Starting /dee2/code/volunteer_pipeline.sh SRR12671337 current disk space = 3049419460608 free memory = 1412074564 SRR12671337 SRAfilesize 1b414063eaa9b5e7350bc1bc6e9b5ea5 SRR12671337.sra SRR12671337.sra file validated SRR12671337 is paired end SRR12671337 is conventional basespace SRR12671337 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671337_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.7055 37.0 37.0 37.0 37.0 37.0 2 36.38275 37.0 37.0 37.0 37.0 37.0 3 36.5935 37.0 37.0 37.0 37.0 37.0 4 36.6285 37.0 37.0 37.0 37.0 37.0 5 36.5665 37.0 37.0 37.0 37.0 37.0 6 36.5955 37.0 37.0 37.0 37.0 37.0 7 36.517 37.0 37.0 37.0 37.0 37.0 8 36.659 37.0 37.0 37.0 37.0 37.0 9 36.614 37.0 37.0 37.0 37.0 37.0 10-14 36.63199999999999 37.0 37.0 37.0 37.0 37.0 15-19 36.637699999999995 37.0 37.0 37.0 37.0 37.0 20-24 36.5517 37.0 37.0 37.0 37.0 37.0 25-29 36.5497 37.0 37.0 37.0 37.0 37.0 30-34 36.5649 37.0 37.0 37.0 37.0 37.0 35-39 36.529700000000005 37.0 37.0 37.0 37.0 37.0 40-44 36.4807 37.0 37.0 37.0 37.0 37.0 45-49 36.438399999999994 37.0 37.0 37.0 37.0 37.0 50-54 36.4336 37.0 37.0 37.0 37.0 37.0 55-59 36.46849999999999 37.0 37.0 37.0 37.0 37.0 60-64 36.38719999999999 37.0 37.0 37.0 37.0 37.0 65-69 36.340500000000006 37.0 37.0 37.0 37.0 37.0 70-74 36.383300000000006 37.0 37.0 37.0 37.0 37.0 75-79 36.3869 37.0 37.0 37.0 37.0 37.0 80-84 36.3916 37.0 37.0 37.0 37.0 37.0 85-89 36.2814 37.0 37.0 37.0 37.0 37.0 90-94 36.3283 37.0 37.0 37.0 37.0 37.0 95-99 36.257400000000004 37.0 37.0 37.0 37.0 37.0 100-104 36.2932 37.0 37.0 37.0 37.0 37.0 105-109 36.2707 37.0 37.0 37.0 37.0 37.0 110-114 36.162600000000005 37.0 37.0 37.0 37.0 37.0 115-119 36.185 37.0 37.0 37.0 37.0 37.0 120-124 36.1599 37.0 37.0 37.0 37.0 37.0 125-129 36.1548 37.0 37.0 37.0 37.0 37.0 130-134 36.0715 37.0 37.0 37.0 37.0 37.0 135-139 36.0809 37.0 37.0 37.0 37.0 37.0 140-144 35.9983 37.0 37.0 37.0 37.0 37.0 145-149 36.0072 37.0 37.0 37.0 37.0 37.0 150-151 35.9005 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 1.0 23 3.0 24 0.0 25 3.0 26 4.0 27 4.0 28 10.0 29 10.0 30 24.0 31 32.0 32 48.0 33 55.0 34 99.0 35 254.0 36 2995.0 37 457.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.175 10.925 5.325 38.574999999999996 2 19.673776662484315 11.693851944792973 37.54077791718946 31.09159347553325 3 18.45 18.025 28.349999999999998 35.175 4 24.725 26.650000000000002 23.425 25.2 5 24.474999999999998 30.95 23.200000000000003 21.375 6 18.3 35.949999999999996 23.825 21.925 7 15.1 26.25 42.025 16.625 8 16.375 24.325 35.25 24.05 9 17.2 22.15 35.375 25.275 10-14 19.919999999999998 29.415000000000003 27.785 22.88 15-19 19.689999999999998 28.439999999999998 28.13 23.74 20-24 19.73 27.82 28.465 23.985 25-29 19.78 28.235 27.935 24.05 30-34 20.025000000000002 28.694999999999997 27.750000000000004 23.53 35-39 19.98 28.345 27.705000000000002 23.97 40-44 20.085 28.415000000000003 27.765 23.735 45-49 19.71 28.305000000000003 27.76 24.224999999999998 50-54 19.605 28.095 27.384999999999998 24.915000000000003 55-59 19.6 28.175 27.615000000000002 24.610000000000003 60-64 19.814999999999998 28.71 27.495000000000005 23.98 65-69 20.285 28.22 27.72 23.775 70-74 20.48 28.134999999999998 27.67 23.715 75-79 19.86 27.965 27.865000000000002 24.310000000000002 80-84 20.175 28.249999999999996 27.72 23.855 85-89 20.544999999999998 28.535 27.595 23.325000000000003 90-94 19.7 27.76 28.115000000000002 24.425 95-99 20.39 27.944999999999997 27.894999999999996 23.77 100-104 20.61 28.744999999999997 27.625 23.02 105-109 20.655 28.384999999999998 27.76 23.200000000000003 110-114 20.385 28.610000000000003 27.279999999999998 23.724999999999998 115-119 20.18 28.215 27.98 23.625 120-124 20.74 28.084999999999997 27.58 23.595 125-129 20.79 28.115000000000002 27.68 23.415 130-134 20.955 27.815 27.625 23.605 135-139 21.07 27.689999999999998 27.389999999999997 23.849999999999998 140-144 21.175 27.955000000000002 27.515 23.355 145-149 21.634999999999998 28.439999999999998 26.71 23.215 150-151 21.0125 27.775 26.75 24.462500000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 2.0 13 1.5 14 0.0 15 1.5 16 1.5 17 0.0 18 1.0 19 1.5 20 0.5 21 0.5 22 0.5 23 4.5 24 8.0 25 6.0 26 7.0 27 9.0 28 11.0 29 19.5 30 18.0 31 18.0 32 33.5 33 47.5 34 64.0 35 69.5 36 76.0 37 87.5 38 111.5 39 151.5 40 162.0 41 183.0 42 220.5 43 246.0 44 272.5 45 278.5 46 262.5 47 250.5 48 243.0 49 220.5 50 181.0 51 141.5 52 123.0 53 106.5 54 89.0 55 80.5 56 60.5 57 41.5 58 33.5 59 23.5 60 12.0 61 6.5 62 5.0 63 2.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.5 69 0.5 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.375 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 84.45 #Duplication Level Percentage of deduplicated Percentage of total 1 84.84310242747188 71.65 2 12.522202486678507 21.15 3 2.1906453522794553 5.55 4 0.2664298401420959 0.8999999999999999 5 0.17761989342806395 0.75 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTGACAACTGTTTTCTACATTTCCCCTGTGGAGATTAAATTATAATCTTC 5 0.125 No Hit GCATTCTCAACACCTGCCATTTCAAGAACAATTCTCACAGCACCTCCAGC 5 0.125 No Hit GCATTGGCATGTTCTGCTAAAACCTTAGTCTTGGCAGGGTAACAAACTTT 5 0.125 No Hit CCTTGCATCTTGTCAGCTGCTTCCTTGAACTCCTTGTTTCTCACAAAGTG 5 0.125 No Hit CAATACTCTTCGCCATTGGCAACCACCACATTTACCCCTCCTCTTGCCTC 5 0.125 No Hit GCAATATGTAATTAAACTGATTGTGCTTTGGAGCACTCAGGGCAGCAAAA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.16249999999999998 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.1875 0.0 0.0 0.0 0.0 92-93 0.225 0.0 0.0 0.0 0.0 94-95 0.2625 0.0 0.0 0.0 0.0 96-97 0.2875 0.0 0.0 0.0 0.0 98-99 0.3125 0.0 0.0 0.0 0.0 100-101 0.38749999999999996 0.0 0.0 0.0 0.0 102-103 0.45 0.0 0.0 0.0 0.0 104-105 0.4625 0.0 0.0 0.0 0.0 106-107 0.5375000000000001 0.0 0.0 0.0 0.0 108-109 0.55 0.0 0.0 0.0 0.0 110-111 0.625 0.0 0.0 0.0 0.0 112-113 0.7625 0.0 0.0 0.0 0.0 114-115 0.8500000000000001 0.0 0.0 0.0 0.0 116-117 1.0499999999999998 0.0 0.0 0.0 0.0 118-119 1.125 0.0 0.0 0.0 0.0 120-121 1.2374999999999998 0.0 0.0 0.0 0.0 122-123 1.5 0.0 0.0 0.0 0.0 124-125 1.625 0.0 0.0 0.0 0.0 126-127 1.9125 0.0 0.0 0.0 0.0 128-129 2.0999999999999996 0.0 0.0 0.0 0.0 130-131 2.325 0.0 0.0 0.0 0.0 132-133 2.5125 0.0 0.0 0.0 0.0 134-135 2.825 0.0 0.0 0.0 0.0 136-137 3.0999999999999996 0.0 0.0 0.0 0.0 138-139 3.4000000000000004 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTCACT 10 0.006830828 145.0 1 >>END_MODULE SRR12671337 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671337_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.173 37.0 37.0 37.0 37.0 37.0 2 35.991 37.0 37.0 37.0 37.0 37.0 3 36.2325 37.0 37.0 37.0 37.0 37.0 4 36.202 37.0 37.0 37.0 37.0 37.0 5 36.3965 37.0 37.0 37.0 37.0 37.0 6 36.1825 37.0 37.0 37.0 37.0 37.0 7 36.257 37.0 37.0 37.0 37.0 37.0 8 36.3115 37.0 37.0 37.0 37.0 37.0 9 36.254 37.0 37.0 37.0 37.0 37.0 10-14 36.2502 37.0 37.0 37.0 37.0 37.0 15-19 36.264300000000006 37.0 37.0 37.0 37.0 37.0 20-24 36.1666 37.0 37.0 37.0 37.0 37.0 25-29 36.16139999999999 37.0 37.0 37.0 37.0 37.0 30-34 36.1009 37.0 37.0 37.0 37.0 37.0 35-39 36.0937 37.0 37.0 37.0 37.0 37.0 40-44 36.100699999999996 37.0 37.0 37.0 37.0 37.0 45-49 36.0418 37.0 37.0 37.0 37.0 37.0 50-54 36.0862 37.0 37.0 37.0 37.0 37.0 55-59 36.044200000000004 37.0 37.0 37.0 37.0 37.0 60-64 36.01690000000001 37.0 37.0 37.0 37.0 37.0 65-69 36.035199999999996 37.0 37.0 37.0 37.0 37.0 70-74 35.978 37.0 37.0 37.0 37.0 37.0 75-79 35.9597 37.0 37.0 37.0 37.0 37.0 80-84 35.8597 37.0 37.0 37.0 37.0 37.0 85-89 35.9271 37.0 37.0 37.0 37.0 37.0 90-94 35.9326 37.0 37.0 37.0 37.0 37.0 95-99 35.8855 37.0 37.0 37.0 37.0 37.0 100-104 35.824200000000005 37.0 37.0 37.0 37.0 37.0 105-109 35.7949 37.0 37.0 37.0 37.0 37.0 110-114 35.763600000000004 37.0 37.0 37.0 37.0 37.0 115-119 35.771699999999996 37.0 37.0 37.0 37.0 37.0 120-124 35.77329999999999 37.0 37.0 37.0 37.0 37.0 125-129 35.7564 37.0 37.0 37.0 37.0 37.0 130-134 35.6279 37.0 37.0 37.0 37.0 37.0 135-139 35.5394 37.0 37.0 37.0 37.0 37.0 140-144 35.657900000000005 37.0 37.0 37.0 37.0 37.0 145-149 35.6056 37.0 37.0 37.0 37.0 37.0 150-151 35.374 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 4.0 14 1.0 15 1.0 16 2.0 17 1.0 18 0.0 19 1.0 20 2.0 21 1.0 22 2.0 23 7.0 24 5.0 25 8.0 26 6.0 27 10.0 28 15.0 29 21.0 30 17.0 31 33.0 32 43.0 33 92.0 34 209.0 35 570.0 36 2708.0 37 240.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.075 24.15 9.225 25.55 2 26.224999999999998 25.95 32.6 15.225 3 20.05 27.775 33.2 18.975 4 24.425 35.05 21.875 18.65 5 24.675 39.725 20.4 15.2 6 20.95 39.800000000000004 21.3 17.95 7 21.15 21.05 39.65 18.15 8 18.975 25.3 29.65 26.075 9 20.724999999999998 24.775 30.85 23.65 10-14 22.945 29.275000000000002 26.615 21.165 15-19 23.45 27.6 27.584999999999997 21.365000000000002 20-24 22.935 28.24 27.66 21.165 25-29 23.025000000000002 27.83 27.68 21.465 30-34 23.005 27.975 28.389999999999997 20.630000000000003 35-39 22.63 28.53 27.775 21.065 40-44 22.585 27.41 28.610000000000003 21.395 45-49 22.835 28.110000000000003 28.13 20.925 50-54 22.994999999999997 28.685 27.47 20.849999999999998 55-59 22.61 28.22 27.93 21.240000000000002 60-64 23.53 27.950000000000003 27.345000000000002 21.175 65-69 23.474999999999998 27.905 26.950000000000003 21.67 70-74 23.7 28.015 27.27 21.015 75-79 23.119999999999997 27.534999999999997 27.73 21.615000000000002 80-84 23.27 28.355000000000004 27.66 20.715 85-89 23.43 27.800000000000004 27.284999999999997 21.485000000000003 90-94 23.685000000000002 27.61 27.534999999999997 21.17 95-99 22.81 28.185 27.694999999999997 21.310000000000002 100-104 22.645 28.035 27.92 21.4 105-109 23.5 28.285 27.54 20.674999999999997 110-114 24.015 27.279999999999998 27.615000000000002 21.09 115-119 23.96 27.92 27.05 21.07 120-124 24.23 27.37 27.52 20.880000000000003 125-129 23.215 28.015 27.915 20.855 130-134 23.98 27.615000000000002 27.71 20.695 135-139 24.035 27.175 27.750000000000004 21.04 140-144 23.77 27.955000000000002 27.575 20.7 145-149 24.37 27.825 27.334999999999997 20.47 150-151 25.362499999999997 27.525 27.224999999999998 19.8875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 0.5 19 0.0 20 0.5 21 2.5 22 3.0 23 1.5 24 2.0 25 5.0 26 6.5 27 5.5 28 8.5 29 12.5 30 20.0 31 31.0 32 37.5 33 39.5 34 46.5 35 63.0 36 78.5 37 99.0 38 130.0 39 165.5 40 190.5 41 208.5 42 232.0 43 244.0 44 253.0 45 270.0 46 278.0 47 272.5 48 240.0 49 201.5 50 167.5 51 128.0 52 110.5 53 98.5 54 80.0 55 64.0 56 53.0 57 41.5 58 32.0 59 27.0 60 20.5 61 12.0 62 4.0 63 3.0 64 2.5 65 1.0 66 1.0 67 1.0 68 0.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 84.65 #Duplication Level Percentage of deduplicated Percentage of total 1 85.70584760779681 72.55 2 11.547548730064973 19.55 3 2.12640283520378 5.4 4 0.29533372711163614 1.0 5 0.2067336089781453 0.8750000000000001 6 0.08860011813349085 0.44999999999999996 7 0.029533372711163616 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 7 0.17500000000000002 No Hit AGAGAACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 6 0.15 No Hit CAGAGAACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTA 6 0.15 No Hit CACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATC 6 0.15 No Hit GGAAGTCCCTCCCTCATCAGGTCCTGGACGGACAACAAGTGGCTGACCGA 5 0.125 No Hit AGGGAGCACTGCATAGCTTATAAGCTTGTAAGAGATGGCTTCCTCCTCTA 5 0.125 No Hit CGACACACTCGATGGCTGTGGTGGGAGTGGGAGGCAAATGGGTCAAGCTT 5 0.125 No Hit CTTCGATTAACAGCTGGTGTCTCACCTCTGTCTCTGCCTCTAAGAGATCA 5 0.125 No Hit CTTAACATCAAGTGAAGTAGCAGGTTTTGGTGTTGGAGCTTTGCTTTTAT 5 0.125 No Hit GTGGGGCTCAAGAGTAAAGAAGGAGAAAATTAAAGATGGGTTTGACGAGA 5 0.125 No Hit GCAAGAATCTTTCTCCAAGAAAAAATGGCTGCAGAGATGGCTTTAGTAAA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.025 0.0 0.0 56-57 0.0 0.0 0.05 0.0 0.0 58-59 0.0 0.0 0.05 0.0 0.0 60-61 0.0 0.0 0.05 0.0 0.0 62-63 0.0 0.0 0.05 0.0 0.0 64-65 0.0 0.0 0.05 0.0 0.0 66-67 0.0 0.0 0.05 0.0 0.0 68-69 0.0 0.0 0.05 0.0 0.0 70-71 0.0 0.0 0.05 0.0 0.0 72-73 0.0 0.0 0.05 0.0 0.0 74-75 0.025 0.0 0.05 0.0 0.0 76-77 0.025 0.0 0.05 0.0 0.0 78-79 0.025 0.0 0.05 0.0 0.0 80-81 0.05 0.0 0.05 0.0 0.0 82-83 0.075 0.0 0.05 0.0 0.0 84-85 0.075 0.0 0.05 0.0 0.0 86-87 0.1375 0.0 0.05 0.0 0.0 88-89 0.15 0.0 0.05 0.0 0.0 90-91 0.16249999999999998 0.0 0.05 0.0 0.0 92-93 0.2 0.0 0.05 0.0 0.0 94-95 0.2375 0.0 0.05 0.0 0.0 96-97 0.2625 0.0 0.05 0.0 0.0 98-99 0.2875 0.0 0.05 0.0 0.0 100-101 0.36250000000000004 0.0 0.05 0.0 0.0 102-103 0.45 0.0 0.05 0.0 0.0 104-105 0.4625 0.0 0.05 0.0 0.0 106-107 0.5375000000000001 0.0 0.05 0.0 0.0 108-109 0.55 0.0 0.05 0.0 0.0 110-111 0.625 0.0 0.05 0.0 0.0 112-113 0.7625 0.0 0.05 0.0 0.0 114-115 0.8500000000000001 0.0 0.05 0.0 0.0 116-117 1.0499999999999998 0.0 0.05 0.0 0.0 118-119 1.125 0.0 0.05 0.0 0.0 120-121 1.225 0.0 0.05 0.0 0.0 122-123 1.475 0.0 0.05 0.0 0.0 124-125 1.6 0.0 0.05 0.0 0.0 126-127 1.9125 0.0 0.05 0.0 0.0 128-129 2.0999999999999996 0.0 0.05 0.0 0.0 130-131 2.325 0.0 0.05 0.0 0.0 132-133 2.5125 0.0 0.05 0.0 0.0 134-135 2.8375 0.0 0.05 0.0 0.0 136-137 3.125 0.0 0.05 0.0 0.0 138-139 3.4375 0.0 0.05 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1402650 spots for SRR12671337.sra Written 1402650 spots for SRR12671337.sra Read 1402650 spots for SRR12671337.sra Written 1402650 spots for SRR12671337.sra Read 1402650 spots for SRR12671337.sra Written 1402650 spots for SRR12671337.sra Read 1402650 spots for SRR12671337.sra Written 1402650 spots for SRR12671337.sra Read 1402650 spots for SRR12671337.sra Written 1402650 spots for SRR12671337.sra Read 1402650 spots for SRR12671337.sra Written 1402650 spots for SRR12671337.sra Read 1402650 spots for SRR12671337.sra Written 1402650 spots for SRR12671337.sra Read 1402650 spots for SRR12671337.sra Written 1402650 spots for SRR12671337.sra Read 1402650 spots for SRR12671337.sra Written 1402650 spots for SRR12671337.sra Read 1402650 spots for SRR12671337.sra Written 1402650 spots for SRR12671337.sra Read 1402650 spots for SRR12671337.sra Written 1402650 spots for SRR12671337.sra Read 1402650 spots for SRR12671337.sra Written 1402650 spots for SRR12671337.sra Read 1402650 spots for SRR12671337.sra Written 1402650 spots for SRR12671337.sra Read 1402650 spots for SRR12671337.sra Written 1402650 spots for SRR12671337.sra Read 1402650 spots for SRR12671337.sra Written 1402650 spots for SRR12671337.sra Read 1402650 spots for SRR12671337.sra Written 1402650 spots for SRR12671337.sra Read 1402654 spots for SRR12671337.sra Written 1402654 spots for SRR12671337.sra Read 1402650 spots for SRR12671337.sra Written 1402650 spots for SRR12671337.sra Read 1402650 spots for SRR12671337.sra Written 1402650 spots for SRR12671337.sra Read 1402650 spots for SRR12671337.sra Written 1402650 spots for SRR12671337.sra SRR ids: ['SRR12671337.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_rdyzz49j SRR12671337.sra spots: 28053004 blocks: [[1, 1402650], [1402651, 2805300], [2805301, 4207950], [4207951, 5610600], [5610601, 7013250], [7013251, 8415900], [8415901, 9818550], [9818551, 11221200], [11221201, 12623850], [12623851, 14026500], [14026501, 15429150], [15429151, 16831800], [16831801, 18234450], [18234451, 19637100], [19637101, 21039750], [21039751, 22442400], [22442401, 23845050], [23845051, 25247700], [25247701, 26650350], [26650351, 28053004]] SRR12671337 file size 9511937 SRR12671337 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671337 SRR12671337_1.fastq SRR12671337_2.fastq Input file: SRR12671337_1.fastq Paired file: SRR12671337_2.fastq trimmed: SRR12671337-trimmed-pair1.fastq, SRR12671337-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 15:47:43 2025 >> started Tue Feb 11 15:48:14 2025 >> done (30.617s) 28053004 read pairs processed; of these: 133 ( 0.00%) short read pairs filtered out after trimming by size control 2345 ( 0.01%) empty read pairs filtered out after trimming by size control 28050526 (99.99%) read pairs available; of these: 1582999 ( 5.64%) trimmed read pairs available after processing 26467527 (94.36%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 10 0.00% 19 7 0.00% 20 20 0.00% 21 10 0.00% 22 15 0.00% 23 14 0.00% 24 26 0.00% 25 25 0.00% 26 25 0.00% 27 24 0.00% 28 19 0.00% 29 24 0.00% 30 31 0.00% 31 28 0.00% 32 43 0.00% 33 37 0.00% 34 35 0.00% 35 48 0.00% 36 46 0.00% 37 42 0.00% 38 38 0.00% 39 39 0.00% 40 40 0.00% 41 53 0.00% 42 53 0.00% 43 41 0.00% 44 71 0.00% 45 58 0.00% 46 68 0.00% 47 78 0.00% 48 88 0.00% 49 101 0.00% 50 125 0.00% 51 147 0.00% 52 169 0.00% 53 165 0.00% 54 168 0.00% 55 197 0.00% 56 179 0.00% 57 254 0.00% 58 256 0.00% 59 306 0.00% 60 379 0.00% 61 419 0.00% 62 485 0.00% 63 538 0.00% 64 586 0.00% 65 641 0.00% 66 727 0.00% 67 837 0.00% 68 885 0.00% 69 1003 0.00% 70 1250 0.00% 71 1244 0.00% 72 1480 0.01% 73 1632 0.01% 74 1903 0.01% 75 2012 0.01% 76 2362 0.01% 77 2466 0.01% 78 2690 0.01% 79 3069 0.01% 80 3281 0.01% 81 3484 0.01% 82 3986 0.01% 83 4275 0.02% 84 4880 0.02% 85 5219 0.02% 86 5603 0.02% 87 5891 0.02% 88 6484 0.02% 89 6649 0.02% 90 7097 0.03% 91 7362 0.03% 92 7795 0.03% 93 8585 0.03% 94 9191 0.03% 95 9704 0.03% 96 10182 0.04% 97 10537 0.04% 98 11048 0.04% 99 11429 0.04% 100 11944 0.04% 101 12192 0.04% 102 12895 0.05% 103 13522 0.05% 104 14000 0.05% 105 14357 0.05% 106 15102 0.05% 107 15587 0.06% 108 15901 0.06% 109 16599 0.06% 110 16939 0.06% 111 17600 0.06% 112 17980 0.06% 113 18715 0.07% 114 19151 0.07% 115 19915 0.07% 116 20916 0.07% 117 21563 0.08% 118 22162 0.08% 119 22329 0.08% 120 23511 0.08% 121 23832 0.08% 122 24393 0.09% 123 25250 0.09% 124 26245 0.09% 125 26529 0.09% 126 27450 0.10% 127 28152 0.10% 128 29103 0.10% 129 29538 0.11% 130 30687 0.11% 131 30593 0.11% 132 31898 0.11% 133 32880 0.12% 134 32727 0.12% 135 34281 0.12% 136 34850 0.12% 137 35903 0.13% 138 36554 0.13% 139 38734 0.14% 140 37899 0.14% 141 39133 0.14% 142 40017 0.14% 143 40077 0.14% 144 41212 0.15% 145 42061 0.15% 146 43344 0.15% 147 44011 0.16% 148 46440 0.17% 149 45757 0.16% 150 48056 0.17% 151 26467527 94.36% 28050526 reads passed initial QC criterion=sequence-density sequence-density=0.70 sequence-density-rank=1 fanout-score=1.96 fanout-score-rank=30 prefix-density=0.70 prefix-fanout=1.9 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTTCGAGCGAAGAAGGT criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=27.30 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=3.5 sequence=TCAAATATATCGGTGACATCTAAGTTCAATGGGTGGTTTTTGTACATAGCAACAGCACTCTATGAGAAATCATAACGATCAGAGACATTACAAGTTCTAGTGATGATACAAAGGTTGCATCGACAAATACAAATATTTCAAGCTCCTTCCTTGATTAGGCAAGCATGTTCACCAGTGTTCCTCACTTGGGGGTGAAAGCAGAAAAAACGGTGGCATGACCAGGATCTGCAAGGTGAGCAAAGAGGTTGTCGATAGGACCAGTGCCAGTGTAAATGTGTTGGAACCAAGCACCCATGACAGCCAACATAGCCAA criterion=sequence-density sequence-density=0.77 sequence-density-rank=1 fanout-score=2.11 fanout-score-rank=27 prefix-density=0.78 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.15 sequence-density-rank=27 fanout-score=26.80 fanout-score-rank=1 prefix-density=0.37 prefix-fanout=10.9 sequence=AAAGAAAAGAAAA SRR12671337 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 15:48:59 Started mapping on | Feb 11 15:48:59 Finished on | Feb 11 15:52:00 Mapping speed, Million of reads per hour | 557.91 Number of input reads | 28050526 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 26186536 Uniquely mapped reads % | 93.35% Average mapped length | 297.64 Number of splices: Total | 26585342 Number of splices: Annotated (sjdb) | 26092816 Number of splices: GT/AG | 26049493 Number of splices: GC/AG | 453793 Number of splices: AT/AC | 13233 Number of splices: Non-canonical | 68823 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.79 Insertion rate per base | 0.02% Insertion average length | 2.21 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 626851 % of reads mapped to multiple loci | 2.23% Number of reads mapped to too many loci | 58411 % of reads mapped to too many loci | 0.21% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.11% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1237139 1237139 1237139 N_multimapping 626851 626851 626851 N_noFeature 930852 25800545 1060630 N_ambiguous 412383 1600 155221 UnstrandedReadsAssigned:24843301 PositiveStrandReadsAssigned:384391 NegativeStrandReadsAssigned:24970685 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671337 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671337-trimmed-pair1.fastq SRR12671337-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 28,050,526 reads, 24,884,175 reads pseudoaligned [quant] estimated average fragment length: 284.203 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,234 rounds 52401 SRR12671337.ke.tsv 34699 SRR12671337.se.tsv 87100 total ==> SRR12671337.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1734.8 1120 23.3416 Potri.005G024800.1.v4.1 1035 751.797 361 17.3607 Potri.004G059700.1.v4.1 961 677.942 4 0.213318 Potri.007G009000.2.v4.1 1416 1132.8 0 0 Potri.003G141000.2.v4.1 2943 2659.8 1433 19.4786 Potri.016G087400.1.v4.1 270 73.7348 778.697 381.818 Potri.015G069301.1.v4.1 564 295.784 0 0 Potri.010G195200.1.v4.1 1773 1489.8 186 4.51384 Potri.012G127500.1.v4.1 977 693.884 176 9.17037 ==> SRR12671337.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 195 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 320 Potri.001G212900.v4.1 23 Potri.001G182400.v4.1 4 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 28 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 16 SRR12671337 completed mapping pipeline successfully