Starting /dee2/code/volunteer_pipeline.sh SRR12671334 current disk space = 3049084383232 free memory = 1458390948 SRR12671334 SRAfilesize aab71c775c4cf9694b47d33e279fb0ed SRR12671334.sra SRR12671334.sra file validated SRR12671334 is paired end SRR12671334 is conventional basespace SRR12671334 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671334_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.574 37.0 37.0 37.0 37.0 37.0 2 36.376 37.0 37.0 37.0 37.0 37.0 3 36.4785 37.0 37.0 37.0 37.0 37.0 4 36.616 37.0 37.0 37.0 37.0 37.0 5 36.563 37.0 37.0 37.0 37.0 37.0 6 36.5295 37.0 37.0 37.0 37.0 37.0 7 36.5335 37.0 37.0 37.0 37.0 37.0 8 36.551 37.0 37.0 37.0 37.0 37.0 9 36.537 37.0 37.0 37.0 37.0 37.0 10-14 36.645300000000006 37.0 37.0 37.0 37.0 37.0 15-19 36.55800000000001 37.0 37.0 37.0 37.0 37.0 20-24 36.5552 37.0 37.0 37.0 37.0 37.0 25-29 36.5209 37.0 37.0 37.0 37.0 37.0 30-34 36.499700000000004 37.0 37.0 37.0 37.0 37.0 35-39 36.4707 37.0 37.0 37.0 37.0 37.0 40-44 36.4578 37.0 37.0 37.0 37.0 37.0 45-49 36.359300000000005 37.0 37.0 37.0 37.0 37.0 50-54 36.3832 37.0 37.0 37.0 37.0 37.0 55-59 36.376999999999995 37.0 37.0 37.0 37.0 37.0 60-64 36.366 37.0 37.0 37.0 37.0 37.0 65-69 36.3328 37.0 37.0 37.0 37.0 37.0 70-74 36.3231 37.0 37.0 37.0 37.0 37.0 75-79 36.287699999999994 37.0 37.0 37.0 37.0 37.0 80-84 36.2501 37.0 37.0 37.0 37.0 37.0 85-89 36.2134 37.0 37.0 37.0 37.0 37.0 90-94 36.220299999999995 37.0 37.0 37.0 37.0 37.0 95-99 36.1683 37.0 37.0 37.0 37.0 37.0 100-104 36.2173 37.0 37.0 37.0 37.0 37.0 105-109 36.1404 37.0 37.0 37.0 37.0 37.0 110-114 36.0766 37.0 37.0 37.0 37.0 37.0 115-119 36.1195 37.0 37.0 37.0 37.0 37.0 120-124 36.0696 37.0 37.0 37.0 37.0 37.0 125-129 35.989200000000004 37.0 37.0 37.0 37.0 37.0 130-134 35.968 37.0 37.0 37.0 37.0 37.0 135-139 35.914699999999996 37.0 37.0 37.0 37.0 37.0 140-144 35.818400000000004 37.0 37.0 37.0 37.0 37.0 145-149 35.8514 37.0 37.0 37.0 37.0 37.0 150-151 35.81675 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 4.0 19 0.0 20 0.0 21 0.0 22 3.0 23 1.0 24 2.0 25 2.0 26 2.0 27 9.0 28 14.0 29 18.0 30 24.0 31 32.0 32 46.0 33 78.0 34 116.0 35 275.0 36 2920.0 37 454.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 50.4 12.275 6.25 31.075000000000003 2 21.403508771929825 12.130325814536342 35.91478696741854 30.55137844611529 3 19.35 17.349999999999998 28.7 34.599999999999994 4 23.95 25.924999999999997 23.025000000000002 27.1 5 24.0 32.475 23.925 19.6 6 20.5 34.0 23.05 22.45 7 15.0 27.775 42.075 15.15 8 16.025 25.974999999999998 31.95 26.05 9 17.525 23.7 34.125 24.65 10-14 19.68 30.345 27.79 22.185 15-19 19.85 28.299999999999997 27.85 24.0 20-24 20.21 27.694999999999997 28.804999999999996 23.29 25-29 20.16 28.065 27.58 24.195 30-34 19.814999999999998 28.64 27.99 23.555 35-39 20.79 28.215 27.67 23.325000000000003 40-44 20.5 28.560000000000002 27.58 23.36 45-49 20.315 28.525 27.944999999999997 23.215 50-54 20.115 28.125 28.050000000000004 23.71 55-59 19.68 28.76 28.310000000000002 23.25 60-64 20.19 28.465 27.785 23.56 65-69 20.335 28.355000000000004 27.639999999999997 23.669999999999998 70-74 20.615 29.205 26.919999999999998 23.26 75-79 20.59 28.33 27.775 23.305 80-84 20.349999999999998 29.165000000000003 27.125 23.36 85-89 20.665 28.58 27.439999999999998 23.315 90-94 20.16 27.889999999999997 28.03 23.919999999999998 95-99 20.4 28.595 27.744999999999997 23.26 100-104 20.75 28.01 27.965 23.275000000000002 105-109 20.49 28.07 27.88 23.56 110-114 20.47 28.625 27.560000000000002 23.345 115-119 20.474999999999998 28.59 27.54 23.395 120-124 20.549999999999997 28.12 27.224999999999998 24.104999999999997 125-129 20.46 28.065 27.66 23.815 130-134 21.21 28.585 26.974999999999998 23.23 135-139 20.79 27.855 28.1 23.255 140-144 20.9 28.17 27.279999999999998 23.65 145-149 20.325 28.4 27.025 24.25 150-151 20.7375 28.262500000000003 26.8375 24.1625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 1.0 4 1.0 5 0.5 6 1.0 7 0.5 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 1.5 18 1.5 19 1.5 20 2.0 21 0.5 22 0.5 23 1.0 24 3.0 25 5.0 26 5.0 27 5.5 28 9.0 29 11.5 30 18.0 31 30.5 32 38.5 33 49.0 34 57.5 35 63.0 36 88.5 37 115.5 38 123.0 39 145.5 40 181.5 41 209.0 42 221.5 43 251.5 44 280.5 45 273.0 46 244.0 47 240.0 48 254.5 49 203.0 50 172.0 51 150.0 52 108.0 53 95.5 54 79.0 55 68.0 56 51.5 57 37.0 58 28.0 59 19.0 60 18.5 61 14.0 62 7.5 63 3.0 64 1.0 65 2.0 66 1.5 67 0.5 68 0.0 69 0.0 70 0.0 71 0.0 72 1.0 73 1.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.25 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 82.475 #Duplication Level Percentage of deduplicated Percentage of total 1 83.60109123976963 68.95 2 12.943316156411033 21.349999999999998 3 2.5159139133070627 6.225 4 0.6365565322825099 2.1 5 0.2121855107608366 0.8750000000000001 6 0.06062443164595332 0.3 7 0.0 0.0 8 0.03031221582297666 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AAGTCTTCAACTGAATATATTCCAGCTTTGGTCAGCCTCTTGTGAAATGA 8 0.2 No Hit CCACATCCTTTGCAAGTGCCTTCCCTCTAGAATGCACCTGAAGAATCTTG 6 0.15 No Hit GTCAACACCAATACCACAGTAGTATGGTCCCTGAGGGCCAGGATAACCAC 6 0.15 No Hit GTCGTTTATCCATAGAAATACAATCACTTTATTTAACCATCCATCCACGA 5 0.125 No Hit CCTGAACCTTTGCAACCCAAAAACCTCACTGTAAGGCTGAAATGGAGTTG 5 0.125 No Hit GAATAGACCACCAAAACAAGAACATGGTCAAAATAAGTAACCACTACGAG 5 0.125 No Hit GTACGAGAACCAGCACAGCAACATTGTCCCTGATTAAAGAACAAAGCAAA 5 0.125 No Hit CTGGATCTAGCTTCCGTTGCCAGCCCTCAAGAACCAAGGTTGTGACCATG 5 0.125 No Hit TAAAAACACTGCCAAGTTTTGGGTACTCTTCACGAAGCATAACGATGGGT 5 0.125 No Hit CACTGCGACAACATCCTTCTAATGGTATTAAAGTGTGGGGAGAGGAGTTG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.21250000000000002 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.275 0.0 0.0 0.0 0.0 92-93 0.375 0.0 0.0 0.0 0.0 94-95 0.5 0.0 0.0 0.0 0.0 96-97 0.6000000000000001 0.0 0.0 0.0 0.0 98-99 0.6875 0.0 0.0 0.0 0.0 100-101 0.725 0.0 0.0 0.0 0.0 102-103 0.775 0.0 0.0 0.0 0.0 104-105 0.8125 0.0 0.0 0.0 0.0 106-107 0.9375 0.0 0.0 0.0 0.0 108-109 1.1 0.0 0.0 0.0 0.0 110-111 1.4625 0.0 0.0 0.0 0.0 112-113 1.7625 0.0 0.0 0.0 0.0 114-115 1.925 0.0 0.0 0.0 0.0 116-117 2.075 0.0 0.0 0.0 0.0 118-119 2.3125 0.0 0.0 0.0 0.0 120-121 2.5625 0.0 0.0 0.0 0.0 122-123 2.7874999999999996 0.0 0.0 0.0 0.0 124-125 3.175 0.0 0.0 0.0 0.0 126-127 3.2750000000000004 0.0 0.0 0.0 0.0 128-129 3.475 0.0 0.0 0.0 0.0 130-131 3.675 0.0 0.0 0.0 0.0 132-133 3.85 0.0 0.0 0.0 0.0 134-135 4.1625 0.0 0.0 0.0 0.0 136-137 4.4375 0.0 0.0 0.0 0.0 138-139 4.7125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTCATTT 10 0.006830828 145.0 1 CATCCAC 10 0.006830828 145.0 9 TCAGATG 10 0.006830828 145.0 2 TCTTCTG 10 0.006830828 145.0 9 GTCAGAT 10 0.006830828 145.0 1 GATGGTT 10 0.006830828 145.0 5 >>END_MODULE SRR12671334 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671334_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2265 37.0 37.0 37.0 37.0 37.0 2 36.0485 37.0 37.0 37.0 37.0 37.0 3 36.111 37.0 37.0 37.0 37.0 37.0 4 36.1055 37.0 37.0 37.0 37.0 37.0 5 36.268 37.0 37.0 37.0 37.0 37.0 6 36.2275 37.0 37.0 37.0 37.0 37.0 7 36.183 37.0 37.0 37.0 37.0 37.0 8 36.277 37.0 37.0 37.0 37.0 37.0 9 36.2125 37.0 37.0 37.0 37.0 37.0 10-14 36.2374 37.0 37.0 37.0 37.0 37.0 15-19 36.227199999999996 37.0 37.0 37.0 37.0 37.0 20-24 36.165800000000004 37.0 37.0 37.0 37.0 37.0 25-29 36.1558 37.0 37.0 37.0 37.0 37.0 30-34 36.1159 37.0 37.0 37.0 37.0 37.0 35-39 36.0753 37.0 37.0 37.0 37.0 37.0 40-44 35.9944 37.0 37.0 37.0 37.0 37.0 45-49 36.0726 37.0 37.0 37.0 37.0 37.0 50-54 36.0308 37.0 37.0 37.0 37.0 37.0 55-59 36.0084 37.0 37.0 37.0 37.0 37.0 60-64 35.978500000000004 37.0 37.0 37.0 37.0 37.0 65-69 36.0072 37.0 37.0 37.0 37.0 37.0 70-74 35.9229 37.0 37.0 37.0 37.0 37.0 75-79 35.9292 37.0 37.0 37.0 37.0 37.0 80-84 35.838 37.0 37.0 37.0 37.0 37.0 85-89 35.91629999999999 37.0 37.0 37.0 37.0 37.0 90-94 35.857299999999995 37.0 37.0 37.0 37.0 37.0 95-99 35.8349 37.0 37.0 37.0 37.0 37.0 100-104 35.754200000000004 37.0 37.0 37.0 37.0 37.0 105-109 35.6785 37.0 37.0 37.0 37.0 37.0 110-114 35.768600000000006 37.0 37.0 37.0 37.0 37.0 115-119 35.775600000000004 37.0 37.0 37.0 37.0 37.0 120-124 35.708800000000004 37.0 37.0 37.0 37.0 37.0 125-129 35.660700000000006 37.0 37.0 37.0 37.0 37.0 130-134 35.6245 37.0 37.0 37.0 37.0 37.0 135-139 35.510799999999996 37.0 37.0 37.0 37.0 37.0 140-144 35.5715 37.0 37.0 37.0 37.0 37.0 145-149 35.498 37.0 37.0 37.0 37.0 37.0 150-151 35.27475 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 2.0 14 0.0 15 3.0 16 3.0 17 3.0 18 2.0 19 3.0 20 2.0 21 2.0 22 9.0 23 3.0 24 5.0 25 7.0 26 8.0 27 16.0 28 17.0 29 23.0 30 36.0 31 35.0 32 61.0 33 82.0 34 168.0 35 486.0 36 2694.0 37 330.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.25 24.224999999999998 8.85 21.675 2 27.725 25.75 31.924999999999997 14.6 3 21.349999999999998 26.875 33.900000000000006 17.875 4 24.05 34.050000000000004 23.825 18.075 5 25.424999999999997 36.325 22.35 15.9 6 20.225 38.975 22.525000000000002 18.275 7 19.675 23.35 37.925 19.05 8 19.950000000000003 26.650000000000002 28.025 25.374999999999996 9 20.825 25.474999999999998 30.45 23.25 10-14 23.419999999999998 29.365000000000002 26.724999999999998 20.49 15-19 22.665 28.58 27.47 21.285 20-24 22.8 28.804999999999996 27.375 21.02 25-29 23.25 28.18 27.694999999999997 20.875 30-34 23.09 28.305000000000003 27.79 20.815 35-39 23.119999999999997 27.82 28.205000000000002 20.855 40-44 23.919999999999998 28.299999999999997 27.13 20.65 45-49 23.505000000000003 27.839999999999996 28.185 20.47 50-54 23.51 28.22 27.265 21.005 55-59 23.61 27.465 27.775 21.15 60-64 23.400000000000002 28.255000000000003 27.644999999999996 20.7 65-69 23.525 27.62 28.12 20.735 70-74 23.055 28.37 27.465 21.11 75-79 22.595000000000002 28.655 28.09 20.66 80-84 23.415 28.310000000000002 27.355 20.919999999999998 85-89 23.18 28.28 27.82 20.72 90-94 23.32 28.095 27.33 21.255 95-99 23.155 27.779999999999998 27.825 21.240000000000002 100-104 23.275000000000002 28.665000000000003 26.865 21.195 105-109 23.36 27.375 28.255000000000003 21.01 110-114 22.759999999999998 28.485 28.29 20.465 115-119 23.485 28.560000000000002 27.189999999999998 20.765 120-124 23.415 29.25 26.61 20.724999999999998 125-129 24.01 27.215 27.694999999999997 21.08 130-134 24.04 28.16 27.495000000000005 20.305 135-139 24.169999999999998 27.800000000000004 27.665 20.365 140-144 24.44 27.644999999999996 27.525 20.39 145-149 24.73494698939788 28.185637127425483 27.265453090618124 19.813962792558513 150-151 23.8625 28.249999999999996 27.450000000000003 20.4375 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 1.0 9 1.0 10 1.0 11 1.5 12 0.5 13 1.0 14 1.0 15 0.5 16 0.5 17 2.0 18 3.0 19 1.0 20 0.0 21 0.5 22 2.5 23 5.0 24 4.5 25 3.0 26 5.0 27 9.5 28 10.5 29 9.5 30 21.0 31 28.5 32 25.5 33 33.0 34 58.0 35 73.5 36 85.5 37 111.0 38 134.5 39 156.0 40 189.5 41 210.5 42 225.0 43 258.5 44 280.0 45 268.5 46 270.5 47 267.0 48 242.5 49 208.5 50 160.0 51 125.0 52 97.0 53 78.5 54 63.0 55 57.0 56 56.5 57 41.0 58 25.5 59 23.0 60 16.0 61 12.0 62 9.5 63 4.5 64 1.5 65 1.0 66 1.0 67 0.0 68 0.0 69 1.0 70 1.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 1.0 80 1.0 81 0.0 82 0.5 83 1.0 84 0.5 85 1.0 86 1.5 87 0.5 88 0.0 89 0.0 90 1.0 91 1.5 92 0.5 93 0.5 94 0.5 95 0.5 96 0.5 97 0.0 98 0.0 99 0.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.02 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 83.05 #Duplication Level Percentage of deduplicated Percentage of total 1 84.28657435279952 70.0 2 12.341962673088501 20.5 3 2.4683925346177005 6.15 4 0.6020469596628537 2.0 5 0.2408187838651415 1.0 6 0.030102347983142687 0.15 7 0.0 0.0 8 0.030102347983142687 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CAGATGCCTTCACCGTTAAGGATCACCGTGGAGAATTATACAAGAAGCAC 8 0.2 No Hit CTTTATTGATGAAATTGATGCGGTTGGGAGGCAGAGAGGGGCTGGACTTG 6 0.15 No Hit TCATGGACTAACAGTTCCAGCGGATGGTAATCACCATGTTCAAACATTGC 5 0.125 No Hit AGTCTATAAAGCCTAGTACTCCAGACCGCCCACTTTGGTATCCAGGAGCC 5 0.125 No Hit GCTACTTTTGAGAAAACAATGAGAAAGTGAAGAAAAAAAGAACACTTTGC 5 0.125 No Hit GGAAACAAAACCAGCACACCTCTGGATCCTACCTGATTTCCCACAGGTAA 5 0.125 No Hit ATGGTCTCAAAGATTTGGCGATTTCTACAAACCATCGAAGTTCTTGGAAG 5 0.125 No Hit GGAGCACTGCATAGCTTATAAGCTTGTAAGAGATGGCTTCCTCCTCTATG 5 0.125 No Hit GACGTTACAAATTGATCAAGCAGTTTACTCTTCAGCAGCAGGAAACAATT 5 0.125 No Hit AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.21250000000000002 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.275 0.0 0.0 0.0 0.0 92-93 0.375 0.0 0.0 0.0 0.0 94-95 0.5 0.0 0.0 0.0 0.0 96-97 0.575 0.0 0.0 0.0 0.0 98-99 0.6625000000000001 0.0 0.0 0.0 0.0 100-101 0.7 0.0 0.0 0.0 0.0 102-103 0.75 0.0 0.0 0.0 0.0 104-105 0.7875000000000001 0.0 0.0 0.0 0.0 106-107 0.9125000000000001 0.0 0.0 0.0 0.0 108-109 1.075 0.0 0.0 0.0 0.0 110-111 1.4375 0.0 0.0 0.0 0.0 112-113 1.7375 0.0 0.0 0.0 0.0 114-115 1.9125 0.0 0.0 0.0 0.0 116-117 2.075 0.0 0.0 0.0 0.0 118-119 2.3125 0.0 0.0 0.0 0.0 120-121 2.5625 0.0 0.0 0.0 0.0 122-123 2.7874999999999996 0.0 0.0 0.0 0.0 124-125 3.175 0.0 0.0 0.0 0.0 126-127 3.2750000000000004 0.0 0.0 0.0 0.0 128-129 3.475 0.0 0.0 0.0 0.0 130-131 3.675 0.0 0.0 0.0 0.0 132-133 3.875 0.0 0.0 0.0 0.0 134-135 4.1875 0.0 0.0 0.0 0.0 136-137 4.4625 0.0 0.0 0.0 0.0 138-139 4.7375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGTTGCG 10 0.006830828 145.0 6 TGCGCAC 10 0.006830828 145.0 9 GTTCAGC 10 0.006830828 145.0 1 TTGCGCA 10 0.006830828 145.0 8 ATATCTT 10 0.006830828 145.0 4 GTTGCGC 10 0.006830828 145.0 7 >>END_MODULE Read 809930 spots for SRR12671334.sra Written 809930 spots for SRR12671334.sra Read 809943 spots for SRR12671334.sra Written 809943 spots for SRR12671334.sra Read 809930 spots for SRR12671334.sra Written 809930 spots for SRR12671334.sra Read 809930 spots for SRR12671334.sra Written 809930 spots for SRR12671334.sra Read 809930 spots for SRR12671334.sra Written 809930 spots for SRR12671334.sra Read 809930 spots for SRR12671334.sra Written 809930 spots for SRR12671334.sra Read 809930 spots for SRR12671334.sra Written 809930 spots for SRR12671334.sra Read 809930 spots for SRR12671334.sra Written 809930 spots for SRR12671334.sra Read 809930 spots for SRR12671334.sra Written 809930 spots for SRR12671334.sra Read 809930 spots for SRR12671334.sra Written 809930 spots for SRR12671334.sra Read 809930 spots for SRR12671334.sra Written 809930 spots for SRR12671334.sra Read 809930 spots for SRR12671334.sra Written 809930 spots for SRR12671334.sra Read 809930 spots for SRR12671334.sra Written 809930 spots for SRR12671334.sra Read 809930 spots for SRR12671334.sra Written 809930 spots for SRR12671334.sra Read 809930 spots for SRR12671334.sra Written 809930 spots for SRR12671334.sra Read 809930 spots for SRR12671334.sra Written 809930 spots for SRR12671334.sra Read 809930 spots for SRR12671334.sra Written 809930 spots for SRR12671334.sra Read 809930 spots for SRR12671334.sra Written 809930 spots for SRR12671334.sra Read 809930 spots for SRR12671334.sra Written 809930 spots for SRR12671334.sra Read 809930 spots for SRR12671334.sra Written 809930 spots for SRR12671334.sra SRR ids: ['SRR12671334.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_4nj77ati SRR12671334.sra spots: 16198613 blocks: [[1, 809930], [809931, 1619860], [1619861, 2429790], [2429791, 3239720], [3239721, 4049650], [4049651, 4859580], [4859581, 5669510], [5669511, 6479440], [6479441, 7289370], [7289371, 8099300], [8099301, 8909230], [8909231, 9719160], [9719161, 10529090], [10529091, 11339020], [11339021, 12148950], [12148951, 12958880], [12958881, 13768810], [13768811, 14578740], [14578741, 15388670], [15388671, 16198613]] SRR12671334 file size 5483297 SRR12671334 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671334 SRR12671334_1.fastq SRR12671334_2.fastq Input file: SRR12671334_1.fastq Paired file: SRR12671334_2.fastq trimmed: SRR12671334-trimmed-pair1.fastq, SRR12671334-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 16:15:56 2025 >> started Tue Feb 11 16:16:22 2025 >> done (25.324s) 16198613 read pairs processed; of these: 117 ( 0.00%) short read pairs filtered out after trimming by size control 7700 ( 0.05%) empty read pairs filtered out after trimming by size control 16190796 (99.95%) read pairs available; of these: 1064368 ( 6.57%) trimmed read pairs available after processing 15126428 (93.43%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 10 0.00% 20 19 0.00% 21 7 0.00% 22 9 0.00% 23 20 0.00% 24 19 0.00% 25 27 0.00% 26 21 0.00% 27 23 0.00% 28 17 0.00% 29 14 0.00% 30 21 0.00% 31 27 0.00% 32 36 0.00% 33 23 0.00% 34 16 0.00% 35 27 0.00% 36 44 0.00% 37 22 0.00% 38 23 0.00% 39 32 0.00% 40 33 0.00% 41 36 0.00% 42 33 0.00% 43 45 0.00% 44 52 0.00% 45 50 0.00% 46 44 0.00% 47 62 0.00% 48 53 0.00% 49 70 0.00% 50 71 0.00% 51 82 0.00% 52 121 0.00% 53 101 0.00% 54 119 0.00% 55 130 0.00% 56 118 0.00% 57 145 0.00% 58 174 0.00% 59 222 0.00% 60 301 0.00% 61 311 0.00% 62 348 0.00% 63 340 0.00% 64 423 0.00% 65 456 0.00% 66 498 0.00% 67 597 0.00% 68 705 0.00% 69 736 0.00% 70 826 0.01% 71 1013 0.01% 72 1132 0.01% 73 1319 0.01% 74 1406 0.01% 75 1547 0.01% 76 1652 0.01% 77 1825 0.01% 78 1982 0.01% 79 2131 0.01% 80 2471 0.02% 81 2648 0.02% 82 2886 0.02% 83 3223 0.02% 84 3548 0.02% 85 3793 0.02% 86 3958 0.02% 87 4317 0.03% 88 4353 0.03% 89 4669 0.03% 90 4984 0.03% 91 5118 0.03% 92 5448 0.03% 93 5914 0.04% 94 6257 0.04% 95 6616 0.04% 96 7142 0.04% 97 7399 0.05% 98 7590 0.05% 99 7840 0.05% 100 8169 0.05% 101 8342 0.05% 102 8758 0.05% 103 9050 0.06% 104 9493 0.06% 105 9803 0.06% 106 10254 0.06% 107 10586 0.07% 108 10992 0.07% 109 11330 0.07% 110 11564 0.07% 111 11837 0.07% 112 12470 0.08% 113 12400 0.08% 114 12775 0.08% 115 13527 0.08% 116 14176 0.09% 117 14448 0.09% 118 15086 0.09% 119 15374 0.09% 120 15668 0.10% 121 15787 0.10% 122 16494 0.10% 123 16684 0.10% 124 17419 0.11% 125 17950 0.11% 126 18721 0.12% 127 19052 0.12% 128 19666 0.12% 129 19878 0.12% 130 20665 0.13% 131 21135 0.13% 132 21427 0.13% 133 21625 0.13% 134 21762 0.13% 135 22517 0.14% 136 23050 0.14% 137 24032 0.15% 138 24393 0.15% 139 25259 0.16% 140 25812 0.16% 141 25748 0.16% 142 26634 0.16% 143 26508 0.16% 144 27320 0.17% 145 27804 0.17% 146 28314 0.17% 147 29162 0.18% 148 30119 0.19% 149 29962 0.19% 150 31419 0.19% 151 15126428 93.43% 16190796 reads passed initial QC criterion=sequence-density sequence-density=0.44 sequence-density-rank=1 fanout-score=1.96 fanout-score-rank=25 prefix-density=0.45 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTTCGAGCGAAGAAGGT criterion=fanout-score sequence-density=0.02 sequence-density-rank=26 fanout-score=13.44 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=2.6 sequence=ATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTC criterion=sequence-density sequence-density=0.57 sequence-density-rank=1 fanout-score=2.19 fanout-score-rank=28 prefix-density=0.58 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.04 sequence-density-rank=32 fanout-score=182.17 fanout-score-rank=1 prefix-density=0.31 prefix-fanout=22.9 sequence=AGAGAGAGAGACAGAGAGAATGGCCACCACAGCAGCCCTCTCCAGCGCCATGGTCAGCACATCGTTTACTCGCCGGGTGCCAGTGACAAGCCTACGGGCACTTCCCAACGTGGGGGAGTCTCTTCTTGGCTTGAAAGCCAGTCGAGGAGGACGTGTTAAAGCAATGGCAG SRR12671334 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 16:17:14 Started mapping on | Feb 11 16:17:14 Finished on | Feb 11 16:21:17 Mapping speed, Million of reads per hour | 239.86 Number of input reads | 16190796 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 15019269 Uniquely mapped reads % | 92.76% Average mapped length | 297.18 Number of splices: Total | 14716673 Number of splices: Annotated (sjdb) | 14398289 Number of splices: GT/AG | 14423369 Number of splices: GC/AG | 242450 Number of splices: AT/AC | 8720 Number of splices: Non-canonical | 42134 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.75 Insertion rate per base | 0.03% Insertion average length | 2.13 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 385672 % of reads mapped to multiple loci | 2.38% Number of reads mapped to too many loci | 27288 % of reads mapped to too many loci | 0.17% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.58% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 785855 785855 785855 N_multimapping 385672 385672 385672 N_noFeature 599959 14803253 694539 N_ambiguous 223507 1053 101411 UnstrandedReadsAssigned:14195803 PositiveStrandReadsAssigned:214963 NegativeStrandReadsAssigned:14223319 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671334 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671334-trimmed-pair1.fastq SRR12671334-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,190,796 reads, 14,214,319 reads pseudoaligned [quant] estimated average fragment length: 287.28 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,199 rounds 52401 SRR12671334.ke.tsv 34699 SRR12671334.se.tsv 87100 total ==> SRR12671334.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1731.72 437 18.1764 Potri.005G024800.1.v4.1 1035 748.72 189 18.1822 Potri.004G059700.1.v4.1 961 675.018 0 0 Potri.007G009000.2.v4.1 1416 1129.72 0 0 Potri.003G141000.2.v4.1 2943 2656.72 678.407 18.3929 Potri.016G087400.1.v4.1 270 76.8634 489 458.241 Potri.015G069301.1.v4.1 564 297.673 0 0 Potri.010G195200.1.v4.1 1773 1486.72 112 5.42617 Potri.012G127500.1.v4.1 977 690.898 103 10.7381 ==> SRR12671334.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 203 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 170 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 4 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR12671334 completed mapping pipeline successfully