Starting /dee2/code/volunteer_pipeline.sh SRR12671332 current disk space = 3049782095872 free memory = 1442514604 SRR12671332 SRAfilesize b802ff61e8aba368bc7b0b363d12e856 SRR12671332.sra SRR12671332.sra file validated SRR12671332 is paired end SRR12671332 is conventional basespace SRR12671332 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671332_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.665 37.0 37.0 37.0 37.0 37.0 2 36.30775 37.0 37.0 37.0 37.0 37.0 3 36.585 37.0 37.0 37.0 37.0 37.0 4 36.621 37.0 37.0 37.0 37.0 37.0 5 36.622 37.0 37.0 37.0 37.0 37.0 6 36.6475 37.0 37.0 37.0 37.0 37.0 7 36.5235 37.0 37.0 37.0 37.0 37.0 8 36.6995 37.0 37.0 37.0 37.0 37.0 9 36.5725 37.0 37.0 37.0 37.0 37.0 10-14 36.6103 37.0 37.0 37.0 37.0 37.0 15-19 36.6289 37.0 37.0 37.0 37.0 37.0 20-24 36.6529 37.0 37.0 37.0 37.0 37.0 25-29 36.55669999999999 37.0 37.0 37.0 37.0 37.0 30-34 36.5559 37.0 37.0 37.0 37.0 37.0 35-39 36.539 37.0 37.0 37.0 37.0 37.0 40-44 36.47240000000001 37.0 37.0 37.0 37.0 37.0 45-49 36.4645 37.0 37.0 37.0 37.0 37.0 50-54 36.43300000000001 37.0 37.0 37.0 37.0 37.0 55-59 36.4557 37.0 37.0 37.0 37.0 37.0 60-64 36.397999999999996 37.0 37.0 37.0 37.0 37.0 65-69 36.3692 37.0 37.0 37.0 37.0 37.0 70-74 36.4514 37.0 37.0 37.0 37.0 37.0 75-79 36.3568 37.0 37.0 37.0 37.0 37.0 80-84 36.334199999999996 37.0 37.0 37.0 37.0 37.0 85-89 36.3013 37.0 37.0 37.0 37.0 37.0 90-94 36.3094 37.0 37.0 37.0 37.0 37.0 95-99 36.236900000000006 37.0 37.0 37.0 37.0 37.0 100-104 36.271699999999996 37.0 37.0 37.0 37.0 37.0 105-109 36.3006 37.0 37.0 37.0 37.0 37.0 110-114 36.2122 37.0 37.0 37.0 37.0 37.0 115-119 36.2039 37.0 37.0 37.0 37.0 37.0 120-124 36.1571 37.0 37.0 37.0 37.0 37.0 125-129 36.1568 37.0 37.0 37.0 37.0 37.0 130-134 36.087 37.0 37.0 37.0 37.0 37.0 135-139 36.078500000000005 37.0 37.0 37.0 37.0 37.0 140-144 35.994800000000005 37.0 37.0 37.0 37.0 37.0 145-149 35.974900000000005 37.0 37.0 37.0 37.0 37.0 150-151 35.85725 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 3.0 24 1.0 25 3.0 26 8.0 27 11.0 28 9.0 29 13.0 30 12.0 31 31.0 32 36.0 33 63.0 34 87.0 35 263.0 36 3002.0 37 458.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 53.77499999999999 10.825 4.675 30.725 2 22.95164119268354 12.603357554497618 34.47757454272112 29.967426710097723 3 18.8 20.1 28.125 32.975 4 24.675 27.0 22.875 25.45 5 24.2 31.8 24.575 19.425 6 19.575 35.5 23.225 21.7 7 14.424999999999999 26.075 43.675000000000004 15.825 8 16.725 24.7 31.8 26.775 9 16.725 22.975 34.025 26.275 10-14 19.375 30.34 27.505000000000003 22.78 15-19 19.86 28.315 28.255000000000003 23.57 20-24 20.565 28.355000000000004 27.485 23.595 25-29 19.2 28.27 27.529999999999998 25.0 30-34 20.979999999999997 28.735 27.305 22.98 35-39 20.45 28.515 27.265 23.77 40-44 20.275000000000002 29.189999999999998 27.165 23.369999999999997 45-49 20.4 28.4 27.11 24.09 50-54 20.51 27.815 27.694999999999997 23.98 55-59 20.72 28.384999999999998 27.705000000000002 23.189999999999998 60-64 20.75 28.07 26.784999999999997 24.395 65-69 20.405 27.994999999999997 28.23 23.369999999999997 70-74 20.32 28.749999999999996 27.055 23.875 75-79 19.96 28.499999999999996 27.68 23.86 80-84 20.45 28.155 27.084999999999997 24.310000000000002 85-89 20.285 29.56 26.784999999999997 23.369999999999997 90-94 20.775 28.63 27.08 23.515 95-99 20.435 27.925 27.095000000000002 24.545 100-104 20.505000000000003 28.825 26.700000000000003 23.97 105-109 20.44 28.77 26.88 23.91 110-114 20.91 28.305000000000003 26.840000000000003 23.945 115-119 20.4 28.199999999999996 27.639999999999997 23.76 120-124 20.365 28.465 27.725 23.445 125-129 20.51 28.01 27.55 23.93 130-134 19.84 28.215 27.639999999999997 24.305 135-139 21.175 28.015 26.889999999999997 23.919999999999998 140-144 20.87 28.025 27.125 23.98 145-149 21.085 28.435 27.1 23.380000000000003 150-151 21.3125 28.225 26.8125 23.65 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 1.0 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 1.5 9 1.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 0.5 20 0.0 21 1.5 22 1.5 23 1.0 24 2.5 25 3.5 26 8.0 27 11.0 28 9.5 29 15.5 30 20.5 31 21.0 32 26.5 33 39.0 34 51.5 35 62.5 36 85.5 37 100.0 38 128.0 39 160.0 40 176.0 41 191.0 42 205.5 43 232.5 44 255.5 45 265.5 46 257.5 47 244.0 48 239.0 49 213.5 50 187.0 51 165.0 52 131.5 53 113.5 54 95.5 55 60.5 56 47.5 57 47.5 58 34.5 59 29.0 60 21.5 61 13.5 62 8.5 63 4.0 64 1.5 65 0.5 66 1.0 67 1.0 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.22499999999999998 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 83.25 #Duplication Level Percentage of deduplicated Percentage of total 1 83.6036036036036 69.6 2 13.333333333333334 22.2 3 2.5225225225225225 6.3 4 0.45045045045045046 1.5 5 0.06006006006006006 0.25 6 0.03003003003003003 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGTGCTTCATAGGTTTCTCTTTTTCTGCACCACTGTGATAACCCACATG 6 0.15 No Hit CCATTAACCAAAACTGACTCAAGCGTCTGCGATTCCAGTTTTGCCCTTTC 5 0.125 No Hit GGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.07500000000000001 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.16249999999999998 0.0 0.0 0.0 0.0 90-91 0.21250000000000002 0.0 0.0 0.0 0.0 92-93 0.2375 0.0 0.0 0.0 0.0 94-95 0.275 0.0 0.0 0.0 0.0 96-97 0.275 0.0 0.0 0.0 0.0 98-99 0.32499999999999996 0.0 0.0 0.0 0.0 100-101 0.4125 0.0 0.0 0.0 0.0 102-103 0.5 0.0 0.0 0.0 0.0 104-105 0.525 0.0 0.0 0.0 0.0 106-107 0.55 0.0 0.0 0.0 0.0 108-109 0.675 0.0 0.0 0.0 0.0 110-111 0.7 0.0 0.0 0.0 0.0 112-113 0.7625 0.0 0.0 0.0 0.0 114-115 0.925 0.0 0.0 0.0 0.0 116-117 0.9875 0.0 0.0 0.0 0.0 118-119 1.0499999999999998 0.0 0.0 0.0 0.0 120-121 1.125 0.0 0.0 0.0 0.0 122-123 1.1875 0.0 0.0 0.0 0.0 124-125 1.325 0.0 0.0 0.0 0.0 126-127 1.475 0.0 0.0 0.0 0.0 128-129 1.5875 0.0 0.0 0.0 0.0 130-131 1.75 0.0 0.0 0.0 0.0 132-133 1.85 0.0 0.0 0.0 0.0 134-135 1.975 0.0 0.0 0.0 0.0 136-137 2.0125 0.0 0.0 0.0 0.0 138-139 2.2125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACTTTCT 10 0.006830828 145.0 6 >>END_MODULE SRR12671332 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671332_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.235 37.0 37.0 37.0 37.0 37.0 2 36.0715 37.0 37.0 37.0 37.0 37.0 3 36.2405 37.0 37.0 37.0 37.0 37.0 4 36.2805 37.0 37.0 37.0 37.0 37.0 5 36.241 37.0 37.0 37.0 37.0 37.0 6 36.253 37.0 37.0 37.0 37.0 37.0 7 36.267 37.0 37.0 37.0 37.0 37.0 8 36.251 37.0 37.0 37.0 37.0 37.0 9 36.197 37.0 37.0 37.0 37.0 37.0 10-14 36.2319 37.0 37.0 37.0 37.0 37.0 15-19 36.295 37.0 37.0 37.0 37.0 37.0 20-24 36.216100000000004 37.0 37.0 37.0 37.0 37.0 25-29 36.1799 37.0 37.0 37.0 37.0 37.0 30-34 36.15089999999999 37.0 37.0 37.0 37.0 37.0 35-39 36.0764 37.0 37.0 37.0 37.0 37.0 40-44 36.1226 37.0 37.0 37.0 37.0 37.0 45-49 36.140100000000004 37.0 37.0 37.0 37.0 37.0 50-54 36.0654 37.0 37.0 37.0 37.0 37.0 55-59 36.0138 37.0 37.0 37.0 37.0 37.0 60-64 36.042199999999994 37.0 37.0 37.0 37.0 37.0 65-69 36.0205 37.0 37.0 37.0 37.0 37.0 70-74 36.006299999999996 37.0 37.0 37.0 37.0 37.0 75-79 35.957100000000004 37.0 37.0 37.0 37.0 37.0 80-84 35.9092 37.0 37.0 37.0 37.0 37.0 85-89 35.905899999999995 37.0 37.0 37.0 37.0 37.0 90-94 35.946600000000004 37.0 37.0 37.0 37.0 37.0 95-99 35.847500000000004 37.0 37.0 37.0 37.0 37.0 100-104 35.83239999999999 37.0 37.0 37.0 37.0 37.0 105-109 35.789199999999994 37.0 37.0 37.0 37.0 37.0 110-114 35.67719999999999 37.0 37.0 37.0 37.0 37.0 115-119 35.8366 37.0 37.0 37.0 37.0 37.0 120-124 35.7255 37.0 37.0 37.0 37.0 37.0 125-129 35.774899999999995 37.0 37.0 37.0 37.0 37.0 130-134 35.658 37.0 37.0 37.0 37.0 37.0 135-139 35.5732 37.0 37.0 37.0 37.0 37.0 140-144 35.668099999999995 37.0 37.0 37.0 37.0 37.0 145-149 35.635 37.0 37.0 37.0 37.0 37.0 150-151 35.41225 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 3.0 14 2.0 15 3.0 16 4.0 17 4.0 18 1.0 19 0.0 20 0.0 21 2.0 22 4.0 23 6.0 24 7.0 25 8.0 26 9.0 27 7.0 28 14.0 29 15.0 30 24.0 31 31.0 32 45.0 33 89.0 34 176.0 35 493.0 36 2775.0 37 277.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 48.725 24.125 7.95 19.2 2 26.575 25.374999999999996 32.1 15.950000000000001 3 20.974999999999998 26.85 34.125 18.05 4 25.55 35.0 20.974999999999998 18.475 5 24.15 39.800000000000004 20.525 15.525 6 20.45 40.725 21.375 17.45 7 19.425 22.775000000000002 38.025 19.775000000000002 8 20.200000000000003 24.4 28.849999999999998 26.55 9 22.650000000000002 24.7 28.225 24.425 10-14 23.26 29.404999999999998 26.56 20.775 15-19 23.150000000000002 27.555000000000003 27.61 21.685 20-24 22.89 29.265 26.63 21.215 25-29 23.189999999999998 28.735 26.900000000000002 21.175 30-34 23.01 28.595 27.345000000000002 21.05 35-39 23.445 28.470000000000002 27.224999999999998 20.86 40-44 23.064999999999998 27.889999999999997 27.935 21.11 45-49 22.82 28.865000000000002 27.450000000000003 20.865000000000002 50-54 23.105 28.110000000000003 27.175 21.61 55-59 23.28 28.225 27.134999999999998 21.36 60-64 23.07 27.675 27.785 21.47 65-69 22.735 27.67 28.1 21.495 70-74 23.150000000000002 27.384999999999998 27.37 22.095000000000002 75-79 23.345 27.99 27.189999999999998 21.475 80-84 23.585 28.67 26.775 20.97 85-89 23.215 27.855 26.935 21.995 90-94 23.400000000000002 27.85 27.6 21.15 95-99 23.41 28.325 27.015 21.25 100-104 24.165 27.96 27.305 20.57 105-109 23.169999999999998 27.275 28.444999999999997 21.11 110-114 23.565 27.395000000000003 28.08 20.96 115-119 23.330000000000002 27.825 28.185 20.66 120-124 24.08 28.53 26.945000000000004 20.445 125-129 23.735 28.134999999999998 27.500000000000004 20.630000000000003 130-134 24.26 27.785 27.435 20.52 135-139 24.349999999999998 27.71 26.974999999999998 20.965 140-144 24.38 28.015 27.42 20.185 145-149 24.36487297459492 27.925585117023406 27.275455091018202 20.43408681736347 150-151 24.075 27.5125 26.950000000000003 21.462500000000002 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.5 2 0.5 3 1.0 4 1.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.5 11 1.0 12 1.5 13 1.5 14 0.5 15 0.5 16 0.5 17 0.5 18 0.5 19 0.5 20 1.5 21 1.0 22 0.5 23 1.5 24 2.0 25 2.0 26 1.5 27 4.5 28 6.0 29 4.5 30 9.5 31 20.0 32 29.0 33 32.0 34 42.5 35 60.0 36 81.5 37 109.5 38 127.0 39 149.0 40 197.5 41 231.0 42 265.0 43 280.5 44 254.0 45 253.0 46 244.0 47 238.5 48 236.5 49 203.0 50 166.0 51 147.5 52 126.5 53 95.0 54 83.0 55 72.5 56 54.5 57 42.0 58 36.5 59 24.5 60 11.5 61 8.0 62 6.5 63 5.5 64 6.0 65 4.0 66 2.0 67 1.0 68 0.0 69 0.0 70 1.0 71 1.0 72 0.0 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.02 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 83.325 #Duplication Level Percentage of deduplicated Percentage of total 1 83.5883588358836 69.65 2 13.441344134413441 22.400000000000002 3 2.5502550255025502 6.375 4 0.3000300030003 1.0 5 0.06000600060006001 0.25 6 0.030003000300030006 0.15 7 0.030003000300030006 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 7 0.17500000000000002 No Hit GGTGGTTGTGGTGCTGTTCTTCGAGCAAAGAAGAAAGTGACTGTAAATGG 6 0.15 No Hit AGATCAATAAGTTCTAACCCAGGGAAAAACAGTAAGGATTGTCTGGAAGA 5 0.125 No Hit AGAGAGTTTTGAGACAATGCCTTGGTTGGCATTGCCATTGAAGGACAAGA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.07500000000000001 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.16249999999999998 0.0 0.0 0.0 0.0 90-91 0.21250000000000002 0.0 0.0 0.0 0.0 92-93 0.2375 0.0 0.0 0.0 0.0 94-95 0.275 0.0 0.0 0.0 0.0 96-97 0.275 0.0 0.0 0.0 0.0 98-99 0.32499999999999996 0.0 0.0 0.0 0.0 100-101 0.4125 0.0 0.0 0.0 0.0 102-103 0.5 0.0 0.0 0.0 0.0 104-105 0.525 0.0 0.0 0.0 0.0 106-107 0.55 0.0 0.0 0.0 0.0 108-109 0.675 0.0 0.0 0.0 0.0 110-111 0.7 0.0 0.0 0.0 0.0 112-113 0.7625 0.0 0.0 0.0 0.0 114-115 0.925 0.0 0.0 0.0 0.0 116-117 0.9875 0.0 0.0 0.0 0.0 118-119 1.0499999999999998 0.0 0.0 0.0 0.0 120-121 1.125 0.0 0.0 0.0 0.0 122-123 1.1875 0.0 0.0 0.0 0.0 124-125 1.325 0.0 0.0 0.0 0.0 126-127 1.475 0.0 0.0 0.0 0.0 128-129 1.5875 0.0 0.0 0.0 0.0 130-131 1.775 0.0 0.0 0.0 0.0 132-133 1.875 0.0 0.0 0.0 0.0 134-135 1.975 0.0 0.0 0.0 0.0 136-137 2.0125 0.0 0.0 0.0 0.0 138-139 2.2125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 924013 spots for SRR12671332.sra Written 924013 spots for SRR12671332.sra Read 924013 spots for SRR12671332.sra Written 924013 spots for SRR12671332.sra Read 924013 spots for SRR12671332.sra Written 924013 spots for SRR12671332.sra Read 924013 spots for SRR12671332.sra Written 924013 spots for SRR12671332.sra Read 924013 spots for SRR12671332.sra Written 924013 spots for SRR12671332.sra Read 924013 spots for SRR12671332.sra Written 924013 spots for SRR12671332.sra Read 924013 spots for SRR12671332.sra Written 924013 spots for SRR12671332.sra Read 924013 spots for SRR12671332.sra Written 924013 spots for SRR12671332.sra Read 924013 spots for SRR12671332.sra Written 924013 spots for SRR12671332.sra Read 924013 spots for SRR12671332.sra Written 924013 spots for SRR12671332.sra Read 924013 spots for SRR12671332.sra Written 924013 spots for SRR12671332.sra Read 924013 spots for SRR12671332.sra Written 924013 spots for SRR12671332.sra Read 924031 spots for SRR12671332.sra Written 924031 spots for SRR12671332.sra Read 924013 spots for SRR12671332.sra Written 924013 spots for SRR12671332.sra Read 924013 spots for SRR12671332.sra Written 924013 spots for SRR12671332.sra Read 924013 spots for SRR12671332.sra Written 924013 spots for SRR12671332.sra Read 924013 spots for SRR12671332.sra Written 924013 spots for SRR12671332.sra Read 924013 spots for SRR12671332.sra Written 924013 spots for SRR12671332.sra Read 924013 spots for SRR12671332.sra Written 924013 spots for SRR12671332.sra Read 924013 spots for SRR12671332.sra Written 924013 spots for SRR12671332.sra SRR ids: ['SRR12671332.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_zsi9_7jc SRR12671332.sra spots: 18480278 blocks: [[1, 924013], [924014, 1848026], [1848027, 2772039], [2772040, 3696052], [3696053, 4620065], [4620066, 5544078], [5544079, 6468091], [6468092, 7392104], [7392105, 8316117], [8316118, 9240130], [9240131, 10164143], [10164144, 11088156], [11088157, 12012169], [12012170, 12936182], [12936183, 13860195], [13860196, 14784208], [14784209, 15708221], [15708222, 16632234], [16632235, 17556247], [17556248, 18480278]] SRR12671332 file size 6258706 SRR12671332 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671332 SRR12671332_1.fastq SRR12671332_2.fastq Input file: SRR12671332_1.fastq Paired file: SRR12671332_2.fastq trimmed: SRR12671332-trimmed-pair1.fastq, SRR12671332-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 15:19:14 2025 >> started Tue Feb 11 15:19:35 2025 >> done (20.315s) 18480278 read pairs processed; of these: 65 ( 0.00%) short read pairs filtered out after trimming by size control 3468 ( 0.02%) empty read pairs filtered out after trimming by size control 18476745 (99.98%) read pairs available; of these: 624292 ( 3.38%) trimmed read pairs available after processing 17852453 (96.62%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 9 0.00% 20 11 0.00% 21 11 0.00% 22 6 0.00% 23 8 0.00% 24 14 0.00% 25 17 0.00% 26 17 0.00% 27 12 0.00% 28 17 0.00% 29 15 0.00% 30 18 0.00% 31 17 0.00% 32 21 0.00% 33 14 0.00% 34 23 0.00% 35 20 0.00% 36 18 0.00% 37 23 0.00% 38 31 0.00% 39 20 0.00% 40 19 0.00% 41 31 0.00% 42 33 0.00% 43 39 0.00% 44 36 0.00% 45 42 0.00% 46 35 0.00% 47 40 0.00% 48 40 0.00% 49 60 0.00% 50 61 0.00% 51 76 0.00% 52 89 0.00% 53 80 0.00% 54 72 0.00% 55 104 0.00% 56 120 0.00% 57 101 0.00% 58 144 0.00% 59 125 0.00% 60 178 0.00% 61 215 0.00% 62 236 0.00% 63 205 0.00% 64 257 0.00% 65 277 0.00% 66 312 0.00% 67 341 0.00% 68 410 0.00% 69 478 0.00% 70 497 0.00% 71 592 0.00% 72 675 0.00% 73 764 0.00% 74 764 0.00% 75 817 0.00% 76 972 0.01% 77 1033 0.01% 78 1119 0.01% 79 1197 0.01% 80 1383 0.01% 81 1520 0.01% 82 1678 0.01% 83 1797 0.01% 84 2002 0.01% 85 2053 0.01% 86 2120 0.01% 87 2428 0.01% 88 2489 0.01% 89 2606 0.01% 90 2827 0.02% 91 2965 0.02% 92 3183 0.02% 93 3383 0.02% 94 3568 0.02% 95 3777 0.02% 96 3921 0.02% 97 4135 0.02% 98 4264 0.02% 99 4426 0.02% 100 4610 0.02% 101 4549 0.02% 102 4902 0.03% 103 5120 0.03% 104 5439 0.03% 105 5551 0.03% 106 5738 0.03% 107 5944 0.03% 108 6268 0.03% 109 6278 0.03% 110 6482 0.04% 111 6858 0.04% 112 6931 0.04% 113 7246 0.04% 114 7358 0.04% 115 7651 0.04% 116 8085 0.04% 117 8481 0.05% 118 8770 0.05% 119 8805 0.05% 120 9152 0.05% 121 9253 0.05% 122 9416 0.05% 123 9847 0.05% 124 10130 0.05% 125 10054 0.05% 126 10725 0.06% 127 10880 0.06% 128 11170 0.06% 129 12034 0.07% 130 11744 0.06% 131 12107 0.07% 132 12636 0.07% 133 12702 0.07% 134 12898 0.07% 135 13583 0.07% 136 13546 0.07% 137 14158 0.08% 138 14409 0.08% 139 14946 0.08% 140 15027 0.08% 141 15439 0.08% 142 15763 0.09% 143 16217 0.09% 144 16704 0.09% 145 17011 0.09% 146 17386 0.09% 147 17923 0.10% 148 18530 0.10% 149 18631 0.10% 150 19648 0.11% 151 17852453 96.62% 18476745 reads passed initial QC criterion=sequence-density sequence-density=0.61 sequence-density-rank=1 fanout-score=1.96 fanout-score-rank=23 prefix-density=0.62 prefix-fanout=1.9 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=24 fanout-score=43.63 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=4.1 sequence=ACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCT criterion=sequence-density sequence-density=0.71 sequence-density-rank=1 fanout-score=2.03 fanout-score-rank=24 prefix-density=0.72 prefix-fanout=2.0 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=21.36 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=1.0 sequence=GCTACACAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTT SRR12671332 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 15:20:27 Started mapping on | Feb 11 15:20:27 Finished on | Feb 11 15:22:42 Mapping speed, Million of reads per hour | 492.71 Number of input reads | 18476745 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 16931403 Uniquely mapped reads % | 91.64% Average mapped length | 298.64 Number of splices: Total | 16286461 Number of splices: Annotated (sjdb) | 15969201 Number of splices: GT/AG | 15965636 Number of splices: GC/AG | 263866 Number of splices: AT/AC | 9710 Number of splices: Non-canonical | 47249 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.85 Insertion rate per base | 0.02% Insertion average length | 2.34 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 560069 % of reads mapped to multiple loci | 3.03% Number of reads mapped to too many loci | 30565 % of reads mapped to too many loci | 0.17% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.05% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 985273 985273 985273 N_multimapping 560069 560069 560069 N_noFeature 530395 16671545 618873 N_ambiguous 298336 1117 126205 UnstrandedReadsAssigned:16102672 PositiveStrandReadsAssigned:258741 NegativeStrandReadsAssigned:16186325 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671332 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671332-trimmed-pair1.fastq SRR12671332-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,476,745 reads, 16,186,509 reads pseudoaligned [quant] estimated average fragment length: 316.594 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,215 rounds 52401 SRR12671332.ke.tsv 34699 SRR12671332.se.tsv 87100 total ==> SRR12671332.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1702.41 600 19.5747 Potri.005G024800.1.v4.1 1035 719.406 190 14.6685 Potri.004G059700.1.v4.1 961 645.748 28 2.40825 Potri.007G009000.2.v4.1 1416 1100.41 0 0 Potri.003G141000.2.v4.1 2943 2627.41 677 14.311 Potri.016G087400.1.v4.1 270 66.6552 629 524.112 Potri.015G069301.1.v4.1 564 270.27 0 0 Potri.010G195200.1.v4.1 1773 1457.41 33 1.25759 Potri.012G127500.1.v4.1 977 661.615 477 40.0424 ==> SRR12671332.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 781 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 174 Potri.001G212900.v4.1 216 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 12 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 2 SRR12671332 completed mapping pipeline successfully