Starting /dee2/code/volunteer_pipeline.sh SRR12671336 current disk space = 3053381140480 free memory = 1579588964 SRR12671336 SRAfilesize fd6a3611c9b0ba03f2aa40e413696cc6 SRR12671336.sra SRR12671336.sra file validated SRR12671336 is paired end SRR12671336 is conventional basespace SRR12671336 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671336_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5495 37.0 37.0 37.0 37.0 37.0 2 36.3575 37.0 37.0 37.0 37.0 37.0 3 36.6325 37.0 37.0 37.0 37.0 37.0 4 36.6035 37.0 37.0 37.0 37.0 37.0 5 36.5645 37.0 37.0 37.0 37.0 37.0 6 36.6 37.0 37.0 37.0 37.0 37.0 7 36.497 37.0 37.0 37.0 37.0 37.0 8 36.5415 37.0 37.0 37.0 37.0 37.0 9 36.5805 37.0 37.0 37.0 37.0 37.0 10-14 36.5984 37.0 37.0 37.0 37.0 37.0 15-19 36.5503 37.0 37.0 37.0 37.0 37.0 20-24 36.5636 37.0 37.0 37.0 37.0 37.0 25-29 36.533100000000005 37.0 37.0 37.0 37.0 37.0 30-34 36.492399999999996 37.0 37.0 37.0 37.0 37.0 35-39 36.461800000000004 37.0 37.0 37.0 37.0 37.0 40-44 36.4206 37.0 37.0 37.0 37.0 37.0 45-49 36.3017 37.0 37.0 37.0 37.0 37.0 50-54 36.34740000000001 37.0 37.0 37.0 37.0 37.0 55-59 36.3087 37.0 37.0 37.0 37.0 37.0 60-64 36.230399999999996 37.0 37.0 37.0 37.0 37.0 65-69 36.2599 37.0 37.0 37.0 37.0 37.0 70-74 36.2091 37.0 37.0 37.0 37.0 37.0 75-79 36.2047 37.0 37.0 37.0 37.0 37.0 80-84 36.2236 37.0 37.0 37.0 37.0 37.0 85-89 36.142700000000005 37.0 37.0 37.0 37.0 37.0 90-94 36.1414 37.0 37.0 37.0 37.0 37.0 95-99 36.131299999999996 37.0 37.0 37.0 37.0 37.0 100-104 36.111000000000004 37.0 37.0 37.0 37.0 37.0 105-109 36.151700000000005 37.0 37.0 37.0 37.0 37.0 110-114 36.06930000000001 37.0 37.0 37.0 37.0 37.0 115-119 36.0654 37.0 37.0 37.0 37.0 37.0 120-124 35.9982 37.0 37.0 37.0 37.0 37.0 125-129 35.9371 37.0 37.0 37.0 37.0 37.0 130-134 35.9241 37.0 37.0 37.0 37.0 37.0 135-139 35.919 37.0 37.0 37.0 37.0 37.0 140-144 35.849900000000005 37.0 37.0 37.0 37.0 37.0 145-149 35.839099999999995 37.0 37.0 37.0 37.0 37.0 150-151 35.6755 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 1.0 18 0.0 19 4.0 20 0.0 21 2.0 22 8.0 23 3.0 24 5.0 25 6.0 26 10.0 27 12.0 28 11.0 29 18.0 30 23.0 31 29.0 32 43.0 33 57.0 34 110.0 35 225.0 36 2979.0 37 454.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 52.37500000000001 10.299999999999999 5.775 31.55 2 20.110330992978938 13.139418254764292 36.96088264794383 29.789368104312942 3 17.599999999999998 18.125 30.325000000000003 33.95 4 21.15 26.0 25.525 27.325 5 23.200000000000003 32.824999999999996 24.2 19.775000000000002 6 18.15 35.15 25.124999999999996 21.575 7 14.2 24.525 43.875 17.4 8 15.325 25.974999999999998 32.6 26.1 9 16.1 21.8 37.775 24.325 10-14 19.900000000000002 29.43 28.48 22.189999999999998 15-19 19.74 27.49 28.125 24.645 20-24 20.125 28.799999999999997 28.065 23.01 25-29 19.935 28.105000000000004 28.199999999999996 23.76 30-34 19.88 28.76 28.050000000000004 23.31 35-39 20.45 28.689999999999998 27.865000000000002 22.994999999999997 40-44 19.575 29.360000000000003 27.500000000000004 23.565 45-49 19.585 28.88 27.57 23.965 50-54 20.225 28.23 27.325 24.22 55-59 19.89 28.055000000000003 28.53 23.525 60-64 20.044999999999998 27.665 28.895 23.395 65-69 20.075000000000003 29.044999999999998 27.735 23.145 70-74 19.814999999999998 29.12 27.77 23.294999999999998 75-79 20.474999999999998 28.389999999999997 27.439999999999998 23.695 80-84 20.195 29.160000000000004 27.18 23.465 85-89 20.515 27.965 27.73 23.79 90-94 20.685000000000002 28.810000000000002 27.310000000000002 23.195 95-99 20.515 28.325 27.27 23.89 100-104 20.435 28.685 27.52 23.36 105-109 20.89 28.23 28.015 22.865 110-114 19.945 28.27 28.095 23.69 115-119 20.64 28.175 28.095 23.09 120-124 20.3 28.265 28.21 23.225 125-129 20.915 27.71 27.72 23.655 130-134 20.52 27.715 27.855 23.91 135-139 20.544999999999998 28.105000000000004 27.029999999999998 24.32 140-144 20.61 28.294999999999998 27.189999999999998 23.905 145-149 20.785 27.944999999999997 27.615000000000002 23.655 150-151 21.1875 27.725 27.85 23.2375 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 4.0 1 2.5 2 1.0 3 1.0 4 0.5 5 1.5 6 3.5 7 4.0 8 2.5 9 0.5 10 1.0 11 2.0 12 1.5 13 0.5 14 1.5 15 1.5 16 0.0 17 0.5 18 0.5 19 0.5 20 1.0 21 1.0 22 1.0 23 3.5 24 5.0 25 6.5 26 8.5 27 9.0 28 11.5 29 20.5 30 26.5 31 26.0 32 33.5 33 49.5 34 63.0 35 74.5 36 84.5 37 93.0 38 106.5 39 140.5 40 176.0 41 201.5 42 209.0 43 235.5 44 290.5 45 281.0 46 251.5 47 251.5 48 235.0 49 194.0 50 158.5 51 152.0 52 136.0 53 101.0 54 74.5 55 61.5 56 61.0 57 44.0 58 22.0 59 20.5 60 19.0 61 11.5 62 6.0 63 2.5 64 2.0 65 1.5 66 2.0 67 3.0 68 2.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.3 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 83.575 #Duplication Level Percentage of deduplicated Percentage of total 1 84.65450194436134 70.75 2 12.294346395453186 20.549999999999997 3 2.273407119353874 5.7 4 0.4786120251271313 1.6 5 0.23930601256356565 1.0 6 0.029913251570445706 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.029913251570445706 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 10 0.25 No Hit GCTTTGTGCGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGTCCACCCT 6 0.15 No Hit GGGAGAGTGTGGTGATAAAAATCACATGCTGGCAAAAGTTTGAACCACAA 5 0.125 No Hit GCCCGATTCAGCATCCGAATCCAGAAGCTAAAAACAAAAACAAAGTAGAA 5 0.125 No Hit GTAACAATATATGGATCCATGTTCGAAGCAGGCCTTCTATCCTCAAAATA 5 0.125 No Hit CACACCTCAATTTCATTGTTTCGTCCAGTCTGTTTGAAGAAAGTAGCATT 5 0.125 No Hit GCCATGGGTTTGCAGACTGGTTCATTGCGTTGAGGTTCAGGGTTGCTTCA 5 0.125 No Hit GGCATCACAAGGGATCTGCAGGCATCCCAAAACCTGTGAGACAAGTTCGA 5 0.125 No Hit GTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACC 5 0.125 No Hit CCCATACATATTCAGGCTGAGAATGATCAGCACAAGGACGTACTAGTAAA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.1875 0.0 0.0 0.0 0.0 94-95 0.225 0.0 0.0 0.0 0.0 96-97 0.275 0.0 0.0 0.0 0.0 98-99 0.3125 0.0 0.0 0.0 0.0 100-101 0.4125 0.0 0.0 0.0 0.0 102-103 0.48750000000000004 0.0 0.0 0.0 0.0 104-105 0.6 0.0 0.0 0.0 0.0 106-107 0.65 0.0 0.0 0.0 0.0 108-109 0.6875 0.0 0.0 0.0 0.0 110-111 0.725 0.0 0.0 0.0 0.0 112-113 0.9125 0.0 0.0 0.0 0.0 114-115 1.075 0.0 0.0 0.0 0.0 116-117 1.2000000000000002 0.0 0.0 0.0 0.0 118-119 1.3250000000000002 0.0 0.0 0.0 0.0 120-121 1.5125000000000002 0.0 0.0 0.0 0.0 122-123 1.65 0.0 0.0 0.0 0.0 124-125 1.8875 0.0 0.0 0.0 0.0 126-127 2.1375 0.0 0.0 0.0 0.0 128-129 2.275 0.0 0.0 0.0 0.0 130-131 2.55 0.0 0.0 0.0 0.0 132-133 2.8875 0.0 0.0 0.0 0.0 134-135 3.0625 0.0 0.0 0.0 0.0 136-137 3.4125 0.0 0.0 0.0 0.0 138-139 3.6875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TACTGGT 10 0.006830828 145.0 9 >>END_MODULE SRR12671336 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671336_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2695 37.0 37.0 37.0 37.0 37.0 2 35.946 37.0 37.0 37.0 37.0 37.0 3 36.1275 37.0 37.0 37.0 37.0 37.0 4 36.1915 37.0 37.0 37.0 37.0 37.0 5 36.37 37.0 37.0 37.0 37.0 37.0 6 36.265 37.0 37.0 37.0 37.0 37.0 7 36.1455 37.0 37.0 37.0 37.0 37.0 8 36.2245 37.0 37.0 37.0 37.0 37.0 9 36.2965 37.0 37.0 37.0 37.0 37.0 10-14 36.2585 37.0 37.0 37.0 37.0 37.0 15-19 36.2367 37.0 37.0 37.0 37.0 37.0 20-24 36.1872 37.0 37.0 37.0 37.0 37.0 25-29 36.167500000000004 37.0 37.0 37.0 37.0 37.0 30-34 36.023199999999996 37.0 37.0 37.0 37.0 37.0 35-39 36.066 37.0 37.0 37.0 37.0 37.0 40-44 36.1044 37.0 37.0 37.0 37.0 37.0 45-49 36.0393 37.0 37.0 37.0 37.0 37.0 50-54 36.0169 37.0 37.0 37.0 37.0 37.0 55-59 35.9995 37.0 37.0 37.0 37.0 37.0 60-64 35.9482 37.0 37.0 37.0 37.0 37.0 65-69 35.94259999999999 37.0 37.0 37.0 37.0 37.0 70-74 35.9172 37.0 37.0 37.0 37.0 37.0 75-79 35.940999999999995 37.0 37.0 37.0 37.0 37.0 80-84 35.8202 37.0 37.0 37.0 37.0 37.0 85-89 35.8977 37.0 37.0 37.0 37.0 37.0 90-94 35.837900000000005 37.0 37.0 37.0 37.0 37.0 95-99 35.8395 37.0 37.0 37.0 37.0 37.0 100-104 35.773900000000005 37.0 37.0 37.0 37.0 37.0 105-109 35.6813 37.0 37.0 37.0 37.0 37.0 110-114 35.661500000000004 37.0 37.0 37.0 37.0 37.0 115-119 35.7276 37.0 37.0 37.0 37.0 37.0 120-124 35.7513 37.0 37.0 37.0 37.0 37.0 125-129 35.6909 37.0 37.0 37.0 37.0 37.0 130-134 35.6671 37.0 37.0 37.0 37.0 37.0 135-139 35.4914 37.0 37.0 37.0 37.0 37.0 140-144 35.5951 37.0 37.0 37.0 37.0 37.0 145-149 35.5311 37.0 37.0 37.0 37.0 37.0 150-151 35.22825 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 1.0 14 4.0 15 1.0 16 2.0 17 3.0 18 1.0 19 1.0 20 4.0 21 2.0 22 6.0 23 9.0 24 4.0 25 4.0 26 8.0 27 15.0 28 11.0 29 17.0 30 28.0 31 51.0 32 42.0 33 96.0 34 171.0 35 555.0 36 2681.0 37 282.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 48.075 23.875 8.175 19.875 2 27.275 24.6 32.15 15.975 3 20.9 26.55 35.925000000000004 16.625 4 25.224999999999998 33.95 22.8 18.025 5 24.55 38.224999999999994 21.325 15.9 6 20.3 39.225 21.775 18.7 7 19.525000000000002 20.875 39.875 19.725 8 19.975 25.3 29.75 24.975 9 22.15 23.724999999999998 30.475 23.65 10-14 23.14 29.185 27.095000000000002 20.580000000000002 15-19 22.955000000000002 28.43 27.439999999999998 21.175 20-24 23.380000000000003 28.54 27.435 20.645 25-29 23.16 28.08 27.58 21.18 30-34 22.78 28.725 27.584999999999997 20.91 35-39 23.03 28.044999999999998 27.485 21.44 40-44 23.44 27.889999999999997 27.775 20.895 45-49 23.53 27.76 28.000000000000004 20.71 50-54 23.76 28.18 27.625 20.435 55-59 23.05 28.475 27.465 21.01 60-64 23.205000000000002 28.16 27.400000000000002 21.235 65-69 23.44 28.055000000000003 27.92 20.585 70-74 23.355 27.99 27.134999999999998 21.52 75-79 23.015 28.325 27.474999999999998 21.185000000000002 80-84 23.095 28.585 27.43 20.89 85-89 23.669999999999998 28.134999999999998 27.200000000000003 20.995 90-94 23.535 27.58 27.575 21.310000000000002 95-99 23.375 28.244999999999997 27.58 20.8 100-104 23.585 27.860000000000003 27.465 21.09 105-109 23.73 27.389999999999997 27.755000000000003 21.125 110-114 23.34 28.544999999999998 28.225 19.89 115-119 24.03 27.994999999999997 27.41 20.565 120-124 23.705000000000002 27.85 27.935 20.51 125-129 24.15 28.360000000000003 26.884999999999998 20.605 130-134 23.96 27.744999999999997 27.700000000000003 20.595 135-139 24.91 27.605 27.82 19.665 140-144 23.925 28.199999999999996 27.445000000000004 20.43 145-149 24.62 28.405 26.735 20.24 150-151 25.124999999999996 27.35 27.9125 19.6125 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 1.0 6 0.5 7 0.0 8 0.5 9 1.0 10 0.5 11 0.5 12 0.5 13 0.0 14 2.0 15 2.5 16 2.5 17 2.0 18 0.0 19 0.0 20 1.0 21 2.0 22 1.5 23 1.0 24 1.0 25 4.5 26 11.0 27 10.5 28 9.0 29 17.5 30 24.5 31 27.0 32 30.5 33 38.0 34 45.5 35 60.0 36 77.0 37 102.0 38 137.5 39 160.0 40 180.5 41 212.0 42 251.0 43 271.5 44 274.0 45 261.5 46 238.0 47 228.0 48 212.5 49 212.0 50 194.0 51 147.5 52 119.5 53 96.0 54 79.0 55 58.5 56 42.5 57 36.0 58 25.5 59 21.0 60 15.0 61 8.0 62 9.0 63 5.5 64 2.0 65 1.5 66 1.0 67 0.5 68 0.5 69 0.5 70 0.0 71 0.5 72 1.0 73 1.0 74 0.5 75 0.5 76 0.5 77 0.5 78 0.5 79 0.5 80 0.5 81 0.0 82 0.0 83 0.5 84 0.5 85 0.0 86 0.5 87 0.5 88 0.5 89 0.5 90 0.0 91 0.5 92 0.5 93 0.0 94 0.0 95 0.0 96 0.5 97 0.5 98 0.5 99 0.5 100 4.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 83.975 #Duplication Level Percentage of deduplicated Percentage of total 1 85.26347127121167 71.6 2 11.878535278356654 19.950000000000003 3 2.1137243227150937 5.325 4 0.4763322417386127 1.6 5 0.17862459065197975 0.75 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.08931229532598987 0.775 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 11 0.27499999999999997 No Hit AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 10 0.25 No Hit AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 10 0.25 No Hit CACATGCATACGATCTATACAGGGCTAACTACTATGTTGAAGATTTTGAT 5 0.125 No Hit CTCGTGTTCATCAAAGGATTTTTTTGAACCTCACCTTCCAACTGGATGGC 5 0.125 No Hit GGGCGATTGGAATGGAGCGGGGGCACACACAAATTACAGTACTGAGTCTA 5 0.125 No Hit GTCTGTCTCTCTACATGCAGTGAATATAAGACAAAGAACAAAACCTAGCT 5 0.125 No Hit GAAGGCATGGGGCCTGCGCCCAAATACCATCACATACTCCATACTCTCAG 5 0.125 No Hit GTCTGACATGTGTGCGAGTCAACGGGCGAGTAAACCCGTAAGGCGCAAGG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.1875 0.0 0.0 0.0 0.0 92-93 0.21250000000000002 0.0 0.0 0.0 0.0 94-95 0.2375 0.0 0.0 0.0 0.0 96-97 0.275 0.0 0.0 0.0 0.0 98-99 0.3125 0.0 0.0 0.0 0.0 100-101 0.4125 0.0 0.0 0.0 0.0 102-103 0.48750000000000004 0.0 0.0 0.0 0.0 104-105 0.6 0.0 0.0 0.0 0.0 106-107 0.65 0.0 0.0 0.0 0.0 108-109 0.6875 0.0 0.0 0.0 0.0 110-111 0.725 0.0 0.0 0.0 0.0 112-113 0.9125 0.0 0.0 0.0 0.0 114-115 1.075 0.0 0.0 0.0 0.0 116-117 1.2000000000000002 0.0 0.0 0.0 0.0 118-119 1.3250000000000002 0.0 0.0 0.0 0.0 120-121 1.5125000000000002 0.0 0.0 0.0 0.0 122-123 1.65 0.0 0.0 0.0 0.0 124-125 1.8875 0.0 0.0 0.0 0.0 126-127 2.1375 0.0 0.0 0.0 0.0 128-129 2.275 0.0 0.0 0.0 0.0 130-131 2.5250000000000004 0.0 0.0 0.0 0.0 132-133 2.8625 0.0 0.0 0.0 0.0 134-135 3.0375 0.0 0.0 0.0 0.0 136-137 3.3875 0.0 0.0 0.0 0.0 138-139 3.6625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1206182 spots for SRR12671336.sra Written 1206182 spots for SRR12671336.sra Read 1206182 spots for SRR12671336.sra Written 1206182 spots for SRR12671336.sra Read 1206182 spots for SRR12671336.sra Written 1206182 spots for SRR12671336.sra Read 1206182 spots for SRR12671336.sra Written 1206182 spots for SRR12671336.sra Read 1206182 spots for SRR12671336.sra Written 1206182 spots for SRR12671336.sra Read 1206182 spots for SRR12671336.sra Written 1206182 spots for SRR12671336.sra Read 1206182 spots for SRR12671336.sra Written 1206182 spots for SRR12671336.sra Read 1206182 spots for SRR12671336.sra Written 1206182 spots for SRR12671336.sra Read 1206182 spots for SRR12671336.sra Written 1206182 spots for SRR12671336.sra Read 1206182 spots for SRR12671336.sra Written 1206182 spots for SRR12671336.sra Read 1206182 spots for SRR12671336.sra Written 1206182 spots for SRR12671336.sra Read 1206182 spots for SRR12671336.sra Written 1206182 spots for SRR12671336.sra Read 1206182 spots for SRR12671336.sra Written 1206182 spots for SRR12671336.sra Read 1206182 spots for SRR12671336.sra Written 1206182 spots for SRR12671336.sra Read 1206196 spots for SRR12671336.sra Written 1206196 spots for SRR12671336.sra Read 1206182 spots for SRR12671336.sra Written 1206182 spots for SRR12671336.sra Read 1206182 spots for SRR12671336.sra Written 1206182 spots for SRR12671336.sra Read 1206182 spots for SRR12671336.sra Written 1206182 spots for SRR12671336.sra Read 1206182 spots for SRR12671336.sra Written 1206182 spots for SRR12671336.sra Read 1206182 spots for SRR12671336.sra Written 1206182 spots for SRR12671336.sra SRR ids: ['SRR12671336.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_nvkzeyqh SRR12671336.sra spots: 24123654 blocks: [[1, 1206182], [1206183, 2412364], [2412365, 3618546], [3618547, 4824728], [4824729, 6030910], [6030911, 7237092], [7237093, 8443274], [8443275, 9649456], [9649457, 10855638], [10855639, 12061820], [12061821, 13268002], [13268003, 14474184], [14474185, 15680366], [15680367, 16886548], [16886549, 18092730], [18092731, 19298912], [19298913, 20505094], [20505095, 21711276], [21711277, 22917458], [22917459, 24123654]] SRR12671336 file size 8176572 SRR12671336 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671336 SRR12671336_1.fastq SRR12671336_2.fastq Input file: SRR12671336_1.fastq Paired file: SRR12671336_2.fastq trimmed: SRR12671336-trimmed-pair1.fastq, SRR12671336-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 18:15:32 2025 >> started Tue Feb 11 18:15:58 2025 >> done (25.374s) 24123654 read pairs processed; of these: 283 ( 0.00%) short read pairs filtered out after trimming by size control 4394 ( 0.02%) empty read pairs filtered out after trimming by size control 24118977 (99.98%) read pairs available; of these: 1295201 ( 5.37%) trimmed read pairs available after processing 22823776 (94.63%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 23 0.00% 19 18 0.00% 20 35 0.00% 21 26 0.00% 22 29 0.00% 23 20 0.00% 24 37 0.00% 25 31 0.00% 26 43 0.00% 27 52 0.00% 28 38 0.00% 29 44 0.00% 30 34 0.00% 31 46 0.00% 32 40 0.00% 33 47 0.00% 34 52 0.00% 35 48 0.00% 36 41 0.00% 37 58 0.00% 38 52 0.00% 39 52 0.00% 40 33 0.00% 41 58 0.00% 42 68 0.00% 43 60 0.00% 44 62 0.00% 45 54 0.00% 46 69 0.00% 47 66 0.00% 48 54 0.00% 49 78 0.00% 50 102 0.00% 51 98 0.00% 52 123 0.00% 53 125 0.00% 54 129 0.00% 55 140 0.00% 56 152 0.00% 57 170 0.00% 58 220 0.00% 59 240 0.00% 60 304 0.00% 61 307 0.00% 62 368 0.00% 63 436 0.00% 64 416 0.00% 65 455 0.00% 66 544 0.00% 67 612 0.00% 68 613 0.00% 69 825 0.00% 70 864 0.00% 71 971 0.00% 72 1134 0.00% 73 1301 0.01% 74 1402 0.01% 75 1435 0.01% 76 1705 0.01% 77 1757 0.01% 78 2050 0.01% 79 2186 0.01% 80 2452 0.01% 81 2766 0.01% 82 3006 0.01% 83 3307 0.01% 84 3518 0.01% 85 3864 0.02% 86 4102 0.02% 87 4349 0.02% 88 4682 0.02% 89 4997 0.02% 90 5291 0.02% 91 5550 0.02% 92 6083 0.03% 93 6639 0.03% 94 6770 0.03% 95 7358 0.03% 96 7716 0.03% 97 8048 0.03% 98 7982 0.03% 99 8817 0.04% 100 9046 0.04% 101 9332 0.04% 102 9964 0.04% 103 10258 0.04% 104 11150 0.05% 105 11303 0.05% 106 11640 0.05% 107 12216 0.05% 108 12713 0.05% 109 12861 0.05% 110 13234 0.05% 111 13988 0.06% 112 14470 0.06% 113 14705 0.06% 114 15485 0.06% 115 15656 0.06% 116 16717 0.07% 117 17482 0.07% 118 17773 0.07% 119 18013 0.07% 120 18613 0.08% 121 19266 0.08% 122 20088 0.08% 123 20520 0.09% 124 21459 0.09% 125 21667 0.09% 126 22544 0.09% 127 23338 0.10% 128 23770 0.10% 129 24811 0.10% 130 24624 0.10% 131 25333 0.11% 132 26203 0.11% 133 26902 0.11% 134 27360 0.11% 135 29087 0.12% 136 29514 0.12% 137 30232 0.13% 138 30311 0.13% 139 31595 0.13% 140 32091 0.13% 141 32742 0.14% 142 33356 0.14% 143 34669 0.14% 144 35860 0.15% 145 36263 0.15% 146 37587 0.16% 147 38131 0.16% 148 39357 0.16% 149 39452 0.16% 150 40501 0.17% 151 22823776 94.63% 24118977 reads passed initial QC criterion=sequence-density sequence-density=0.46 sequence-density-rank=1 fanout-score=2.03 fanout-score-rank=16 prefix-density=0.47 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=663.01 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=17.4 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTG criterion=sequence-density sequence-density=0.53 sequence-density-rank=1 fanout-score=2.37 fanout-score-rank=20 prefix-density=0.56 prefix-fanout=2.2 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=35.51 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=2.2 sequence=GGAACTCAAACGCATAGCTTCCTACAAATACCCCAGCTAGCCAATACTCTCCACCACTAAACCCAAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTC SRR12671336 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 18:16:39 Started mapping on | Feb 11 18:16:39 Finished on | Feb 11 18:19:29 Mapping speed, Million of reads per hour | 510.75 Number of input reads | 24118977 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 21975285 Uniquely mapped reads % | 91.11% Average mapped length | 297.55 Number of splices: Total | 21480287 Number of splices: Annotated (sjdb) | 21028231 Number of splices: GT/AG | 21055809 Number of splices: GC/AG | 342665 Number of splices: AT/AC | 13816 Number of splices: Non-canonical | 67997 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.92 Insertion rate per base | 0.02% Insertion average length | 2.19 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 594158 % of reads mapped to multiple loci | 2.46% Number of reads mapped to too many loci | 99607 % of reads mapped to too many loci | 0.41% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.83% % of reads unmapped: other | 0.18% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1549534 1549534 1549534 N_multimapping 594158 594158 594158 N_noFeature 882126 21571045 1010329 N_ambiguous 429198 1652 152775 UnstrandedReadsAssigned:20663961 PositiveStrandReadsAssigned:402588 NegativeStrandReadsAssigned:20812181 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671336 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671336-trimmed-pair1.fastq SRR12671336-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 24,118,977 reads, 20,841,263 reads pseudoaligned [quant] estimated average fragment length: 286.967 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,139 rounds 52401 SRR12671336.ke.tsv 34699 SRR12671336.se.tsv 87100 total ==> SRR12671336.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1732.03 1342 30.7145 Potri.005G024800.1.v4.1 1035 749.033 491 25.9853 Potri.004G059700.1.v4.1 961 675.262 0 0 Potri.007G009000.2.v4.1 1416 1130.03 0 0 Potri.003G141000.2.v4.1 2943 2657.03 1370.49 20.4468 Potri.016G087400.1.v4.1 270 73.6413 1070 575.983 Potri.015G069301.1.v4.1 564 296.211 0 0 Potri.010G195200.1.v4.1 1773 1487.03 485.983 12.9553 Potri.012G127500.1.v4.1 977 691.174 97 5.56329 ==> SRR12671336.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 163 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 260 Potri.001G212900.v4.1 29 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 10 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 6 SRR12671336 completed mapping pipeline successfully