Starting /dee2/code/volunteer_pipeline.sh SRR12671330 current disk space = 3049412489216 free memory = 1414079648 SRR12671330 SRAfilesize f3b89d71a2228d91883b3d544f03313c SRR12671330.sra SRR12671330.sra file validated SRR12671330 is paired end SRR12671330 is conventional basespace SRR12671330 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671330_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.6585 37.0 37.0 37.0 37.0 37.0 2 36.41575 37.0 37.0 37.0 37.0 37.0 3 36.59 37.0 37.0 37.0 37.0 37.0 4 36.5825 37.0 37.0 37.0 37.0 37.0 5 36.638 37.0 37.0 37.0 37.0 37.0 6 36.651 37.0 37.0 37.0 37.0 37.0 7 36.5995 37.0 37.0 37.0 37.0 37.0 8 36.572 37.0 37.0 37.0 37.0 37.0 9 36.645 37.0 37.0 37.0 37.0 37.0 10-14 36.6374 37.0 37.0 37.0 37.0 37.0 15-19 36.6566 37.0 37.0 37.0 37.0 37.0 20-24 36.615899999999996 37.0 37.0 37.0 37.0 37.0 25-29 36.5372 37.0 37.0 37.0 37.0 37.0 30-34 36.5201 37.0 37.0 37.0 37.0 37.0 35-39 36.5039 37.0 37.0 37.0 37.0 37.0 40-44 36.5127 37.0 37.0 37.0 37.0 37.0 45-49 36.451100000000004 37.0 37.0 37.0 37.0 37.0 50-54 36.45649999999999 37.0 37.0 37.0 37.0 37.0 55-59 36.4106 37.0 37.0 37.0 37.0 37.0 60-64 36.3681 37.0 37.0 37.0 37.0 37.0 65-69 36.3725 37.0 37.0 37.0 37.0 37.0 70-74 36.3458 37.0 37.0 37.0 37.0 37.0 75-79 36.3345 37.0 37.0 37.0 37.0 37.0 80-84 36.3639 37.0 37.0 37.0 37.0 37.0 85-89 36.2826 37.0 37.0 37.0 37.0 37.0 90-94 36.2933 37.0 37.0 37.0 37.0 37.0 95-99 36.1918 37.0 37.0 37.0 37.0 37.0 100-104 36.2079 37.0 37.0 37.0 37.0 37.0 105-109 36.2541 37.0 37.0 37.0 37.0 37.0 110-114 36.1608 37.0 37.0 37.0 37.0 37.0 115-119 36.1831 37.0 37.0 37.0 37.0 37.0 120-124 36.1456 37.0 37.0 37.0 37.0 37.0 125-129 36.1188 37.0 37.0 37.0 37.0 37.0 130-134 36.0673 37.0 37.0 37.0 37.0 37.0 135-139 36.086400000000005 37.0 37.0 37.0 37.0 37.0 140-144 35.9422 37.0 37.0 37.0 37.0 37.0 145-149 35.978100000000005 37.0 37.0 37.0 37.0 37.0 150-151 35.8455 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 2.0 19 1.0 20 3.0 21 1.0 22 2.0 23 3.0 24 2.0 25 1.0 26 2.0 27 7.0 28 7.0 29 14.0 30 18.0 31 30.0 32 29.0 33 49.0 34 112.0 35 288.0 36 2976.0 37 453.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 52.275000000000006 10.2 5.8999999999999995 31.624999999999996 2 19.919819594086697 12.15234277123528 35.3545477323979 32.57328990228013 3 18.325 17.325 29.5 34.849999999999994 4 23.95 25.2 22.35 28.499999999999996 5 24.45 30.925000000000004 23.425 21.2 6 20.125 34.875 22.525000000000002 22.475 7 15.85 26.625 41.8 15.725 8 16.175 27.55 31.674999999999997 24.6 9 16.45 25.3 34.125 24.125 10-14 19.595000000000002 29.849999999999998 28.105000000000004 22.45 15-19 19.85 28.07 28.565 23.515 20-24 20.085 28.43 27.529999999999998 23.955000000000002 25-29 20.54 28.384999999999998 27.150000000000002 23.925 30-34 20.369999999999997 29.255 26.99 23.385 35-39 19.97 28.865000000000002 27.32 23.845 40-44 19.900000000000002 28.57 27.810000000000002 23.72 45-49 20.419999999999998 28.945 27.1 23.535 50-54 20.365 28.544999999999998 27.26 23.830000000000002 55-59 19.99 28.505000000000003 27.71 23.794999999999998 60-64 19.509999999999998 28.48 27.77 24.240000000000002 65-69 20.365 28.599999999999998 27.195000000000004 23.84 70-74 20.424999999999997 28.365000000000002 27.47 23.74 75-79 20.419999999999998 27.894999999999996 27.515 24.169999999999998 80-84 20.075000000000003 28.13 27.815 23.98 85-89 19.580000000000002 28.685 27.845 23.89 90-94 20.330000000000002 28.075 27.175 24.42 95-99 20.5 27.91 27.779999999999998 23.810000000000002 100-104 20.73 28.360000000000003 27.325 23.585 105-109 21.325 27.76 27.534999999999997 23.380000000000003 110-114 20.78 28.194999999999997 27.92 23.105 115-119 21.105 27.865000000000002 26.905 24.125 120-124 20.46 27.275 27.83 24.435000000000002 125-129 20.805 28.595 27.67 22.93 130-134 20.505000000000003 27.145000000000003 28.08 24.27 135-139 20.724999999999998 28.21 27.029999999999998 24.035 140-144 20.955 27.794999999999998 27.485 23.765 145-149 21.2 28.07 27.27 23.46 150-151 20.8 28.175 27.400000000000002 23.625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 1.0 2 1.0 3 0.5 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.5 11 0.5 12 0.0 13 0.5 14 0.5 15 1.0 16 2.0 17 1.5 18 0.5 19 0.0 20 1.0 21 1.0 22 1.0 23 2.0 24 2.0 25 5.0 26 7.5 27 9.5 28 11.0 29 16.0 30 22.0 31 23.5 32 28.5 33 44.0 34 44.5 35 64.5 36 94.0 37 107.5 38 140.0 39 154.0 40 165.5 41 188.5 42 209.0 43 226.0 44 240.5 45 246.5 46 249.0 47 264.5 48 253.5 49 225.0 50 200.0 51 159.5 52 121.5 53 112.0 54 92.0 55 62.5 56 57.0 57 44.0 58 29.5 59 25.0 60 15.5 61 6.5 62 5.5 63 4.5 64 2.5 65 1.0 66 1.0 67 1.5 68 1.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.22499999999999998 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 83.275 #Duplication Level Percentage of deduplicated Percentage of total 1 83.99879915941159 69.95 2 12.758931251876312 21.25 3 2.4917442209546685 6.225 4 0.6604623236265386 2.1999999999999997 5 0.09006304413089163 0.375 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CACCAAGAAGATGCTAAAACAACCTCACTTGACCCCTCTGCTGCCTTCAT 5 0.125 No Hit GCCAAAACAGCTTATATTCTTCACCCCTGTTATGAAGGGCTTCTCGGGCT 5 0.125 No Hit GACCGGCCTAACTAGATACATTTTCAACCAAGAGAAAGAGTAAATTGATA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0125 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.16249999999999998 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.1875 0.0 0.0 0.0 0.0 84-85 0.21250000000000002 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88-89 0.2625 0.0 0.0 0.0 0.0 90-91 0.35 0.0 0.0 0.0 0.0 92-93 0.4 0.0 0.0 0.0 0.0 94-95 0.4125 0.0 0.0 0.0 0.0 96-97 0.44999999999999996 0.0 0.0 0.0 0.0 98-99 0.5 0.0 0.0 0.0 0.0 100-101 0.55 0.0 0.0 0.0 0.0 102-103 0.625 0.0 0.0 0.0 0.0 104-105 0.7 0.0 0.0 0.0 0.0 106-107 0.825 0.0 0.0 0.0 0.0 108-109 0.8625 0.0 0.0 0.0 0.0 110-111 0.925 0.0 0.0 0.0 0.0 112-113 0.9874999999999999 0.0 0.0 0.0 0.0 114-115 1.1125 0.0 0.0 0.0 0.0 116-117 1.225 0.0 0.0 0.0 0.0 118-119 1.3 0.0 0.0 0.0 0.0 120-121 1.3125 0.0 0.0 0.0 0.0 122-123 1.325 0.0 0.0 0.0 0.0 124-125 1.4249999999999998 0.0 0.0 0.0 0.0 126-127 1.625 0.0 0.0 0.0 0.0 128-129 1.775 0.0 0.0 0.0 0.0 130-131 1.9625 0.0 0.0 0.0 0.0 132-133 2.0999999999999996 0.0 0.0 0.0 0.0 134-135 2.3 0.0 0.0 0.0 0.0 136-137 2.475 0.0 0.0 0.0 0.0 138-139 2.6500000000000004 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAGGTTC 10 0.006830828 145.0 2 >>END_MODULE SRR12671330 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671330_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3175 37.0 37.0 37.0 37.0 37.0 2 36.088 37.0 37.0 37.0 37.0 37.0 3 36.294 37.0 37.0 37.0 37.0 37.0 4 36.2745 37.0 37.0 37.0 37.0 37.0 5 36.3195 37.0 37.0 37.0 37.0 37.0 6 36.3385 37.0 37.0 37.0 37.0 37.0 7 36.303 37.0 37.0 37.0 37.0 37.0 8 36.2405 37.0 37.0 37.0 37.0 37.0 9 36.2585 37.0 37.0 37.0 37.0 37.0 10-14 36.3075 37.0 37.0 37.0 37.0 37.0 15-19 36.2713 37.0 37.0 37.0 37.0 37.0 20-24 36.2367 37.0 37.0 37.0 37.0 37.0 25-29 36.1945 37.0 37.0 37.0 37.0 37.0 30-34 36.1777 37.0 37.0 37.0 37.0 37.0 35-39 36.133500000000005 37.0 37.0 37.0 37.0 37.0 40-44 36.142399999999995 37.0 37.0 37.0 37.0 37.0 45-49 36.069199999999995 37.0 37.0 37.0 37.0 37.0 50-54 36.0914 37.0 37.0 37.0 37.0 37.0 55-59 36.0737 37.0 37.0 37.0 37.0 37.0 60-64 36.0743 37.0 37.0 37.0 37.0 37.0 65-69 36.033699999999996 37.0 37.0 37.0 37.0 37.0 70-74 36.0168 37.0 37.0 37.0 37.0 37.0 75-79 36.0013 37.0 37.0 37.0 37.0 37.0 80-84 35.9215 37.0 37.0 37.0 37.0 37.0 85-89 35.9805 37.0 37.0 37.0 37.0 37.0 90-94 35.963100000000004 37.0 37.0 37.0 37.0 37.0 95-99 35.8258 37.0 37.0 37.0 37.0 37.0 100-104 35.8245 37.0 37.0 37.0 37.0 37.0 105-109 35.7251 37.0 37.0 37.0 37.0 37.0 110-114 35.7745 37.0 37.0 37.0 37.0 37.0 115-119 35.8596 37.0 37.0 37.0 37.0 37.0 120-124 35.803399999999996 37.0 37.0 37.0 37.0 37.0 125-129 35.7654 37.0 37.0 37.0 37.0 37.0 130-134 35.6889 37.0 37.0 37.0 37.0 37.0 135-139 35.6104 37.0 37.0 37.0 37.0 37.0 140-144 35.6495 37.0 37.0 37.0 37.0 37.0 145-149 35.5778 37.0 37.0 37.0 37.0 37.0 150-151 35.36725 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 2.0 14 3.0 15 8.0 16 2.0 17 0.0 18 1.0 19 3.0 20 2.0 21 1.0 22 3.0 23 3.0 24 3.0 25 13.0 26 7.0 27 10.0 28 18.0 29 15.0 30 16.0 31 35.0 32 44.0 33 83.0 34 170.0 35 483.0 36 2782.0 37 292.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.775 25.374999999999996 8.125 20.724999999999998 2 27.450000000000003 25.924999999999997 30.3 16.325 3 21.45 25.275 34.2 19.075 4 24.875 34.275 24.25 16.6 5 26.525 36.425000000000004 20.875 16.175 6 20.9 38.175 22.900000000000002 18.025 7 20.95 21.125 38.15 19.775000000000002 8 19.875 25.575 28.725 25.825 9 22.625 24.75 28.075 24.55 10-14 23.095 29.770000000000003 25.979999999999997 21.154999999999998 15-19 23.68 28.18 27.334999999999997 20.805 20-24 23.155 28.645 27.275 20.925 25-29 22.355 27.465 28.425 21.755 30-34 22.515 28.365000000000002 27.62 21.5 35-39 23.400000000000002 28.04 27.935 20.625 40-44 22.85 28.235 28.27 20.645 45-49 22.805 28.249999999999996 27.73 21.215 50-54 22.625 28.444999999999997 27.750000000000004 21.18 55-59 23.105 28.285 27.13 21.48 60-64 22.61 27.944999999999997 27.36 22.085 65-69 22.98 27.32 27.93 21.77 70-74 23.205000000000002 27.98 26.69 22.125 75-79 22.900000000000002 28.065 27.315 21.72 80-84 23.28 27.825 26.805 22.09 85-89 23.565 26.875 27.415 22.145 90-94 24.32 27.715 27.08 20.885 95-99 22.96 27.855 27.07 22.115000000000002 100-104 23.419999999999998 27.965 27.74 20.875 105-109 23.425 27.189999999999998 28.060000000000002 21.325 110-114 23.56 28.189999999999998 27.33 20.919999999999998 115-119 23.445 28.13 27.474999999999998 20.95 120-124 24.060000000000002 27.83 27.13 20.979999999999997 125-129 23.995 27.860000000000003 27.265 20.880000000000003 130-134 24.610000000000003 27.455000000000002 27.575 20.36 135-139 23.845 27.815 27.37 20.97 140-144 24.09 27.55 27.095000000000002 21.265 145-149 24.927492749274926 27.07270727072707 27.552755275527552 20.447044704470446 150-151 25.324999999999996 28.3375 25.6125 20.724999999999998 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 1.0 14 1.0 15 1.5 16 2.0 17 1.0 18 0.0 19 0.0 20 2.0 21 3.0 22 2.0 23 1.0 24 1.0 25 2.0 26 2.0 27 2.5 28 4.5 29 10.5 30 16.5 31 24.0 32 26.0 33 32.5 34 39.5 35 50.0 36 77.0 37 109.5 38 123.0 39 152.0 40 192.0 41 221.5 42 253.5 43 264.0 44 273.0 45 269.0 46 246.5 47 228.0 48 233.5 49 225.5 50 169.0 51 140.5 52 120.0 53 90.5 54 84.0 55 69.0 56 59.5 57 49.5 58 37.5 59 27.5 60 17.5 61 13.5 62 10.5 63 5.0 64 0.5 65 1.0 66 2.0 67 1.5 68 0.5 69 0.0 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.5 81 0.5 82 1.0 83 1.0 84 0.0 85 0.0 86 0.0 87 0.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.01 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 83.42500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 84.6568774348217 70.625 2 12.346418939166917 20.599999999999998 3 2.0077914294276296 5.025 4 0.7491759065028468 2.5 5 0.08990110878034162 0.375 6 0.08990110878034162 0.44999999999999996 7 0.029967036260113877 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.029967036260113877 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 10 0.25 No Hit AGAACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 7 0.17500000000000002 No Hit GAGAACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAAT 6 0.15 No Hit AGAGAACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 6 0.15 No Hit CAGAGAACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTA 6 0.15 No Hit AAGGGGAAATGCCAGCATTTCAATCATGTCAAGGCGATTAGAACCCGTAC 5 0.125 No Hit GGAGGATTGATTTGGTCTTAGACTTTATTCCACCAAGCATGTCAGAATTC 5 0.125 No Hit AATATTGGGACTTTGAGGATGTTGACGCCCAGGACTTTGAATTTGTTCGA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0125 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.16249999999999998 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.1875 0.0 0.0 0.0 0.0 84-85 0.21250000000000002 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88-89 0.2625 0.0 0.0 0.0 0.0 90-91 0.35 0.0 0.0 0.0 0.0 92-93 0.4 0.0 0.0 0.0 0.0 94-95 0.4125 0.0 0.0 0.0 0.0 96-97 0.44999999999999996 0.0 0.0 0.0 0.0 98-99 0.5 0.0 0.0 0.0 0.0 100-101 0.55 0.0 0.0 0.0 0.0 102-103 0.625 0.0 0.0 0.0 0.0 104-105 0.7 0.0 0.0 0.0 0.0 106-107 0.825 0.0 0.0 0.0 0.0 108-109 0.8625 0.0 0.0 0.0 0.0 110-111 0.925 0.0 0.0 0.0 0.0 112-113 0.9874999999999999 0.0 0.0 0.0 0.0 114-115 1.1125 0.0 0.0 0.0 0.0 116-117 1.225 0.0 0.0 0.0 0.0 118-119 1.3 0.0 0.0 0.0 0.0 120-121 1.3125 0.0 0.0 0.0 0.0 122-123 1.325 0.0 0.0 0.0 0.0 124-125 1.4249999999999998 0.0 0.0 0.0 0.0 126-127 1.625 0.0 0.0 0.0 0.0 128-129 1.775 0.0 0.0 0.0 0.0 130-131 1.95 0.0 0.0 0.0 0.0 132-133 2.075 0.0 0.0 0.0 0.0 134-135 2.2875 0.0 0.0 0.0 0.0 136-137 2.475 0.0 0.0 0.0 0.0 138-139 2.6500000000000004 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTAGTC 10 0.006830828 145.0 1 >>END_MODULE Read 978588 spots for SRR12671330.sra Written 978588 spots for SRR12671330.sra Read 978588 spots for SRR12671330.sra Written 978588 spots for SRR12671330.sra Read 978588 spots for SRR12671330.sra Written 978588 spots for SRR12671330.sra Read 978588 spots for SRR12671330.sra Written 978588 spots for SRR12671330.sra Read 978588 spots for SRR12671330.sra Written 978588 spots for SRR12671330.sra Read 978588 spots for SRR12671330.sra Written 978588 spots for SRR12671330.sra Read 978588 spots for SRR12671330.sra Written 978588 spots for SRR12671330.sra Read 978588 spots for SRR12671330.sra Written 978588 spots for SRR12671330.sra Read 978588 spots for SRR12671330.sra Written 978588 spots for SRR12671330.sra Read 978588 spots for SRR12671330.sra Written 978588 spots for SRR12671330.sra Read 978588 spots for SRR12671330.sra Written 978588 spots for SRR12671330.sra Read 978588 spots for SRR12671330.sra Written 978588 spots for SRR12671330.sra Read 978588 spots for SRR12671330.sra Written 978588 spots for SRR12671330.sra Read 978588 spots for SRR12671330.sra Written 978588 spots for SRR12671330.sra Read 978588 spots for SRR12671330.sra Written 978588 spots for SRR12671330.sra Read 978588 spots for SRR12671330.sra Written 978588 spots for SRR12671330.sra Read 978588 spots for SRR12671330.sra Written 978588 spots for SRR12671330.sra Read 978588 spots for SRR12671330.sra Written 978588 spots for SRR12671330.sra Read 978601 spots for SRR12671330.sra Written 978601 spots for SRR12671330.sra Read 978588 spots for SRR12671330.sra Written 978588 spots for SRR12671330.sra SRR ids: ['SRR12671330.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_2pxt_inx SRR12671330.sra spots: 19571773 blocks: [[1, 978588], [978589, 1957176], [1957177, 2935764], [2935765, 3914352], [3914353, 4892940], [4892941, 5871528], [5871529, 6850116], [6850117, 7828704], [7828705, 8807292], [8807293, 9785880], [9785881, 10764468], [10764469, 11743056], [11743057, 12721644], [12721645, 13700232], [13700233, 14678820], [14678821, 15657408], [15657409, 16635996], [16635997, 17614584], [17614585, 18593172], [18593173, 19571773]] SRR12671330 file size 6629644 SRR12671330 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671330 SRR12671330_1.fastq SRR12671330_2.fastq Input file: SRR12671330_1.fastq Paired file: SRR12671330_2.fastq trimmed: SRR12671330-trimmed-pair1.fastq, SRR12671330-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 15:49:53 2025 >> started Tue Feb 11 15:50:14 2025 >> done (20.969s) 19571773 read pairs processed; of these: 112 ( 0.00%) short read pairs filtered out after trimming by size control 10044 ( 0.05%) empty read pairs filtered out after trimming by size control 19561617 (99.95%) read pairs available; of these: 832372 ( 4.26%) trimmed read pairs available after processing 18729245 (95.74%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 11 0.00% 19 13 0.00% 20 14 0.00% 21 9 0.00% 22 10 0.00% 23 20 0.00% 24 20 0.00% 25 13 0.00% 26 33 0.00% 27 21 0.00% 28 16 0.00% 29 25 0.00% 30 20 0.00% 31 23 0.00% 32 27 0.00% 33 26 0.00% 34 31 0.00% 35 26 0.00% 36 36 0.00% 37 45 0.00% 38 27 0.00% 39 30 0.00% 40 28 0.00% 41 35 0.00% 42 24 0.00% 43 41 0.00% 44 41 0.00% 45 34 0.00% 46 51 0.00% 47 57 0.00% 48 52 0.00% 49 76 0.00% 50 96 0.00% 51 95 0.00% 52 94 0.00% 53 72 0.00% 54 100 0.00% 55 107 0.00% 56 104 0.00% 57 140 0.00% 58 145 0.00% 59 189 0.00% 60 230 0.00% 61 213 0.00% 62 261 0.00% 63 273 0.00% 64 306 0.00% 65 315 0.00% 66 356 0.00% 67 368 0.00% 68 456 0.00% 69 501 0.00% 70 612 0.00% 71 680 0.00% 72 711 0.00% 73 903 0.00% 74 983 0.01% 75 1029 0.01% 76 1205 0.01% 77 1230 0.01% 78 1317 0.01% 79 1530 0.01% 80 1744 0.01% 81 1899 0.01% 82 2012 0.01% 83 2203 0.01% 84 2401 0.01% 85 2603 0.01% 86 2845 0.01% 87 3044 0.02% 88 3249 0.02% 89 3329 0.02% 90 3575 0.02% 91 3903 0.02% 92 3929 0.02% 93 4340 0.02% 94 4604 0.02% 95 5080 0.03% 96 5193 0.03% 97 5433 0.03% 98 5605 0.03% 99 6014 0.03% 100 5959 0.03% 101 6162 0.03% 102 6586 0.03% 103 6918 0.04% 104 7204 0.04% 105 7717 0.04% 106 7855 0.04% 107 8107 0.04% 108 8358 0.04% 109 8441 0.04% 110 8568 0.04% 111 8877 0.05% 112 9489 0.05% 113 9678 0.05% 114 9748 0.05% 115 10530 0.05% 116 10771 0.06% 117 11057 0.06% 118 11404 0.06% 119 11514 0.06% 120 12021 0.06% 121 12348 0.06% 122 12700 0.06% 123 13359 0.07% 124 13733 0.07% 125 13771 0.07% 126 14582 0.07% 127 14956 0.08% 128 15411 0.08% 129 15837 0.08% 130 15825 0.08% 131 15884 0.08% 132 16734 0.09% 133 16986 0.09% 134 17352 0.09% 135 18044 0.09% 136 18245 0.09% 137 18976 0.10% 138 18958 0.10% 139 20414 0.10% 140 20343 0.10% 141 20833 0.11% 142 21444 0.11% 143 21400 0.11% 144 22209 0.11% 145 22759 0.12% 146 23574 0.12% 147 24062 0.12% 148 25016 0.13% 149 24967 0.13% 150 26125 0.13% 151 18729245 95.74% 19561617 reads passed initial QC criterion=sequence-density sequence-density=1.07 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=18 prefix-density=1.07 prefix-fanout=2.0 sequence=TTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=390.77 fanout-score-rank=1 prefix-density=0.26 prefix-fanout=16.0 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTG criterion=sequence-density sequence-density=1.28 sequence-density-rank=1 fanout-score=2.27 fanout-score-rank=24 prefix-density=1.33 prefix-fanout=2.2 sequence=CCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGAC criterion=fanout-score sequence-density=0.10 sequence-density-rank=31 fanout-score=10.99 fanout-score-rank=1 prefix-density=0.38 prefix-fanout=3.0 sequence=AACAGAAAAAAGAAAGATGGCCTCGGCATCATTTCTCAAGTCATCACCAGTTCTAGACAAGTCTGAGTTTGTTAAGGGTCAGACCCTCCGCTTGCCTTCTGCCTCCATTGTCCGGTGCCGCTCCACCGCCCCTTCTGCTCTTACCGTTCGTGCTGGTTCCTATGCTGAGGAGCTTGTCAAAACCGCGAAAACAATTGCATCTCCTGGCCGAGGTATTTTGGCCATGGATGAGTCTAACGCTACCTGTGGAAAACGTCTCGCGTCAATCGGGCTAGAGAACACCGAGGCTAACCGCCAGGCATACCGTACCCTTCTTGTGACAGTCCCTGGCCTTGGTGATTACGTCTCTGGTGCCATCCTTTTTGAGGAGACTCTCTACCAATCCAC SRR12671330 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 15:50:57 Started mapping on | Feb 11 15:50:58 Finished on | Feb 11 15:53:06 Mapping speed, Million of reads per hour | 550.17 Number of input reads | 19561617 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 17935016 Uniquely mapped reads % | 91.68% Average mapped length | 298.33 Number of splices: Total | 18035827 Number of splices: Annotated (sjdb) | 17693021 Number of splices: GT/AG | 17664742 Number of splices: GC/AG | 313263 Number of splices: AT/AC | 10810 Number of splices: Non-canonical | 47012 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.98 Insertion rate per base | 0.02% Insertion average length | 2.14 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 468352 % of reads mapped to multiple loci | 2.39% Number of reads mapped to too many loci | 110065 % of reads mapped to too many loci | 0.56% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.18% % of reads unmapped: other | 0.18% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1158249 1158249 1158249 N_multimapping 468352 468352 468352 N_noFeature 642795 17548395 741238 N_ambiguous 412876 1455 123865 UnstrandedReadsAssigned:16879345 PositiveStrandReadsAssigned:385166 NegativeStrandReadsAssigned:17069913 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671330 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671330-trimmed-pair1.fastq SRR12671330-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,561,617 reads, 17,035,469 reads pseudoaligned [quant] estimated average fragment length: 300.784 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 985 rounds 52401 SRR12671330.ke.tsv 34699 SRR12671330.se.tsv 87100 total ==> SRR12671330.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1718.22 657 16.716 Potri.005G024800.1.v4.1 1035 735.216 308 18.3139 Potri.004G059700.1.v4.1 961 661.43 6 0.396563 Potri.007G009000.2.v4.1 1416 1116.22 0 0 Potri.003G141000.2.v4.1 2943 2643.22 984 16.2745 Potri.016G087400.1.v4.1 270 69.4033 640.468 403.424 Potri.015G069301.1.v4.1 564 282.755 0 0 Potri.010G195200.1.v4.1 1773 1473.22 119 3.53122 Potri.012G127500.1.v4.1 977 677.338 108 6.97048 ==> SRR12671330.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 133 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 364 Potri.001G212900.v4.1 178 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 3 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 5 SRR12671330 completed mapping pipeline successfully