Starting /dee2/code/volunteer_pipeline.sh SRR12671331 current disk space = 3049280004096 free memory = 1289822612 SRR12671331 SRAfilesize 46f9e30fcd4f8bb2e395a69cc31f0e52 SRR12671331.sra SRR12671331.sra file validated SRR12671331 is paired end SRR12671331 is conventional basespace SRR12671331 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671331_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5855 37.0 37.0 37.0 37.0 37.0 2 36.37775 37.0 37.0 37.0 37.0 37.0 3 36.566 37.0 37.0 37.0 37.0 37.0 4 36.618 37.0 37.0 37.0 37.0 37.0 5 36.6565 37.0 37.0 37.0 37.0 37.0 6 36.655 37.0 37.0 37.0 37.0 37.0 7 36.5555 37.0 37.0 37.0 37.0 37.0 8 36.5985 37.0 37.0 37.0 37.0 37.0 9 36.5755 37.0 37.0 37.0 37.0 37.0 10-14 36.617200000000004 37.0 37.0 37.0 37.0 37.0 15-19 36.566700000000004 37.0 37.0 37.0 37.0 37.0 20-24 36.5409 37.0 37.0 37.0 37.0 37.0 25-29 36.5409 37.0 37.0 37.0 37.0 37.0 30-34 36.521 37.0 37.0 37.0 37.0 37.0 35-39 36.505500000000005 37.0 37.0 37.0 37.0 37.0 40-44 36.5161 37.0 37.0 37.0 37.0 37.0 45-49 36.46169999999999 37.0 37.0 37.0 37.0 37.0 50-54 36.4518 37.0 37.0 37.0 37.0 37.0 55-59 36.445 37.0 37.0 37.0 37.0 37.0 60-64 36.4505 37.0 37.0 37.0 37.0 37.0 65-69 36.444 37.0 37.0 37.0 37.0 37.0 70-74 36.4149 37.0 37.0 37.0 37.0 37.0 75-79 36.358200000000004 37.0 37.0 37.0 37.0 37.0 80-84 36.382000000000005 37.0 37.0 37.0 37.0 37.0 85-89 36.3087 37.0 37.0 37.0 37.0 37.0 90-94 36.2722 37.0 37.0 37.0 37.0 37.0 95-99 36.29540000000001 37.0 37.0 37.0 37.0 37.0 100-104 36.223 37.0 37.0 37.0 37.0 37.0 105-109 36.304 37.0 37.0 37.0 37.0 37.0 110-114 36.18320000000001 37.0 37.0 37.0 37.0 37.0 115-119 36.1731 37.0 37.0 37.0 37.0 37.0 120-124 36.1952 37.0 37.0 37.0 37.0 37.0 125-129 36.11 37.0 37.0 37.0 37.0 37.0 130-134 36.1391 37.0 37.0 37.0 37.0 37.0 135-139 36.056000000000004 37.0 37.0 37.0 37.0 37.0 140-144 35.9126 37.0 37.0 37.0 37.0 37.0 145-149 35.9971 37.0 37.0 37.0 37.0 37.0 150-151 35.92525 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 2.0 23 2.0 24 2.0 25 2.0 26 3.0 27 2.0 28 10.0 29 17.0 30 21.0 31 17.0 32 48.0 33 66.0 34 122.0 35 237.0 36 2975.0 37 474.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.800000000000004 10.65 6.25 36.3 2 20.89290193127665 11.487333834963632 34.988713318284425 32.6310509154753 3 17.775 17.2 28.15 36.875 4 22.900000000000002 25.95 22.175 28.975 5 25.35 30.2 24.15 20.3 6 18.8 35.125 24.349999999999998 21.725 7 15.625 24.8 43.2 16.375 8 16.05 26.450000000000003 32.925 24.575 9 16.625 23.35 37.125 22.900000000000002 10-14 19.495 30.570000000000004 27.915 22.02 15-19 20.265 28.515 27.63 23.59 20-24 20.23 28.335 27.91 23.525 25-29 19.439999999999998 28.46 27.939999999999998 24.16 30-34 19.415 28.535 28.515 23.535 35-39 20.1 28.38 27.58 23.94 40-44 20.215 28.689999999999998 27.79 23.305 45-49 19.855 28.860000000000003 27.73 23.555 50-54 20.599999999999998 29.18 26.845000000000002 23.375 55-59 19.63 28.585 27.595 24.19 60-64 20.06 29.375 27.42 23.145 65-69 20.27 28.494999999999997 27.435 23.799999999999997 70-74 19.725 28.77 27.435 24.07 75-79 20.52 28.325 27.865000000000002 23.29 80-84 20.18 28.415000000000003 27.72 23.685000000000002 85-89 20.72 28.439999999999998 27.500000000000004 23.34 90-94 20.395 28.025 28.244999999999997 23.335 95-99 19.814999999999998 28.71 27.950000000000003 23.525 100-104 20.365 27.925 27.715 23.995 105-109 20.349999999999998 27.889999999999997 28.139999999999997 23.62 110-114 20.075000000000003 28.82 28.060000000000002 23.044999999999998 115-119 20.1 28.87 27.37 23.66 120-124 20.080000000000002 28.825 27.105 23.990000000000002 125-129 20.474999999999998 28.025 27.634999999999998 23.865 130-134 20.575 27.63 28.365000000000002 23.43 135-139 20.75 27.939999999999998 27.034999999999997 24.275 140-144 21.21 27.725 28.01 23.055 145-149 20.405 28.38 27.355 23.86 150-151 21.2375 27.800000000000004 27.700000000000003 23.2625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 1.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.5 22 2.0 23 3.5 24 2.5 25 3.0 26 8.5 27 10.5 28 11.5 29 20.5 30 22.5 31 20.5 32 30.0 33 42.0 34 56.0 35 68.0 36 87.5 37 106.5 38 127.0 39 154.5 40 190.0 41 224.5 42 241.5 43 252.0 44 257.5 45 257.0 46 267.5 47 248.5 48 225.5 49 212.5 50 175.0 51 150.5 52 126.5 53 103.0 54 77.5 55 47.0 56 36.5 57 36.5 58 30.5 59 23.0 60 13.0 61 7.0 62 5.0 63 3.5 64 3.0 65 2.5 66 0.5 67 0.0 68 1.0 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.325 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 83.45 #Duplication Level Percentage of deduplicated Percentage of total 1 84.30197723187537 70.35 2 12.522468544038345 20.9 3 2.4266027561414023 6.075 4 0.5692031156381067 1.9 5 0.14979029358897544 0.625 6 0.029958058717795086 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGAGGATTTTGGGCTTCTGGGTCAGCTTGAATTTATGTCCTGGAGATTG 6 0.15 No Hit GTGAGGCCGAGCACAGAGAGAGGTTTCCATAAAACACATTATTATTTTAC 5 0.125 No Hit CACTAAGCTGTGTATTAACCTCAACAATCTCACCGGAGATCGGAGAATTG 5 0.125 No Hit CTTCCACATAGTCCAGTAGCGTCCATCATAGTACCCTGGTGAGCTGTGGT 5 0.125 No Hit CCTCGCATCTATACCGGCCATCAGGTCCAATTCCAAAGCCCTTTGGATCA 5 0.125 No Hit GCCATGGCTAGCTAACTGTACTTTAATTTACAGCAAATACTATATTAGAC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.16249999999999998 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88-89 0.325 0.0 0.0 0.0 0.0 90-91 0.3625 0.0 0.0 0.0 0.0 92-93 0.3875 0.0 0.0 0.0 0.0 94-95 0.4375 0.0 0.0 0.0 0.0 96-97 0.525 0.0 0.0 0.0 0.0 98-99 0.625 0.0 0.0 0.0 0.0 100-101 0.725 0.0 0.0 0.0 0.0 102-103 0.825 0.0 0.0 0.0 0.0 104-105 0.9125000000000001 0.0 0.0 0.0 0.0 106-107 1.025 0.0 0.0 0.0 0.0 108-109 1.1125 0.0 0.0 0.0 0.0 110-111 1.1375 0.0 0.0 0.0 0.0 112-113 1.25 0.0 0.0 0.0 0.0 114-115 1.3250000000000002 0.0 0.0 0.0 0.0 116-117 1.3875 0.0 0.0 0.0 0.0 118-119 1.45 0.0 0.0 0.0 0.0 120-121 1.5625 0.0 0.0 0.0 0.0 122-123 1.6375 0.0 0.0 0.0 0.0 124-125 1.775 0.0 0.0 0.0 0.0 126-127 1.8624999999999998 0.0 0.0 0.025 0.0 128-129 1.95 0.0 0.0 0.025 0.0 130-131 2.0875000000000004 0.0 0.0 0.025 0.0 132-133 2.3 0.0 0.0 0.025 0.0 134-135 2.5125 0.0 0.0 0.025 0.0 136-137 2.75 0.0 0.0 0.025 0.0 138-139 3.125 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGCACTA 10 0.006830828 145.0 4 >>END_MODULE SRR12671331 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671331_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2585 37.0 37.0 37.0 37.0 37.0 2 35.7915 37.0 37.0 37.0 37.0 37.0 3 36.052 37.0 37.0 37.0 37.0 37.0 4 36.0875 37.0 37.0 37.0 37.0 37.0 5 36.103 37.0 37.0 37.0 37.0 37.0 6 36.1725 37.0 37.0 37.0 37.0 37.0 7 36.1295 37.0 37.0 37.0 37.0 37.0 8 36.145 37.0 37.0 37.0 37.0 37.0 9 36.164 37.0 37.0 37.0 37.0 37.0 10-14 36.1845 37.0 37.0 37.0 37.0 37.0 15-19 36.2152 37.0 37.0 37.0 37.0 37.0 20-24 36.0594 37.0 37.0 37.0 37.0 37.0 25-29 36.106700000000004 37.0 37.0 37.0 37.0 37.0 30-34 36.1094 37.0 37.0 37.0 37.0 37.0 35-39 36.0127 37.0 37.0 37.0 37.0 37.0 40-44 36.030899999999995 37.0 37.0 37.0 37.0 37.0 45-49 36.032399999999996 37.0 37.0 37.0 37.0 37.0 50-54 35.95870000000001 37.0 37.0 37.0 37.0 37.0 55-59 35.989200000000004 37.0 37.0 37.0 37.0 37.0 60-64 35.9559 37.0 37.0 37.0 37.0 37.0 65-69 35.9287 37.0 37.0 37.0 37.0 37.0 70-74 35.888600000000004 37.0 37.0 37.0 37.0 37.0 75-79 35.8647 37.0 37.0 37.0 37.0 37.0 80-84 35.813199999999995 37.0 37.0 37.0 37.0 37.0 85-89 35.9203 37.0 37.0 37.0 37.0 37.0 90-94 35.8044 37.0 37.0 37.0 37.0 37.0 95-99 35.784400000000005 37.0 37.0 37.0 37.0 37.0 100-104 35.763999999999996 37.0 37.0 37.0 37.0 37.0 105-109 35.6966 37.0 37.0 37.0 37.0 37.0 110-114 35.6713 37.0 37.0 37.0 37.0 37.0 115-119 35.735200000000006 37.0 37.0 37.0 37.0 37.0 120-124 35.7082 37.0 37.0 37.0 37.0 37.0 125-129 35.633900000000004 37.0 37.0 37.0 37.0 37.0 130-134 35.576800000000006 37.0 37.0 37.0 37.0 37.0 135-139 35.455799999999996 37.0 37.0 37.0 37.0 37.0 140-144 35.5383 37.0 37.0 37.0 37.0 37.0 145-149 35.3968 37.0 37.0 37.0 37.0 37.0 150-151 35.174 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 2.0 21 2.0 22 4.0 23 2.0 24 5.0 25 7.0 26 3.0 27 13.0 28 20.0 29 25.0 30 33.0 31 45.0 32 73.0 33 118.0 34 232.0 35 628.0 36 2576.0 37 211.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.8 23.125 10.575 24.5 2 28.325 24.825 32.375 14.475 3 19.675 28.125 33.275 18.925 4 24.349999999999998 33.775 22.725 19.15 5 24.9 39.25 20.0 15.85 6 18.875 39.65 22.35 19.125 7 19.725 22.975 37.65 19.650000000000002 8 20.549999999999997 26.400000000000002 28.125 24.925 9 20.575 26.825 28.875 23.724999999999998 10-14 23.605 29.744999999999997 25.88 20.77 15-19 22.515 28.355000000000004 27.38 21.75 20-24 22.825 28.595 27.560000000000002 21.02 25-29 22.54 28.939999999999998 27.705000000000002 20.815 30-34 22.415 27.529999999999998 28.854999999999997 21.2 35-39 21.77 28.29 28.535 21.404999999999998 40-44 22.49 27.43 28.255000000000003 21.825 45-49 22.67 27.97 28.125 21.235 50-54 22.245 28.410000000000004 28.005000000000003 21.34 55-59 22.7 28.205000000000002 27.67 21.425 60-64 23.35 28.285 27.215 21.15 65-69 22.78 27.994999999999997 28.175 21.05 70-74 23.03 28.345 27.529999999999998 21.095 75-79 22.770000000000003 29.244999999999997 26.634999999999998 21.349999999999998 80-84 23.18 27.55 27.38 21.89 85-89 23.02 28.189999999999998 27.35 21.44 90-94 23.255 27.71 28.215 20.82 95-99 23.01 27.384999999999998 27.975 21.63 100-104 23.494999999999997 27.534999999999997 27.68 21.29 105-109 23.455000000000002 27.38 28.565 20.599999999999998 110-114 23.335 27.22 28.015 21.43 115-119 23.46 27.775 28.105000000000004 20.66 120-124 23.345 28.01 28.18 20.465 125-129 23.805 27.565 27.655 20.974999999999998 130-134 23.925 27.6 27.779999999999998 20.695 135-139 23.775 27.229999999999997 27.955000000000002 21.04 140-144 23.87 27.42 27.224999999999998 21.485000000000003 145-149 24.57 28.38 26.915 20.135 150-151 25.374999999999996 27.875 26.3625 20.3875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 1.0 21 1.5 22 2.5 23 2.5 24 1.5 25 1.5 26 5.5 27 7.0 28 6.0 29 8.5 30 11.5 31 15.5 32 29.5 33 44.5 34 50.0 35 68.0 36 95.5 37 122.0 38 137.0 39 157.0 40 201.5 41 222.0 42 225.5 43 265.5 44 295.0 45 293.5 46 256.5 47 233.0 48 236.5 49 210.0 50 173.5 51 126.5 52 99.0 53 93.5 54 82.0 55 67.0 56 45.5 57 30.5 58 19.5 59 9.5 60 16.0 61 13.0 62 4.5 63 3.0 64 1.0 65 0.5 66 0.0 67 0.5 68 0.5 69 0.0 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.5 93 0.5 94 0.0 95 0.0 96 0.0 97 0.5 98 0.5 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 84.0 #Duplication Level Percentage of deduplicated Percentage of total 1 84.91071428571428 71.325 2 11.964285714285715 20.1 3 2.5 6.3 4 0.4761904761904762 1.6 5 0.08928571428571429 0.375 6 0.05952380952380953 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAGAACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 6 0.15 No Hit AGAACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 6 0.15 No Hit GATTGCTATGTGATGGCATCGTATGCACGGTTTCTTTGGGACGCTGAAGA 5 0.125 No Hit GGCCAAAGAGACCCAGAGGGAAGGAGAGAAATGAGTCCCCATCTTCTTCT 5 0.125 No Hit CGCAGCCTTGAAGAAGTACATGATTGAGAACAGCCTTGCCAGTGAAGCAG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.16249999999999998 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88-89 0.325 0.0 0.0 0.0 0.0 90-91 0.3625 0.0 0.0 0.0 0.0 92-93 0.3875 0.0 0.0 0.0 0.0 94-95 0.4375 0.0 0.0 0.0 0.0 96-97 0.525 0.0 0.0 0.0 0.0 98-99 0.625 0.0 0.0 0.0 0.0 100-101 0.725 0.0 0.0 0.0 0.0 102-103 0.825 0.0 0.0 0.0 0.0 104-105 0.9125000000000001 0.0 0.0 0.0 0.0 106-107 1.0375 0.0 0.0 0.0 0.0 108-109 1.1375 0.0 0.0 0.0 0.0 110-111 1.1625 0.0 0.0 0.0 0.0 112-113 1.275 0.0 0.0 0.0 0.0 114-115 1.35 0.0 0.0 0.0 0.0 116-117 1.4125 0.0 0.0 0.0 0.0 118-119 1.475 0.0 0.0 0.0 0.0 120-121 1.5875 0.0 0.0 0.0 0.0 122-123 1.6625 0.0 0.0 0.0 0.0 124-125 1.8 0.0 0.0 0.0 0.0 126-127 1.8875000000000002 0.0 0.0 0.0 0.0 128-129 1.975 0.0 0.0 0.0 0.0 130-131 2.1125 0.0 0.0 0.0 0.0 132-133 2.3499999999999996 0.0 0.0 0.0 0.0 134-135 2.5625 0.0 0.0 0.0 0.0 136-137 2.8 0.0 0.0 0.0 0.0 138-139 3.175 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTGTATG 10 0.006830828 145.0 9 GAAAACA 10 0.006830828 145.0 2 GGAAAAC 10 0.006830828 145.0 1 >>END_MODULE Read 1284581 spots for SRR12671331.sra Written 1284581 spots for SRR12671331.sra Read 1284581 spots for SRR12671331.sra Written 1284581 spots for SRR12671331.sra Read 1284581 spots for SRR12671331.sra Written 1284581 spots for SRR12671331.sra Read 1284581 spots for SRR12671331.sra Written 1284581 spots for SRR12671331.sra Read 1284581 spots for SRR12671331.sra Written 1284581 spots for SRR12671331.sra Read 1284581 spots for SRR12671331.sra Written 1284581 spots for SRR12671331.sra Read 1284581 spots for SRR12671331.sra Written 1284581 spots for SRR12671331.sra Read 1284581 spots for SRR12671331.sra Written 1284581 spots for SRR12671331.sra Read 1284581 spots for SRR12671331.sra Written 1284581 spots for SRR12671331.sra Read 1284581 spots for SRR12671331.sra Written 1284581 spots for SRR12671331.sra Read 1284581 spots for SRR12671331.sra Written 1284581 spots for SRR12671331.sra Read 1284581 spots for SRR12671331.sra Written 1284581 spots for SRR12671331.sra Read 1284598 spots for SRR12671331.sra Written 1284598 spots for SRR12671331.sra Read 1284581 spots for SRR12671331.sra Written 1284581 spots for SRR12671331.sra Read 1284581 spots for SRR12671331.sra Written 1284581 spots for SRR12671331.sra Read 1284581 spots for SRR12671331.sra Written 1284581 spots for SRR12671331.sra Read 1284581 spots for SRR12671331.sra Written 1284581 spots for SRR12671331.sra Read 1284581 spots for SRR12671331.sra Written 1284581 spots for SRR12671331.sra Read 1284581 spots for SRR12671331.sra Written 1284581 spots for SRR12671331.sra Read 1284581 spots for SRR12671331.sra Written 1284581 spots for SRR12671331.sra SRR ids: ['SRR12671331.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_r6cdfjwd SRR12671331.sra spots: 25691637 blocks: [[1, 1284581], [1284582, 2569162], [2569163, 3853743], [3853744, 5138324], [5138325, 6422905], [6422906, 7707486], [7707487, 8992067], [8992068, 10276648], [10276649, 11561229], [11561230, 12845810], [12845811, 14130391], [14130392, 15414972], [15414973, 16699553], [16699554, 17984134], [17984135, 19268715], [19268716, 20553296], [20553297, 21837877], [21837878, 23122458], [23122459, 24407039], [24407040, 25691637]] SRR12671331 file size 8709441 SRR12671331 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671331 SRR12671331_1.fastq SRR12671331_2.fastq Input file: SRR12671331_1.fastq Paired file: SRR12671331_2.fastq trimmed: SRR12671331-trimmed-pair1.fastq, SRR12671331-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 16:06:04 2025 >> started Tue Feb 11 16:06:34 2025 >> done (30.445s) 25691637 read pairs processed; of these: 187 ( 0.00%) short read pairs filtered out after trimming by size control 6437 ( 0.03%) empty read pairs filtered out after trimming by size control 25685013 (99.97%) read pairs available; of these: 1176378 ( 4.58%) trimmed read pairs available after processing 24508635 (95.42%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 15 0.00% 19 15 0.00% 20 24 0.00% 21 15 0.00% 22 26 0.00% 23 26 0.00% 24 22 0.00% 25 27 0.00% 26 29 0.00% 27 36 0.00% 28 24 0.00% 29 25 0.00% 30 24 0.00% 31 37 0.00% 32 40 0.00% 33 37 0.00% 34 39 0.00% 35 41 0.00% 36 42 0.00% 37 38 0.00% 38 42 0.00% 39 51 0.00% 40 29 0.00% 41 48 0.00% 42 46 0.00% 43 36 0.00% 44 44 0.00% 45 59 0.00% 46 46 0.00% 47 68 0.00% 48 78 0.00% 49 72 0.00% 50 81 0.00% 51 86 0.00% 52 107 0.00% 53 111 0.00% 54 109 0.00% 55 126 0.00% 56 152 0.00% 57 150 0.00% 58 163 0.00% 59 216 0.00% 60 265 0.00% 61 287 0.00% 62 319 0.00% 63 339 0.00% 64 373 0.00% 65 419 0.00% 66 411 0.00% 67 524 0.00% 68 530 0.00% 69 694 0.00% 70 743 0.00% 71 815 0.00% 72 911 0.00% 73 1060 0.00% 74 1195 0.00% 75 1329 0.01% 76 1508 0.01% 77 1606 0.01% 78 1809 0.01% 79 1948 0.01% 80 2210 0.01% 81 2412 0.01% 82 2690 0.01% 83 2907 0.01% 84 3361 0.01% 85 3557 0.01% 86 3775 0.01% 87 4035 0.02% 88 4356 0.02% 89 4591 0.02% 90 5092 0.02% 91 5384 0.02% 92 5828 0.02% 93 6260 0.02% 94 6704 0.03% 95 7405 0.03% 96 7507 0.03% 97 7928 0.03% 98 8353 0.03% 99 8550 0.03% 100 9142 0.04% 101 9391 0.04% 102 9688 0.04% 103 10501 0.04% 104 10841 0.04% 105 11047 0.04% 106 11674 0.05% 107 12178 0.05% 108 12326 0.05% 109 12884 0.05% 110 13206 0.05% 111 13443 0.05% 112 14222 0.06% 113 14462 0.06% 114 14897 0.06% 115 15429 0.06% 116 15840 0.06% 117 16817 0.07% 118 16842 0.07% 119 17266 0.07% 120 17733 0.07% 121 18353 0.07% 122 18779 0.07% 123 19174 0.07% 124 19845 0.08% 125 20144 0.08% 126 20671 0.08% 127 21626 0.08% 128 22003 0.09% 129 22323 0.09% 130 22677 0.09% 131 23214 0.09% 132 23855 0.09% 133 24348 0.09% 134 24781 0.10% 135 24929 0.10% 136 25800 0.10% 137 26325 0.10% 138 26956 0.10% 139 27639 0.11% 140 28294 0.11% 141 28709 0.11% 142 29229 0.11% 143 29635 0.12% 144 29991 0.12% 145 31143 0.12% 146 31538 0.12% 147 31681 0.12% 148 32987 0.13% 149 33034 0.13% 150 34374 0.13% 151 24508635 95.42% 25685013 reads passed initial QC criterion=sequence-density sequence-density=0.44 sequence-density-rank=1 fanout-score=2.18 fanout-score-rank=30 prefix-density=0.46 prefix-fanout=2.1 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=38 fanout-score=100.43 fanout-score-rank=1 prefix-density=0.22 prefix-fanout=3.9 sequence=ATCAAGCTTCCGATTAAAGATACATAATTCCATGGAATGGAACCAACAAAGCAGCAGGAAATACAAGACACTTACAGATTACTAGCCATCAAATGAGATCCTGTAGAAAGGATTTGAGGAGGCCATGGCTAGCTAACTGTACTTTAATTTACAGCAAATACTATATTAGACAAACATGGAGTGACCAGACTTCTTCTTTTTATTTATTATAGTTCCATAAAACTGCTTGGTTGGAGCCATGCGGCGACGTTTTCTCATTTGCAGGAGCATGGATCACAGGTGCAGTTTGATCCACATTTGCAGCCATTCTCAGCACCAAAGTTCATCTCAGAGCTCTCGTAGAACATCCTAACTGGAGCTACACCAGCAATGATTGTCTGACTTGTGGTGGTCTCGGAGAAACTCAAGTCTGGGTACATGCTGCATCCATTGCAGCCACTGCCGCACTTGCA criterion=sequence-density sequence-density=0.65 sequence-density-rank=1 fanout-score=2.04 fanout-score-rank=35 prefix-density=0.65 prefix-fanout=2.0 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGG criterion=fanout-score sequence-density=0.07 sequence-density-rank=30 fanout-score=60.11 fanout-score-rank=1 prefix-density=0.40 prefix-fanout=10.7 sequence=AGAAAAGAAAACAGATTATCAAGCTTACTAGAATTATGGAAGGAATGAGTGTGGAGAACATGCACAAGATAGTGGTGGCAGTGGATGAGAGTGAGGAGAGCATGCATGCTCTTTCATGGTGTCTCAGCAACCTTATTTCTCACAACTCCACCGCCACGTTAGTCCTCCTCTAT SRR12671331 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 16:07:19 Started mapping on | Feb 11 16:07:20 Finished on | Feb 11 16:10:19 Mapping speed, Million of reads per hour | 516.57 Number of input reads | 25685013 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 23898314 Uniquely mapped reads % | 93.04% Average mapped length | 298.16 Number of splices: Total | 24298195 Number of splices: Annotated (sjdb) | 23816580 Number of splices: GT/AG | 23826568 Number of splices: GC/AG | 392149 Number of splices: AT/AC | 13651 Number of splices: Non-canonical | 65827 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.79 Insertion rate per base | 0.02% Insertion average length | 2.26 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 610092 % of reads mapped to multiple loci | 2.38% Number of reads mapped to too many loci | 77360 % of reads mapped to too many loci | 0.30% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.16% % of reads unmapped: other | 0.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1176607 1176607 1176607 N_multimapping 610092 610092 610092 N_noFeature 874491 23585255 973206 N_ambiguous 363941 1562 149039 UnstrandedReadsAssigned:22659882 PositiveStrandReadsAssigned:311497 NegativeStrandReadsAssigned:22776069 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671331 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671331-trimmed-pair1.fastq SRR12671331-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 25,685,013 reads, 22,778,989 reads pseudoaligned [quant] estimated average fragment length: 305.254 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,183 rounds 52401 SRR12671331.ke.tsv 34699 SRR12671331.se.tsv 87100 total ==> SRR12671331.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1713.75 901 21.6229 Potri.005G024800.1.v4.1 1035 730.746 448 25.2143 Potri.004G059700.1.v4.1 961 657.017 1 0.0625977 Potri.007G009000.2.v4.1 1416 1111.75 0 0 Potri.003G141000.2.v4.1 2943 2638.75 1474.04 22.9746 Potri.016G087400.1.v4.1 270 71.8194 1449 829.778 Potri.015G069301.1.v4.1 564 281.806 0 0 Potri.010G195200.1.v4.1 1773 1468.75 359 10.0527 Potri.012G127500.1.v4.1 977 672.859 101 6.17351 ==> SRR12671331.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 324 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 307 Potri.001G212900.v4.1 5 Potri.001G182400.v4.1 4 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 10 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 11 SRR12671331 completed mapping pipeline successfully