22.0 31 20.5 32 24.0 33 32.0 34 48.5 35 55.0 36 74.0 37 103.0 38 140.5 39 163.5 40 170.0 41 219.0 42 282.5 43 292.5 44 279.0 45 280.0 46 259.5 47 247.0 48 231.0 49 206.5 50 165.5 51 138.0 52 122.5 53 91.0 54 66.0 55 51.0 56 39.0 57 30.5 58 23.0 59 16.5 60 13.5 61 9.5 62 9.0 63 4.5 64 1.0 65 1.0 66 1.0 67 1.0 68 0.5 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.5 79 1.0 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.5 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.5 97 1.5 98 2.0 99 1.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 84.875 #Duplication Level Percentage of deduplicated Percentage of total 1 85.59646539027982 72.65 2 11.634756995581737 19.75 3 2.1796759941089836 5.55 4 0.5301914580265096 1.7999999999999998 5 0.05891016200294551 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 5 0.125 No Hit GAAGGGCTTCACTTATCAAATCATGGCACCTGAAGATCTCCATGTCTTCT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.037500000000000006 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.07500000000000001 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.275 0.0 0.0 0.0 0.0 92-93 0.325 0.0 0.0 0.0 0.0 94-95 0.375 0.0 0.0 0.0 0.0 96-97 0.475 0.0 0.0 0.0 0.0 98-99 0.575 0.0 0.0 0.0 0.0 100-101 0.6125 0.0 0.0 0.0 0.0 102-103 0.625 0.0 0.0 0.0 0.0 104-105 0.7 0.0 0.0 0.0 0.0 106-107 0.825 0.0 0.0 0.0 0.0 108-109 0.9125 0.0 0.0 0.0 0.0 110-111 1.0125 0.0 0.0 0.0 0.0 112-113 1.1375000000000002 0.0 0.0 0.0 0.0 114-115 1.2875 0.0 0.0 0.0 0.0 116-117 1.5125 0.0 0.0 0.0 0.0 118-119 1.825 0.0 0.0 0.0 0.0 120-121 2.05 0.0 0.0 0.0 0.0 122-123 2.25 0.0 0.0 0.0 0.0 124-125 2.5125 0.0 0.0 0.0 0.0 126-127 2.8499999999999996 0.0 0.0 0.0 0.0 128-129 3.1625 0.0 0.0 0.0 0.0 130-131 3.4749999999999996 0.0 0.0 0.0 0.0 132-133 3.8375 0.0 0.0 0.0 0.0 134-135 4.0625 0.0 0.0 0.0 0.0 136-137 4.325 0.0 0.0 0.0 0.0 138-139 4.699999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTGTTTT 10 0.006830828 145.0 1 GTACCAA 10 0.006830828 145.0 145 TAAAAGA 10 0.006830828 145.0 3 ATAAAAG 10 0.006830828 145.0 2 >>END_MODULE Read 906914 spots for SRR12671329.sra Written 906914 spots for SRR12671329.sra Read 906914 spots for SRR12671329.sra Written 906914 spots for SRR12671329.sra Read 906914 spots for SRR12671329.sra Written 906914 spots for SRR12671329.sra Read 906914 spots for SRR12671329.sra Written 906914 spots for SRR12671329.sra Read 906914 spots for SRR12671329.sra Written 906914 spots for SRR12671329.sra Read 906914 spots for SRR12671329.sra Written 906914 spots for SRR12671329.sra Read 906914 spots for SRR12671329.sra Written 906914 spots for SRR12671329.sra Read 906914 spots for SRR12671329.sra Written 906914 spots for SRR12671329.sra Read 906918 spots for SRR12671329.sra Written 906918 spots for SRR12671329.sra Read 906914 spots for SRR12671329.sra Written 906914 spots for SRR12671329.sra Read 906914 spots for SRR12671329.sra Written 906914 spots for SRR12671329.sra Read 906914 spots for SRR12671329.sra Written 906914 spots for SRR12671329.sra Read 906914 spots for SRR12671329.sra Written 906914 spots for SRR12671329.sra Read 906914 spots for SRR12671329.sra Written 906914 spots for SRR12671329.sra Read 906914 spots for SRR12671329.sra Written 906914 spots for SRR12671329.sra Read 906914 spots for SRR12671329.sra Written 906914 spots for SRR12671329.sra Read 906914 spots for SRR12671329.sra Written 906914 spots for SRR12671329.sra Read 906914 spots for SRR12671329.sra Written 906914 spots for SRR12671329.sra Read 906914 spots for SRR12671329.sra Written 906914 spots for SRR12671329.sra Read 906914 spots for SRR12671329.sra Written 906914 spots for SRR12671329.sra SRR ids: ['SRR12671329.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_unkckrow SRR12671329.sra spots: 18138284 blocks: [[1, 906914], [906915, 1813828], [1813829, 2720742], [2720743, 3627656], [3627657, 4534570], [4534571, 5441484], [5441485, 6348398], [6348399, 7255312], [7255313, 8162226], [8162227, 9069140], [9069141, 9976054], [9976055, 10882968], [10882969, 11789882], [11789883, 12696796], [12696797, 13603710], [13603711, 14510624], [14510625, 15417538], [15417539, 16324452], [16324453, 17231366], [17231367, 18138284]] SRR12671329 file size 6142482 SRR12671329 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671329 SRR12671329_1.fastq SRR12671329_2.fastq Input file: SRR12671329_1.fastq Paired file: SRR12671329_2.fastq trimmed: SRR12671329-trimmed-pair1.fastq, SRR12671329-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 14:56:00 2025 >> started Tue Feb 11 14:56:20 2025 >> done (20.486s) 18138284 read pairs processed; of these: 69 ( 0.00%) short read pairs filtered out after trimming by size control 7081 ( 0.04%) empty read pairs filtered out after trimming by size control 18131134 (99.96%) read pairs available; of these: 1072078 ( 5.91%) trimmed read pairs available after processing 17059056 (94.09%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 5 0.00% 20 7 0.00% 21 12 0.00% 22 8 0.00% 23 5 0.00% 24 14 0.00% 25 13 0.00% 26 9 0.00% 27 11 0.00% 28 17 0.00% 29 13 0.00% 30 19 0.00% 31 17 0.00% 32 23 0.00% 33 16 0.00% 34 17 0.00% 35 16 0.00% 36 29 0.00% 37 23 0.00% 38 26 0.00% 39 26 0.00% 40 24 0.00% 41 23 0.00% 42 29 0.00% 43 37 0.00% 44 47 0.00% 45 54 0.00% 46 39 0.00% 47 63 0.00% 48 55 0.00% 49 61 0.00% 50 73 0.00% 51 62 0.00% 52 97 0.00% 53 96 0.00% 54 87 0.00% 55 105 0.00% 56 126 0.00% 57 141 0.00% 58 175 0.00% 59 203 0.00% 60 246 0.00% 61 257 0.00% 62 323 0.00% 63 365 0.00% 64 388 0.00% 65 460 0.00% 66 461 0.00% 67 478 0.00% 68 579 0.00% 69 666 0.00% 70 748 0.00% 71 806 0.00% 72 985 0.01% 73 1098 0.01% 74 1196 0.01% 75 1360 0.01% 76 1397 0.01% 77 1666 0.01% 78 1734 0.01% 79 1897 0.01% 80 2192 0.01% 81 2517 0.01% 82 2719 0.01% 83 2854 0.02% 84 3233 0.02% 85 3509 0.02% 86 3941 0.02% 87 4137 0.02% 88 4237 0.02% 89 4494 0.02% 90 4782 0.03% 91 5029 0.03% 92 5496 0.03% 93 5994 0.03% 94 6159 0.03% 95 6790 0.04% 96 7082 0.04% 97 7576 0.04% 98 7664 0.04% 99 7770 0.04% 100 8461 0.05% 101 8340 0.05% 102 8742 0.05% 103 9104 0.05% 104 9826 0.05% 105 10250 0.06% 106 10665 0.06% 107 11136 0.06% 108 11315 0.06% 109 11587 0.06% 110 11935 0.07% 111 12186 0.07% 112 12741 0.07% 113 12812 0.07% 114 13443 0.07% 115 14043 0.08% 116 14462 0.08% 117 14964 0.08% 118 15253 0.08% 119 15857 0.09% 120 15769 0.09% 121 16310 0.09% 122 16623 0.09% 123 16977 0.09% 124 17940 0.10% 125 17981 0.10% 126 19103 0.11% 127 19420 0.11% 128 19594 0.11% 129 20236 0.11% 130 20628 0.11% 131 21162 0.12% 132 21578 0.12% 133 21877 0.12% 134 22083 0.12% 135 23031 0.13% 136 22901 0.13% 137 23659 0.13% 138 24465 0.13% 139 25534 0.14% 140 25612 0.14% 141 26413 0.15% 142 26562 0.15% 143 26862 0.15% 144 27450 0.15% 145 28361 0.16% 146 28482 0.16% 147 28672 0.16% 148 30026 0.17% 149 31058 0.17% 150 31371 0.17% 151 17059056 94.09% 18131134 reads passed initial QC criterion=sequence-density sequence-density=0.38 sequence-density-rank=1 fanout-score=1.97 fanout-score-rank=28 prefix-density=0.38 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTTCGAGCGAAGAAGGT criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=83.81 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=9.1 sequence=AAACAGAATATTTACTTTTAGCGCAAGTTTCAATTCATGAGCTCGTTACATCACAAGTTAACATTACAAGCCAATAGTCCCAGCACAGAAAAAACTCTTTTGTTGCTCACTTTCCGGGAACGAAGTTTGTGGCATATGCCCAGGCGTTGTTGTTTACTGGGTCAGAAAGGTGGTCAGCCAGGTTCTCCAGTGGTCCCTTTCCGGTCACAATGGCCTGGACAAAGAATCCGAACATTGAGAACATAGCCAACCT criterion=sequence-density sequence-density=0.48 sequence-density-rank=1 fanout-score=2.08 fanout-score-rank=24 prefix-density=0.49 prefix-fanout=2.0 sequence=AACCGCACCCCGGCACA criterion=fanout-score sequence-density=0.08 sequence-density-rank=26 fanout-score=38.07 fanout-score-rank=1 prefix-density=0.31 prefix-fanout=10.3 sequence=AAGGCCAAGATCCAGGACAAGGA SRR12671329 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 14:57:08 Started mapping on | Feb 11 14:57:08 Finished on | Feb 11 14:59:36 Mapping speed, Million of reads per hour | 441.03 Number of input reads | 18131134 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 16851634 Uniquely mapped reads % | 92.94% Average mapped length | 297.57 Number of splices: Total | 16361625 Number of splices: Annotated (sjdb) | 16006671 Number of splices: GT/AG | 16036504 Number of splices: GC/AG | 257803 Number of splices: AT/AC | 11737 Number of splices: Non-canonical | 55581 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.72 Insertion rate per base | 0.03% Insertion average length | 2.25 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 491425 % of reads mapped to multiple loci | 2.71% Number of reads mapped to too many loci | 29245 % of reads mapped to too many loci | 0.16% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.10% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 788075 788075 788075 N_multimapping 491425 491425 491425 N_noFeature 532524 16558682 624723 N_ambiguous 325950 1203 124783 UnstrandedReadsAssigned:15993160 PositiveStrandReadsAssigned:291749 NegativeStrandReadsAssigned:16102128 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671329 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671329-trimmed-pair1.fastq SRR12671329-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,131,134 reads, 16,046,566 reads pseudoaligned [quant] estimated average fragment length: 280.948 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,094 rounds 52401 SRR12671329.ke.tsv 34699 SRR12671329.se.tsv 87100 total ==> SRR12671329.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1738.05 600 18.5657 Potri.005G024800.1.v4.1 1035 755.052 587 41.8104 Potri.004G059700.1.v4.1 961 681.163 5 0.394768 Potri.007G009000.2.v4.1 1416 1136.05 0 0 Potri.003G141000.2.v4.1 2943 2663.05 500 10.0975 Potri.016G087400.1.v4.1 270 72.3015 1386 1030.95 Potri.015G069301.1.v4.1 564 296.535 0 0 Potri.010G195200.1.v4.1 1773 1493.05 105 3.78214 Potri.012G127500.1.v4.1 977 697.078 123 9.48958 ==> SRR12671329.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 190 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 289 Potri.001G212900.v4.1 6 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 11 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 14 SRR12671329 completed mapping pipeline successfully