Starting /dee2/code/volunteer_pipeline.sh SRR12671335 current disk space = 3048322891776 free memory = 1482411996 SRR12671335 SRAfilesize a2588331c65ac2d58154404bfa1ecae3 SRR12671335.sra SRR12671335.sra file validated SRR12671335 is paired end SRR12671335 is conventional basespace SRR12671335 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671335_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.6205 37.0 37.0 37.0 37.0 37.0 2 36.41375 37.0 37.0 37.0 37.0 37.0 3 36.6595 37.0 37.0 37.0 37.0 37.0 4 36.661 37.0 37.0 37.0 37.0 37.0 5 36.6685 37.0 37.0 37.0 37.0 37.0 6 36.6645 37.0 37.0 37.0 37.0 37.0 7 36.491 37.0 37.0 37.0 37.0 37.0 8 36.6165 37.0 37.0 37.0 37.0 37.0 9 36.669 37.0 37.0 37.0 37.0 37.0 10-14 36.618700000000004 37.0 37.0 37.0 37.0 37.0 15-19 36.5897 37.0 37.0 37.0 37.0 37.0 20-24 36.5859 37.0 37.0 37.0 37.0 37.0 25-29 36.5261 37.0 37.0 37.0 37.0 37.0 30-34 36.483799999999995 37.0 37.0 37.0 37.0 37.0 35-39 36.5395 37.0 37.0 37.0 37.0 37.0 40-44 36.486900000000006 37.0 37.0 37.0 37.0 37.0 45-49 36.45399999999999 37.0 37.0 37.0 37.0 37.0 50-54 36.4422 37.0 37.0 37.0 37.0 37.0 55-59 36.367200000000004 37.0 37.0 37.0 37.0 37.0 60-64 36.3894 37.0 37.0 37.0 37.0 37.0 65-69 36.3701 37.0 37.0 37.0 37.0 37.0 70-74 36.310700000000004 37.0 37.0 37.0 37.0 37.0 75-79 36.368700000000004 37.0 37.0 37.0 37.0 37.0 80-84 36.315200000000004 37.0 37.0 37.0 37.0 37.0 85-89 36.3089 37.0 37.0 37.0 37.0 37.0 90-94 36.2694 37.0 37.0 37.0 37.0 37.0 95-99 36.2626 37.0 37.0 37.0 37.0 37.0 100-104 36.2267 37.0 37.0 37.0 37.0 37.0 105-109 36.2975 37.0 37.0 37.0 37.0 37.0 110-114 36.188100000000006 37.0 37.0 37.0 37.0 37.0 115-119 36.1746 37.0 37.0 37.0 37.0 37.0 120-124 36.1167 37.0 37.0 37.0 37.0 37.0 125-129 36.05970000000001 37.0 37.0 37.0 37.0 37.0 130-134 36.019 37.0 37.0 37.0 37.0 37.0 135-139 36.0596 37.0 37.0 37.0 37.0 37.0 140-144 35.9413 37.0 37.0 37.0 37.0 37.0 145-149 36.00019999999999 37.0 37.0 37.0 37.0 37.0 150-151 35.90425 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 2.0 21 1.0 22 1.0 23 3.0 24 2.0 25 3.0 26 6.0 27 3.0 28 15.0 29 14.0 30 22.0 31 24.0 32 51.0 33 62.0 34 109.0 35 240.0 36 2917.0 37 525.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.574999999999996 11.600000000000001 6.0 37.824999999999996 2 19.32815241915267 11.506643268989722 37.97944346954124 31.18576084231637 3 17.349999999999998 16.425 26.8 39.425 4 22.95 22.95 22.525000000000002 31.574999999999996 5 24.0 30.225 25.074999999999996 20.7 6 18.9 33.300000000000004 24.825 22.975 7 14.924999999999999 27.925 40.65 16.5 8 15.575 26.85 34.325 23.25 9 16.85 23.325000000000003 34.625 25.2 10-14 19.515 30.56 27.91 22.015 15-19 19.400000000000002 28.560000000000002 28.62 23.419999999999998 20-24 19.63 28.82 27.445000000000004 24.104999999999997 25-29 19.71 29.505 27.345000000000002 23.44 30-34 19.86 29.494999999999997 27.395000000000003 23.25 35-39 20.02 28.825 27.57 23.585 40-44 19.865 29.13 27.255000000000003 23.75 45-49 19.775000000000002 28.88 27.505000000000003 23.84 50-54 20.345 28.535 27.375 23.745 55-59 20.52 28.675 27.345000000000002 23.46 60-64 19.950000000000003 29.060000000000002 27.005000000000003 23.985 65-69 20.155 28.785 27.21 23.849999999999998 70-74 20.674999999999997 28.565 26.99 23.77 75-79 20.135 27.915 27.500000000000004 24.45 80-84 20.599999999999998 28.189999999999998 27.66 23.549999999999997 85-89 20.485 28.675 26.87 23.97 90-94 21.035 28.055000000000003 27.115000000000002 23.794999999999998 95-99 20.29 28.54 27.595 23.575 100-104 20.76 27.665 27.450000000000003 24.125 105-109 20.415 28.37 27.175 24.04 110-114 21.29 28.444999999999997 26.974999999999998 23.29 115-119 20.355 28.505000000000003 26.640000000000004 24.5 120-124 21.38 28.194999999999997 26.889999999999997 23.535 125-129 20.39 28.634999999999998 26.590000000000003 24.385 130-134 20.755000000000003 28.48 26.8 23.965 135-139 21.09 27.935 26.845000000000002 24.13 140-144 20.7 27.905 27.084999999999997 24.310000000000002 145-149 20.47 28.310000000000002 26.66 24.560000000000002 150-151 20.3 28.1375 26.8375 24.725 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.5 4 0.5 5 0.0 6 0.5 7 0.5 8 0.0 9 0.5 10 0.5 11 0.0 12 0.5 13 0.5 14 1.0 15 1.5 16 0.5 17 0.0 18 0.5 19 1.5 20 3.0 21 2.5 22 3.0 23 4.0 24 1.5 25 2.5 26 6.5 27 10.0 28 12.0 29 15.0 30 22.0 31 26.5 32 30.5 33 42.5 34 66.0 35 79.5 36 95.5 37 123.0 38 135.0 39 146.0 40 177.0 41 208.5 42 226.0 43 239.0 44 226.5 45 221.5 46 239.0 47 244.5 48 226.5 49 206.0 50 190.5 51 158.0 52 124.5 53 96.0 54 75.5 55 68.0 56 61.5 57 50.0 58 37.5 59 25.5 60 18.0 61 12.5 62 6.5 63 5.5 64 5.5 65 6.5 66 5.0 67 0.5 68 1.0 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.27499999999999997 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 83.025 #Duplication Level Percentage of deduplicated Percentage of total 1 83.76994881059922 69.55 2 13.038241493526046 21.65 3 2.5293586269196027 6.3 4 0.4215597711532671 1.4000000000000001 5 0.12044564890093346 0.5 6 0.12044564890093346 0.6 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCGCATCTAGCCCGGATTCTGACTTAGAGGCGTTCAGTCATAATCCAAC 6 0.15 No Hit GACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTG 6 0.15 No Hit GCACTCTTTGACTCTCTTTTCAAAGTCCTTTTCATCTTTCCCTCGCGGTA 6 0.15 No Hit GCCAGCAATTCTGTAACCCTCAACGGCACCCATCAAGACCACCTGTGTAG 6 0.15 No Hit GATCGGAAGAGCACACGTCTGAACTCCAGTCACGCTATCCTATCTCGTAT 5 0.125 TruSeq Adapter, Index 6 (97% over 37bp) GGGTAGGTTAGCAAGTGTCCAAGGGACACGTTCACTGCCTCCTTTTCACA 5 0.125 No Hit AGAAAGTGCTTCTCCTTACACACCCACAAGCCTAGAAAAGGAATTAGAAT 5 0.125 No Hit GTGTAAACAAGAAGTGCACCTCCTGCAAGGATTCCAGCTAGGGTAACAGC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.21250000000000002 0.0 0.0 0.0 0.0 92-93 0.275 0.0 0.0 0.0 0.0 94-95 0.2875 0.0 0.0 0.0 0.0 96-97 0.4 0.0 0.0 0.0 0.0 98-99 0.45 0.0 0.0 0.0 0.0 100-101 0.5375000000000001 0.0 0.0 0.0 0.0 102-103 0.7125 0.0 0.0 0.0 0.0 104-105 0.875 0.0 0.0 0.0 0.0 106-107 1.075 0.0 0.0 0.0 0.0 108-109 1.2000000000000002 0.0 0.0 0.0 0.0 110-111 1.275 0.0 0.0 0.0 0.0 112-113 1.4375 0.0 0.0 0.0 0.0 114-115 1.7000000000000002 0.0 0.0 0.0 0.0 116-117 1.8875 0.0 0.0 0.0 0.0 118-119 2.1125 0.0 0.0 0.0 0.0 120-121 2.4625 0.0 0.0 0.0 0.0 122-123 2.825 0.0 0.0 0.0 0.0 124-125 3.2125 0.0 0.0 0.0 0.0 126-127 3.55 0.0 0.0 0.0 0.0 128-129 3.825 0.0 0.0 0.0 0.0 130-131 4.05 0.0 0.0 0.0 0.0 132-133 4.4 0.0 0.0 0.0 0.0 134-135 4.775 0.0 0.0 0.0 0.0 136-137 5.1 0.0 0.0 0.0 0.0 138-139 5.4625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AACTCCA 30 0.0014437955 24.166668 140-144 >>END_MODULE SRR12671335 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671335_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3535 37.0 37.0 37.0 37.0 37.0 2 36.1445 37.0 37.0 37.0 37.0 37.0 3 36.289 37.0 37.0 37.0 37.0 37.0 4 36.271 37.0 37.0 37.0 37.0 37.0 5 36.387 37.0 37.0 37.0 37.0 37.0 6 36.323 37.0 37.0 37.0 37.0 37.0 7 36.3435 37.0 37.0 37.0 37.0 37.0 8 36.327 37.0 37.0 37.0 37.0 37.0 9 36.372 37.0 37.0 37.0 37.0 37.0 10-14 36.3549 37.0 37.0 37.0 37.0 37.0 15-19 36.360400000000006 37.0 37.0 37.0 37.0 37.0 20-24 36.294399999999996 37.0 37.0 37.0 37.0 37.0 25-29 36.2867 37.0 37.0 37.0 37.0 37.0 30-34 36.2523 37.0 37.0 37.0 37.0 37.0 35-39 36.2575 37.0 37.0 37.0 37.0 37.0 40-44 36.1731 37.0 37.0 37.0 37.0 37.0 45-49 36.192899999999995 37.0 37.0 37.0 37.0 37.0 50-54 36.1282 37.0 37.0 37.0 37.0 37.0 55-59 36.137 37.0 37.0 37.0 37.0 37.0 60-64 36.1091 37.0 37.0 37.0 37.0 37.0 65-69 36.12519999999999 37.0 37.0 37.0 37.0 37.0 70-74 36.0467 37.0 37.0 37.0 37.0 37.0 75-79 36.052499999999995 37.0 37.0 37.0 37.0 37.0 80-84 36.0827 37.0 37.0 37.0 37.0 37.0 85-89 36.110699999999994 37.0 37.0 37.0 37.0 37.0 90-94 36.04600000000001 37.0 37.0 37.0 37.0 37.0 95-99 36.0125 37.0 37.0 37.0 37.0 37.0 100-104 35.9782 37.0 37.0 37.0 37.0 37.0 105-109 36.022200000000005 37.0 37.0 37.0 37.0 37.0 110-114 35.9347 37.0 37.0 37.0 37.0 37.0 115-119 35.96659999999999 37.0 37.0 37.0 37.0 37.0 120-124 35.9983 37.0 37.0 37.0 37.0 37.0 125-129 35.9126 37.0 37.0 37.0 37.0 37.0 130-134 35.78189999999999 37.0 37.0 37.0 37.0 37.0 135-139 35.7052 37.0 37.0 37.0 37.0 37.0 140-144 35.7076 37.0 37.0 37.0 37.0 37.0 145-149 35.6896 37.0 37.0 37.0 37.0 37.0 150-151 35.4535 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 2.0 14 3.0 15 3.0 16 1.0 17 2.0 18 1.0 19 1.0 20 2.0 21 3.0 22 6.0 23 3.0 24 3.0 25 2.0 26 8.0 27 13.0 28 10.0 29 21.0 30 18.0 31 31.0 32 51.0 33 58.0 34 152.0 35 396.0 36 2895.0 37 315.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.1 25.650000000000002 8.425 25.825 2 25.575 24.224999999999998 34.225 15.975 3 20.325 25.974999999999998 35.25 18.45 4 24.224999999999998 34.425 23.474999999999998 17.875 5 25.775 35.775 21.95 16.5 6 20.1 39.675 22.775000000000002 17.45 7 20.45 23.075000000000003 37.75 18.725 8 20.875 23.875 29.25 26.0 9 22.45 23.75 31.125000000000004 22.675 10-14 24.41 28.875 26.46 20.255000000000003 15-19 24.67 27.18 27.67 20.48 20-24 23.275000000000002 28.345 27.255000000000003 21.125 25-29 23.905 27.575 27.884999999999998 20.635 30-34 23.405 27.925 27.235 21.435000000000002 35-39 23.955000000000002 27.884999999999998 26.775 21.385 40-44 23.74 27.655 27.825 20.78 45-49 23.91 27.51 27.485 21.095 50-54 23.189999999999998 28.255000000000003 27.689999999999998 20.865000000000002 55-59 24.104999999999997 27.36 27.55 20.985 60-64 23.835 27.42 27.785 20.96 65-69 23.880000000000003 28.050000000000004 26.815 21.255 70-74 24.135 26.845000000000002 27.525 21.495 75-79 24.085 27.32 27.3 21.295 80-84 23.91 28.134999999999998 27.29 20.665 85-89 23.775 27.565 28.04 20.62 90-94 24.115000000000002 27.450000000000003 27.49 20.945 95-99 24.16 28.050000000000004 27.35 20.44 100-104 25.305 27.29 27.36 20.044999999999998 105-109 23.98 27.500000000000004 27.725 20.794999999999998 110-114 24.38 28.285 26.915 20.419999999999998 115-119 24.52 27.54 27.250000000000004 20.69 120-124 24.135 27.665 27.41 20.79 125-129 24.404999999999998 27.944999999999997 27.43 20.22 130-134 25.14 27.750000000000004 27.02 20.09 135-139 24.58 26.875 28.310000000000002 20.235 140-144 25.064999999999998 27.485 27.644999999999996 19.805 145-149 25.542554255425543 27.69276927692769 27.012701270127014 19.75197519751975 150-151 25.587500000000002 27.625 27.400000000000002 19.3875 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 1.0 6 0.5 7 0.5 8 1.0 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 0.5 17 0.0 18 0.0 19 0.5 20 1.5 21 2.0 22 2.0 23 4.0 24 4.5 25 4.5 26 4.0 27 6.0 28 11.5 29 11.5 30 11.0 31 15.5 32 24.5 33 32.5 34 45.5 35 67.0 36 80.5 37 86.5 38 116.5 39 149.5 40 162.5 41 194.0 42 246.5 43 271.5 44 273.5 45 268.0 46 245.5 47 244.5 48 241.5 49 222.5 50 184.5 51 142.0 52 120.0 53 106.5 54 100.5 55 75.5 56 46.0 57 35.0 58 27.0 59 26.5 60 25.0 61 11.0 62 6.0 63 6.5 64 4.5 65 1.5 66 0.0 67 2.0 68 5.0 69 3.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.5 81 0.5 82 0.5 83 0.5 84 0.5 85 1.0 86 0.5 87 0.0 88 0.0 89 0.0 90 1.5 91 1.5 92 0.0 93 0.0 94 0.0 95 0.5 96 0.5 97 0.5 98 1.0 99 0.5 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.01 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 83.375 #Duplication Level Percentage of deduplicated Percentage of total 1 84.19790104947526 70.19999999999999 2 12.383808095952025 20.65 3 2.8785607196401797 7.199999999999999 4 0.35982008995502246 1.2 5 0.17991004497751123 0.75 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTGCATAGCTTATAAGCTTGTAAGAGATGGCTTCCTCCTCTATGATCTCA 5 0.125 No Hit AAGTACCTGAGCGAGGCTTCTCTTGGTGAAGCCAATCAAGATTCCATTGA 5 0.125 No Hit ATTCCCGGGTTTGCCCGTCCCATGTGCTTGATTTCCAACCAGGGGAAGCT 5 0.125 No Hit AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 5 0.125 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 5 0.125 No Hit ATACGAACCGTGAAAGCGTGGCCTATCGATCCTTTAGACCTTCGGAATTT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.21250000000000002 0.0 0.0 0.0 0.0 92-93 0.275 0.0 0.0 0.0 0.0 94-95 0.2875 0.0 0.0 0.0 0.0 96-97 0.4 0.0 0.0 0.0 0.0 98-99 0.45 0.0 0.0 0.0 0.0 100-101 0.5375000000000001 0.0 0.0 0.0 0.0 102-103 0.7125 0.0 0.0 0.0 0.0 104-105 0.875 0.0 0.0 0.0 0.0 106-107 1.0625 0.0 0.0 0.0 0.0 108-109 1.1749999999999998 0.0 0.0 0.0 0.0 110-111 1.25 0.0 0.0 0.0 0.0 112-113 1.4125 0.0 0.0 0.0 0.0 114-115 1.6749999999999998 0.0 0.0 0.0 0.0 116-117 1.8625 0.0 0.0 0.0 0.0 118-119 2.0875 0.0 0.0 0.0 0.0 120-121 2.425 0.0 0.0 0.0 0.0 122-123 2.7875 0.0 0.0 0.0 0.0 124-125 3.2 0.0 0.0 0.0 0.0 126-127 3.55 0.0 0.0 0.0 0.0 128-129 3.825 0.0 0.0 0.0 0.0 130-131 4.025 0.0 0.0 0.0 0.0 132-133 4.375 0.0 0.0 0.0 0.0 134-135 4.75 0.0 0.0 0.0 0.0 136-137 5.0625 0.0 0.0 0.0 0.0 138-139 5.4125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAGCAGC 10 0.006830828 145.0 2 GTAGGGA 30 0.0014437955 24.166668 135-139 GAAAGAG 45 6.5511256E-4 19.333332 140-144 GGAAAGA 40 0.0076550315 18.125 140-144 >>END_MODULE Read 789979 spots for SRR12671335.sra Written 789979 spots for SRR12671335.sra Read 789979 spots for SRR12671335.sra Written 789979 spots for SRR12671335.sra Read 789979 spots for SRR12671335.sra Written 789979 spots for SRR12671335.sra Read 789979 spots for SRR12671335.sra Written 789979 spots for SRR12671335.sra Read 789985 spots for SRR12671335.sra Written 789985 spots for SRR12671335.sra Read 789979 spots for SRR12671335.sra Written 789979 spots for SRR12671335.sra Read 789979 spots for SRR12671335.sra Written 789979 spots for SRR12671335.sra Read 789979 spots for SRR12671335.sra Written 789979 spots for SRR12671335.sra Read 789979 spots for SRR12671335.sra Written 789979 spots for SRR12671335.sra Read 789979 spots for SRR12671335.sra Written 789979 spots for SRR12671335.sra Read 789979 spots for SRR12671335.sra Written 789979 spots for SRR12671335.sra Read 789979 spots for SRR12671335.sra Written 789979 spots for SRR12671335.sra Read 789979 spots for SRR12671335.sra Written 789979 spots for SRR12671335.sra Read 789979 spots for SRR12671335.sra Written 789979 spots for SRR12671335.sra Read 789979 spots for SRR12671335.sra Written 789979 spots for SRR12671335.sra Read 789979 spots for SRR12671335.sra Written 789979 spots for SRR12671335.sra Read 789979 spots for SRR12671335.sra Written 789979 spots for SRR12671335.sra Read 789979 spots for SRR12671335.sra Written 789979 spots for SRR12671335.sra Read 789979 spots for SRR12671335.sra Written 789979 spots for SRR12671335.sra Read 789979 spots for SRR12671335.sra Written 789979 spots for SRR12671335.sra SRR ids: ['SRR12671335.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_6v59dsc0 SRR12671335.sra spots: 15799586 blocks: [[1, 789979], [789980, 1579958], [1579959, 2369937], [2369938, 3159916], [3159917, 3949895], [3949896, 4739874], [4739875, 5529853], [5529854, 6319832], [6319833, 7109811], [7109812, 7899790], [7899791, 8689769], [8689770, 9479748], [9479749, 10269727], [10269728, 11059706], [11059707, 11849685], [11849686, 12639664], [12639665, 13429643], [13429644, 14219622], [14219623, 15009601], [15009602, 15799586]] SRR12671335 file size 5347690 SRR12671335 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671335 SRR12671335_1.fastq SRR12671335_2.fastq Input file: SRR12671335_1.fastq Paired file: SRR12671335_2.fastq trimmed: SRR12671335-trimmed-pair1.fastq, SRR12671335-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 17:09:42 2025 >> started Tue Feb 11 17:10:00 2025 >> done (17.681s) 15799586 read pairs processed; of these: 125 ( 0.00%) short read pairs filtered out after trimming by size control 10192 ( 0.06%) empty read pairs filtered out after trimming by size control 15789269 (99.93%) read pairs available; of these: 1342404 ( 8.50%) trimmed read pairs available after processing 14446865 (91.50%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 14 0.00% 20 13 0.00% 21 5 0.00% 22 17 0.00% 23 10 0.00% 24 15 0.00% 25 20 0.00% 26 17 0.00% 27 16 0.00% 28 22 0.00% 29 25 0.00% 30 19 0.00% 31 26 0.00% 32 19 0.00% 33 32 0.00% 34 26 0.00% 35 28 0.00% 36 24 0.00% 37 26 0.00% 38 28 0.00% 39 32 0.00% 40 39 0.00% 41 42 0.00% 42 37 0.00% 43 29 0.00% 44 38 0.00% 45 43 0.00% 46 46 0.00% 47 34 0.00% 48 66 0.00% 49 64 0.00% 50 92 0.00% 51 79 0.00% 52 99 0.00% 53 109 0.00% 54 71 0.00% 55 125 0.00% 56 113 0.00% 57 138 0.00% 58 181 0.00% 59 195 0.00% 60 210 0.00% 61 274 0.00% 62 283 0.00% 63 324 0.00% 64 353 0.00% 65 356 0.00% 66 443 0.00% 67 460 0.00% 68 569 0.00% 69 595 0.00% 70 696 0.00% 71 717 0.00% 72 883 0.01% 73 1087 0.01% 74 1076 0.01% 75 1259 0.01% 76 1413 0.01% 77 1567 0.01% 78 1700 0.01% 79 1854 0.01% 80 2008 0.01% 81 2343 0.01% 82 2637 0.02% 83 2942 0.02% 84 3190 0.02% 85 3535 0.02% 86 3866 0.02% 87 4137 0.03% 88 4453 0.03% 89 4541 0.03% 90 5056 0.03% 91 5442 0.03% 92 5782 0.04% 93 6263 0.04% 94 6954 0.04% 95 7347 0.05% 96 7753 0.05% 97 8228 0.05% 98 8578 0.05% 99 9117 0.06% 100 9571 0.06% 101 9840 0.06% 102 10411 0.07% 103 10686 0.07% 104 11589 0.07% 105 11726 0.07% 106 12808 0.08% 107 13369 0.08% 108 13553 0.09% 109 13948 0.09% 110 14544 0.09% 111 14871 0.09% 112 15535 0.10% 113 15709 0.10% 114 16658 0.11% 115 17294 0.11% 116 18227 0.12% 117 19052 0.12% 118 19125 0.12% 119 19817 0.13% 120 20336 0.13% 121 21178 0.13% 122 21031 0.13% 123 21601 0.14% 124 22738 0.14% 125 23052 0.15% 126 24079 0.15% 127 24751 0.16% 128 25514 0.16% 129 26274 0.17% 130 26907 0.17% 131 27121 0.17% 132 27386 0.17% 133 28006 0.18% 134 28293 0.18% 135 29838 0.19% 136 30350 0.19% 137 31128 0.20% 138 31805 0.20% 139 33350 0.21% 140 33468 0.21% 141 34378 0.22% 142 34660 0.22% 143 35215 0.22% 144 36139 0.23% 145 36366 0.23% 146 37147 0.24% 147 38264 0.24% 148 39742 0.25% 149 39848 0.25% 150 41736 0.26% 151 14446865 91.50% 15789269 reads passed initial QC criterion=sequence-density sequence-density=0.67 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=28 prefix-density=0.67 prefix-fanout=2.0 sequence=GTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGTTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTG criterion=fanout-score sequence-density=0.02 sequence-density-rank=29 fanout-score=207.20 fanout-score-rank=1 prefix-density=0.29 prefix-fanout=11.8 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTC criterion=sequence-density sequence-density=1.41 sequence-density-rank=1 fanout-score=1.95 fanout-score-rank=29 prefix-density=1.39 prefix-fanout=2.0 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=57.14 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=4.9 sequence=AAACCCAAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTCCTCCCCTTCGCTAGCCGGAAAGGCGGTGAAGCTCAACCCCTCCTCCTCTGAGATCATGGGCAATGGCCGTGTCTCCATGAGGAAAACCACCAAGCCTGTTCCCTCCGGGAGCCCATGGTACGGACCAGACCGTGTTAAATACTTGGGCCCGTTCTCTGGTGAGCCCCCATCCTACTTGACTGGTGAGTTCCCTGGTGACTACGGCTGGGACACTGCTGGCCTCTCTGCTGACCCAGAGACCTTTGCCAAGAACCGTGAGCTTGAAGTCATCCATTCCAGGTGGGCCATGCTTGGAGCTCTTGGATGCGTCTTCCCCGAGCTCTTGTCCCGCAACGGTGTCAAGTTCGGCGAGGCTGTATGGTTCAAGGCTGGAGCCCAGATCTTCAGCGAGGGTGGACTTGACTACTTGGGCAACCCAAGCTTGATCCACGCACAAAG SRR12671335 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 17:10:38 Started mapping on | Feb 11 17:10:39 Finished on | Feb 11 17:12:11 Mapping speed, Million of reads per hour | 617.84 Number of input reads | 15789269 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 14910303 Uniquely mapped reads % | 94.43% Average mapped length | 296.58 Number of splices: Total | 14474269 Number of splices: Annotated (sjdb) | 14209969 Number of splices: GT/AG | 14161241 Number of splices: GC/AG | 269927 Number of splices: AT/AC | 7664 Number of splices: Non-canonical | 35437 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.79 Insertion rate per base | 0.03% Insertion average length | 2.15 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 334607 % of reads mapped to multiple loci | 2.12% Number of reads mapped to too many loci | 70360 % of reads mapped to too many loci | 0.45% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.88% % of reads unmapped: other | 0.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 544359 544359 544359 N_multimapping 334607 334607 334607 N_noFeature 486590 14599270 572111 N_ambiguous 320644 1419 94560 UnstrandedReadsAssigned:14103069 PositiveStrandReadsAssigned:309614 NegativeStrandReadsAssigned:14243632 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671335 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671335-trimmed-pair1.fastq SRR12671335-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,789,269 reads, 14,192,583 reads pseudoaligned [quant] estimated average fragment length: 256.229 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,220 rounds 52401 SRR12671335.ke.tsv 34699 SRR12671335.se.tsv 87100 total ==> SRR12671335.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1762.77 355 10.3304 Potri.005G024800.1.v4.1 1035 779.771 229 15.0645 Potri.004G059700.1.v4.1 961 705.865 13 0.944728 Potri.007G009000.2.v4.1 1416 1160.77 0 0 Potri.003G141000.2.v4.1 2943 2687.77 658 12.558 Potri.016G087400.1.v4.1 270 78.56 550.611 359.525 Potri.015G069301.1.v4.1 564 317.654 0 0 Potri.010G195200.1.v4.1 1773 1517.77 112 3.78527 Potri.012G127500.1.v4.1 977 721.826 208 14.7814 ==> SRR12671335.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 242 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 386 Potri.001G212900.v4.1 47 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR12671335 completed mapping pipeline successfully