Starting /dee2/code/volunteer_pipeline.sh SRR12671338 current disk space = 3048281251840 free memory = 1500160356 SRR12671338 SRAfilesize 4c115f2ff1d480b6c876daaaa65b2ce1 SRR12671338.sra SRR12671338.sra file validated SRR12671338 is paired end SRR12671338 is conventional basespace SRR12671338 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671338_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.563 37.0 37.0 37.0 37.0 37.0 2 36.402 37.0 37.0 37.0 37.0 37.0 3 36.581 37.0 37.0 37.0 37.0 37.0 4 36.679 37.0 37.0 37.0 37.0 37.0 5 36.665 37.0 37.0 37.0 37.0 37.0 6 36.615 37.0 37.0 37.0 37.0 37.0 7 36.563 37.0 37.0 37.0 37.0 37.0 8 36.5605 37.0 37.0 37.0 37.0 37.0 9 36.61 37.0 37.0 37.0 37.0 37.0 10-14 36.611200000000004 37.0 37.0 37.0 37.0 37.0 15-19 36.636900000000004 37.0 37.0 37.0 37.0 37.0 20-24 36.592999999999996 37.0 37.0 37.0 37.0 37.0 25-29 36.570899999999995 37.0 37.0 37.0 37.0 37.0 30-34 36.5323 37.0 37.0 37.0 37.0 37.0 35-39 36.5278 37.0 37.0 37.0 37.0 37.0 40-44 36.467800000000004 37.0 37.0 37.0 37.0 37.0 45-49 36.4306 37.0 37.0 37.0 37.0 37.0 50-54 36.4662 37.0 37.0 37.0 37.0 37.0 55-59 36.462599999999995 37.0 37.0 37.0 37.0 37.0 60-64 36.4199 37.0 37.0 37.0 37.0 37.0 65-69 36.3917 37.0 37.0 37.0 37.0 37.0 70-74 36.359 37.0 37.0 37.0 37.0 37.0 75-79 36.324 37.0 37.0 37.0 37.0 37.0 80-84 36.3771 37.0 37.0 37.0 37.0 37.0 85-89 36.296 37.0 37.0 37.0 37.0 37.0 90-94 36.2495 37.0 37.0 37.0 37.0 37.0 95-99 36.2288 37.0 37.0 37.0 37.0 37.0 100-104 36.2613 37.0 37.0 37.0 37.0 37.0 105-109 36.2649 37.0 37.0 37.0 37.0 37.0 110-114 36.1319 37.0 37.0 37.0 37.0 37.0 115-119 36.181400000000004 37.0 37.0 37.0 37.0 37.0 120-124 36.0634 37.0 37.0 37.0 37.0 37.0 125-129 36.0706 37.0 37.0 37.0 37.0 37.0 130-134 36.037699999999994 37.0 37.0 37.0 37.0 37.0 135-139 35.966 37.0 37.0 37.0 37.0 37.0 140-144 35.9542 37.0 37.0 37.0 37.0 37.0 145-149 35.9527 37.0 37.0 37.0 37.0 37.0 150-151 35.76025 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 0.0 20 1.0 21 1.0 22 0.0 23 0.0 24 3.0 25 4.0 26 6.0 27 14.0 28 11.0 29 8.0 30 15.0 31 28.0 32 53.0 33 54.0 34 119.0 35 248.0 36 2954.0 37 480.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.0 12.075 6.75 42.175000000000004 2 19.55867602808425 12.83851554663992 40.79739217652959 26.80541624874624 3 18.475 19.925 26.450000000000003 35.15 4 23.25 26.6 23.799999999999997 26.35 5 24.925 31.8 24.975 18.3 6 19.6 35.175 25.05 20.175 7 14.875 25.45 43.575 16.1 8 16.8 22.425 34.300000000000004 26.474999999999998 9 16.45 21.75 37.05 24.75 10-14 19.505 30.255 27.939999999999998 22.3 15-19 19.885 28.444999999999997 27.42 24.25 20-24 20.674999999999997 27.71 28.765 22.85 25-29 19.84 28.625 28.125 23.41 30-34 19.68 28.96 27.54 23.82 35-39 20.294999999999998 28.125 27.894999999999996 23.685000000000002 40-44 19.814999999999998 29.044999999999998 27.88 23.26 45-49 19.895 27.97 28.384999999999998 23.75 50-54 19.54 28.975 27.815 23.669999999999998 55-59 20.055 28.13 28.24 23.575 60-64 20.11 28.575 28.134999999999998 23.18 65-69 19.485 28.13 28.055000000000003 24.33 70-74 20.485 28.485 27.26 23.77 75-79 20.615 28.58 27.400000000000002 23.405 80-84 20.49 28.144999999999996 27.76 23.605 85-89 21.16 28.83 26.895000000000003 23.115 90-94 20.105 28.46 27.62 23.815 95-99 20.025000000000002 28.165000000000003 27.860000000000003 23.95 100-104 20.515 28.799999999999997 27.224999999999998 23.46 105-109 20.39 29.054999999999996 27.279999999999998 23.275000000000002 110-114 21.445 27.775 27.525 23.255 115-119 20.875 28.82 26.845000000000002 23.46 120-124 20.53 28.799999999999997 27.045 23.625 125-129 20.765 28.605000000000004 26.765 23.865 130-134 20.285 29.294999999999998 26.779999999999998 23.64 135-139 21.305 28.265 26.6 23.830000000000002 140-144 21.295 28.505000000000003 26.474999999999998 23.724999999999998 145-149 21.185000000000002 28.65 26.88 23.285 150-151 21.0 28.050000000000004 26.6125 24.337500000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 1.0 3 1.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.5 10 0.5 11 0.5 12 0.5 13 0.0 14 0.5 15 0.5 16 0.5 17 1.5 18 3.5 19 2.5 20 0.0 21 0.0 22 0.5 23 2.0 24 3.0 25 3.0 26 5.0 27 7.0 28 6.5 29 11.0 30 20.5 31 32.5 32 37.5 33 42.5 34 49.5 35 75.0 36 103.0 37 111.0 38 127.0 39 153.5 40 174.0 41 214.5 42 247.0 43 249.5 44 271.5 45 268.5 46 253.0 47 241.5 48 233.0 49 214.0 50 170.5 51 141.5 52 118.0 53 94.5 54 83.5 55 61.5 56 39.0 57 32.5 58 25.0 59 25.0 60 17.0 61 5.5 62 4.5 63 4.5 64 2.5 65 0.5 66 0.5 67 0.5 68 1.0 69 1.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.3 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 81.875 #Duplication Level Percentage of deduplicated Percentage of total 1 82.50381679389312 67.55 2 13.801526717557252 22.6 3 2.8702290076335877 7.049999999999999 4 0.7022900763358778 2.3 5 0.12213740458015268 0.5 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTATACCCAAGTCAGACGAACGATTTGCACGTCAGTATCGCTGCGGGCCT 5 0.125 No Hit TTCATCTTCTCGAATTCCTCCTTGTAAAGCAATGAGCTACTTGTTGGGAC 5 0.125 No Hit CGGAAGGCTTGACCACCAACTCTGCCACCAGACTTGGCAGCTGATGCATC 5 0.125 No Hit CTCAAGTTCAGAATCACTTACACCAACTGGTAGATGCTGCAACTCGAAAT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.3 0.0 0.0 0.0 0.0 86-87 0.3875 0.0 0.0 0.0 0.0 88-89 0.4625 0.0 0.0 0.0 0.0 90-91 0.5375 0.0 0.0 0.0 0.0 92-93 0.5874999999999999 0.0 0.0 0.0 0.0 94-95 0.775 0.0 0.0 0.0 0.0 96-97 1.0 0.0 0.0 0.0 0.0 98-99 1.175 0.0 0.0 0.0 0.0 100-101 1.5 0.0 0.0 0.0 0.0 102-103 1.675 0.0 0.0 0.0 0.0 104-105 1.9500000000000002 0.0 0.0 0.0 0.0 106-107 2.3625 0.0 0.0 0.0 0.0 108-109 2.65 0.0 0.0 0.0 0.0 110-111 2.8875 0.0 0.0 0.0 0.0 112-113 3.1375 0.0 0.0 0.0 0.0 114-115 3.45 0.0 0.0 0.0 0.0 116-117 3.7375 0.0 0.0 0.0 0.0 118-119 4.0875 0.0 0.0 0.0 0.0 120-121 4.3375 0.0 0.0 0.0 0.0 122-123 4.9 0.0 0.0 0.0 0.0 124-125 5.4375 0.0 0.0 0.0 0.0 126-127 6.0 0.0 0.0 0.0 0.0 128-129 6.2875 0.0 0.0 0.0 0.0 130-131 6.6 0.0 0.0 0.0 0.0 132-133 7.0375 0.0 0.0 0.0 0.0 134-135 7.575 0.0 0.0 0.0 0.0 136-137 8.1375 0.0 0.0 0.0 0.0 138-139 8.787500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGGTCAC 15 1.1411342E-4 145.0 2 GTCACAG 10 0.006830828 145.0 4 CAGAGCA 10 0.006830828 145.0 8 AGAGCAA 10 0.006830828 145.0 9 GGGGTCA 15 1.1411342E-4 145.0 1 GGGTGGT 10 0.006830828 145.0 145 >>END_MODULE SRR12671338 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671338_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.277 37.0 37.0 37.0 37.0 37.0 2 36.108 37.0 37.0 37.0 37.0 37.0 3 36.208 37.0 37.0 37.0 37.0 37.0 4 36.3755 37.0 37.0 37.0 37.0 37.0 5 36.3045 37.0 37.0 37.0 37.0 37.0 6 36.222 37.0 37.0 37.0 37.0 37.0 7 36.2765 37.0 37.0 37.0 37.0 37.0 8 36.4555 37.0 37.0 37.0 37.0 37.0 9 36.2655 37.0 37.0 37.0 37.0 37.0 10-14 36.317099999999996 37.0 37.0 37.0 37.0 37.0 15-19 36.3168 37.0 37.0 37.0 37.0 37.0 20-24 36.2247 37.0 37.0 37.0 37.0 37.0 25-29 36.3086 37.0 37.0 37.0 37.0 37.0 30-34 36.2325 37.0 37.0 37.0 37.0 37.0 35-39 36.196299999999994 37.0 37.0 37.0 37.0 37.0 40-44 36.164300000000004 37.0 37.0 37.0 37.0 37.0 45-49 36.2232 37.0 37.0 37.0 37.0 37.0 50-54 36.1448 37.0 37.0 37.0 37.0 37.0 55-59 36.124199999999995 37.0 37.0 37.0 37.0 37.0 60-64 36.067 37.0 37.0 37.0 37.0 37.0 65-69 36.1104 37.0 37.0 37.0 37.0 37.0 70-74 36.0638 37.0 37.0 37.0 37.0 37.0 75-79 36.0417 37.0 37.0 37.0 37.0 37.0 80-84 35.9947 37.0 37.0 37.0 37.0 37.0 85-89 36.0531 37.0 37.0 37.0 37.0 37.0 90-94 36.029399999999995 37.0 37.0 37.0 37.0 37.0 95-99 35.9636 37.0 37.0 37.0 37.0 37.0 100-104 35.963 37.0 37.0 37.0 37.0 37.0 105-109 35.84739999999999 37.0 37.0 37.0 37.0 37.0 110-114 35.7992 37.0 37.0 37.0 37.0 37.0 115-119 35.8543 37.0 37.0 37.0 37.0 37.0 120-124 35.785000000000004 37.0 37.0 37.0 37.0 37.0 125-129 35.730900000000005 37.0 37.0 37.0 37.0 37.0 130-134 35.6588 37.0 37.0 37.0 37.0 37.0 135-139 35.4704 37.0 37.0 37.0 37.0 37.0 140-144 35.4538 37.0 37.0 37.0 37.0 37.0 145-149 35.265 37.0 37.0 37.0 34.6 37.0 150-151 35.067499999999995 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 0.0 15 3.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 3.0 22 5.0 23 5.0 24 3.0 25 6.0 26 11.0 27 10.0 28 18.0 29 22.0 30 22.0 31 27.0 32 54.0 33 117.0 34 197.0 35 500.0 36 2648.0 37 348.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.25 19.400000000000002 12.425 29.925 2 24.099999999999998 25.624999999999996 34.5 15.775 3 19.75 26.724999999999998 34.1 19.425 4 24.875 32.4 23.575 19.15 5 25.15 37.275000000000006 21.75 15.825 6 19.05 39.4 24.05 17.5 7 19.650000000000002 19.5 42.025 18.825 8 19.225 25.15 30.8 24.825 9 21.95 24.099999999999998 31.424999999999997 22.525000000000002 10-14 22.915 29.104999999999997 26.939999999999998 21.04 15-19 23.14 28.175 27.955000000000002 20.73 20-24 22.52 28.825 27.55 21.105 25-29 22.5 28.144999999999996 28.82 20.535 30-34 22.615 27.485 28.74 21.16 35-39 22.865 27.55 28.215 21.37 40-44 22.96 28.22 27.715 21.105 45-49 22.13 27.92 28.74 21.21 50-54 22.97 27.955000000000002 27.99 21.085 55-59 22.56 27.82 28.425 21.195 60-64 22.595000000000002 27.21 28.515 21.68 65-69 22.915 27.88 28.515 20.69 70-74 23.05 27.855 27.73 21.365000000000002 75-79 22.435 27.68 28.494999999999997 21.39 80-84 23.02 28.365000000000002 27.495000000000005 21.12 85-89 23.13 28.59 27.715 20.565 90-94 22.82 28.310000000000002 28.02 20.849999999999998 95-99 23.244999999999997 27.639999999999997 27.85 21.265 100-104 23.365 27.779999999999998 28.415000000000003 20.44 105-109 23.080000000000002 27.49 28.560000000000002 20.87 110-114 23.880000000000003 27.794999999999998 28.050000000000004 20.275000000000002 115-119 24.075 28.83 27.255000000000003 19.84 120-124 24.044999999999998 28.23 27.43 20.294999999999998 125-129 24.349999999999998 28.615000000000002 26.834999999999997 20.200000000000003 130-134 24.93 27.775 27.595 19.7 135-139 25.335 27.43 26.935 20.3 140-144 25.080000000000002 27.92 27.125 19.875 145-149 26.21 27.595 26.91 19.285 150-151 26.5125 28.075 26.375 19.037499999999998 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 1.0 9 1.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.5 16 1.0 17 0.5 18 1.0 19 2.0 20 2.5 21 1.5 22 1.5 23 2.0 24 2.0 25 3.5 26 4.0 27 6.5 28 7.0 29 10.5 30 15.5 31 19.0 32 28.0 33 44.0 34 58.5 35 70.5 36 94.0 37 115.0 38 146.0 39 173.5 40 197.5 41 233.5 42 263.5 43 285.5 44 285.5 45 251.5 46 233.5 47 236.5 48 217.5 49 200.0 50 172.5 51 135.0 52 107.5 53 74.5 54 62.0 55 64.0 56 47.5 57 34.5 58 22.5 59 18.0 60 13.0 61 8.0 62 11.0 63 5.0 64 0.5 65 0.5 66 0.5 67 0.0 68 0.5 69 0.5 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.5 84 1.0 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 82.22500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 82.9735481909395 68.22500000000001 2 13.377926421404682 22.0 3 2.918820310124658 7.199999999999999 4 0.5776831863788386 1.9 5 0.12161751292186075 0.5 6 0.0 0.0 7 0.030404378230465188 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAGAACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 7 0.17500000000000002 No Hit GGAAAGAAATGCTCATGCCTAAAGATCCCAATGCCACTGTCATTATGCTT 5 0.125 No Hit GGCTGCTGAAGACAATAGGGACAACCTATCAGCACTTATGGTTACATATC 5 0.125 No Hit AACACAAGTAAGAACCCAAAAGAATTTCACACGACACCAGAGTAGTCATA 5 0.125 No Hit GTCTGACATGTGTGCGAGTCAACGGGCGAGTAAACCCGTAAGGCGCAAGG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.3 0.0 0.0 0.0 0.0 86-87 0.3875 0.0 0.0 0.0 0.0 88-89 0.4625 0.0 0.0 0.0 0.0 90-91 0.5375 0.0 0.0 0.0 0.0 92-93 0.5874999999999999 0.0 0.0 0.0 0.0 94-95 0.775 0.0 0.0 0.0 0.0 96-97 1.0125 0.0 0.0 0.0 0.0 98-99 1.2 0.0 0.0 0.0 0.0 100-101 1.525 0.0 0.0 0.0 0.0 102-103 1.7 0.0 0.0 0.0 0.0 104-105 1.975 0.0 0.0 0.0 0.0 106-107 2.3875 0.0 0.0 0.0 0.0 108-109 2.675 0.0 0.0 0.0 0.0 110-111 2.9125 0.0 0.0 0.0 0.0 112-113 3.1625 0.0 0.0 0.0 0.0 114-115 3.5 0.0 0.0 0.0 0.0 116-117 3.825 0.0 0.0 0.0 0.0 118-119 4.2375 0.0 0.0 0.0 0.0 120-121 4.5 0.0 0.0 0.0 0.0 122-123 5.075 0.0 0.0 0.0 0.0 124-125 5.625 0.0 0.0 0.0 0.0 126-127 6.199999999999999 0.0 0.0 0.0 0.0 128-129 6.4875 0.0 0.0 0.0 0.0 130-131 6.8 0.0 0.0 0.0 0.0 132-133 7.262499999999999 0.0 0.0 0.0 0.0 134-135 7.8125 0.0 0.0 0.0 0.0 136-137 8.3875 0.0 0.0 0.0 0.0 138-139 9.0625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TAAGAGG 10 0.006830828 145.0 4 TTTAAGA 10 0.006830828 145.0 2 >>END_MODULE Read 1144229 spots for SRR12671338.sra Written 1144229 spots for SRR12671338.sra Read 1144229 spots for SRR12671338.sra Written 1144229 spots for SRR12671338.sra Read 1144229 spots for SRR12671338.sra Written 1144229 spots for SRR12671338.sra Read 1144229 spots for SRR12671338.sra Written 1144229 spots for SRR12671338.sra Read 1144229 spots for SRR12671338.sra Written 1144229 spots for SRR12671338.sra Read 1144229 spots for SRR12671338.sra Written 1144229 spots for SRR12671338.sra Read 1144229 spots for SRR12671338.sra Written 1144229 spots for SRR12671338.sra Read 1144229 spots for SRR12671338.sra Written 1144229 spots for SRR12671338.sra Read 1144229 spots for SRR12671338.sra Written 1144229 spots for SRR12671338.sra Read 1144229 spots for SRR12671338.sra Written 1144229 spots for SRR12671338.sra Read 1144229 spots for SRR12671338.sra Written 1144229 spots for SRR12671338.sra Read 1144231 spots for SRR12671338.sra Written 1144231 spots for SRR12671338.sra Read 1144229 spots for SRR12671338.sra Written 1144229 spots for SRR12671338.sra Read 1144229 spots for SRR12671338.sra Written 1144229 spots for SRR12671338.sra Read 1144229 spots for SRR12671338.sra Written 1144229 spots for SRR12671338.sra Read 1144229 spots for SRR12671338.sra Written 1144229 spots for SRR12671338.sra Read 1144229 spots for SRR12671338.sra Written 1144229 spots for SRR12671338.sra Read 1144229 spots for SRR12671338.sra Written 1144229 spots for SRR12671338.sra Read 1144229 spots for SRR12671338.sra Written 1144229 spots for SRR12671338.sra Read 1144229 spots for SRR12671338.sra Written 1144229 spots for SRR12671338.sra SRR ids: ['SRR12671338.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_gz8j0qh0 SRR12671338.sra spots: 22884582 blocks: [[1, 1144229], [1144230, 2288458], [2288459, 3432687], [3432688, 4576916], [4576917, 5721145], [5721146, 6865374], [6865375, 8009603], [8009604, 9153832], [9153833, 10298061], [10298062, 11442290], [11442291, 12586519], [12586520, 13730748], [13730749, 14874977], [14874978, 16019206], [16019207, 17163435], [17163436, 18307664], [18307665, 19451893], [19451894, 20596122], [20596123, 21740351], [21740352, 22884582]] SRR12671338 file size 7755481 SRR12671338 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671338 SRR12671338_1.fastq SRR12671338_2.fastq Input file: SRR12671338_1.fastq Paired file: SRR12671338_2.fastq trimmed: SRR12671338-trimmed-pair1.fastq, SRR12671338-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 17:14:05 2025 >> started Tue Feb 11 17:14:38 2025 >> done (32.587s) 22884582 read pairs processed; of these: 65 ( 0.00%) short read pairs filtered out after trimming by size control 2464 ( 0.01%) empty read pairs filtered out after trimming by size control 22882053 (99.99%) read pairs available; of these: 2766200 (12.09%) trimmed read pairs available after processing 20115853 (87.91%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 5 0.00% 20 3 0.00% 21 7 0.00% 22 10 0.00% 23 4 0.00% 24 8 0.00% 25 10 0.00% 26 16 0.00% 27 11 0.00% 28 8 0.00% 29 15 0.00% 30 12 0.00% 31 20 0.00% 32 16 0.00% 33 15 0.00% 34 19 0.00% 35 13 0.00% 36 9 0.00% 37 23 0.00% 38 17 0.00% 39 20 0.00% 40 15 0.00% 41 28 0.00% 42 26 0.00% 43 29 0.00% 44 30 0.00% 45 36 0.00% 46 38 0.00% 47 47 0.00% 48 52 0.00% 49 78 0.00% 50 90 0.00% 51 92 0.00% 52 122 0.00% 53 115 0.00% 54 126 0.00% 55 159 0.00% 56 176 0.00% 57 219 0.00% 58 242 0.00% 59 343 0.00% 60 413 0.00% 61 434 0.00% 62 519 0.00% 63 542 0.00% 64 590 0.00% 65 713 0.00% 66 775 0.00% 67 952 0.00% 68 1041 0.00% 69 1223 0.01% 70 1383 0.01% 71 1639 0.01% 72 1856 0.01% 73 2191 0.01% 74 2444 0.01% 75 2755 0.01% 76 3092 0.01% 77 3383 0.01% 78 3759 0.02% 79 4379 0.02% 80 4644 0.02% 81 5408 0.02% 82 6047 0.03% 83 6656 0.03% 84 7327 0.03% 85 7749 0.03% 86 8420 0.04% 87 9429 0.04% 88 9711 0.04% 89 10549 0.05% 90 11665 0.05% 91 12473 0.05% 92 13262 0.06% 93 14380 0.06% 94 15345 0.07% 95 16369 0.07% 96 17410 0.08% 97 18183 0.08% 98 19149 0.08% 99 19868 0.09% 100 21152 0.09% 101 21741 0.10% 102 23219 0.10% 103 24029 0.11% 104 25480 0.11% 105 26272 0.11% 106 27973 0.12% 107 28765 0.13% 108 29801 0.13% 109 30596 0.13% 110 31149 0.14% 111 32882 0.14% 112 34081 0.15% 113 34526 0.15% 114 36343 0.16% 115 38181 0.17% 116 39260 0.17% 117 40846 0.18% 118 42311 0.18% 119 42319 0.18% 120 43571 0.19% 121 44782 0.20% 122 45791 0.20% 123 46991 0.21% 124 48790 0.21% 125 49176 0.21% 126 51508 0.23% 127 52197 0.23% 128 53288 0.23% 129 54273 0.24% 130 55573 0.24% 131 55738 0.24% 132 57157 0.25% 133 58498 0.26% 134 59127 0.26% 135 60398 0.26% 136 61582 0.27% 137 62199 0.27% 138 63894 0.28% 139 65465 0.29% 140 65766 0.29% 141 66982 0.29% 142 68280 0.30% 143 68592 0.30% 144 69175 0.30% 145 70538 0.31% 146 71404 0.31% 147 71703 0.31% 148 73508 0.32% 149 73868 0.32% 150 75003 0.33% 151 20115853 87.91% 22882053 reads passed initial QC criterion=sequence-density sequence-density=0.38 sequence-density-rank=1 fanout-score=2.21 fanout-score-rank=27 prefix-density=0.39 prefix-fanout=2.1 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=37 fanout-score=595.35 fanout-score-rank=1 prefix-density=0.28 prefix-fanout=19.3 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAG criterion=sequence-density sequence-density=0.72 sequence-density-rank=1 fanout-score=2.04 fanout-score-rank=29 prefix-density=0.72 prefix-fanout=2.0 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTCTTCA criterion=fanout-score sequence-density=0.02 sequence-density-rank=28 fanout-score=36.78 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=6.9 sequence=AAACAAGAGAGGTGGAGATATAGGAGAGCATAACCATGTTAGTCCCATATATTTCCAAGATGAAGGCCTTTCTTATCGCATGCATTCTCTTAGCTACCATCGTCTTCTCTCCCCTGTCCACTTGCACTGCTCGAGAATT SRR12671338 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 17:15:23 Started mapping on | Feb 11 17:15:23 Finished on | Feb 11 17:18:17 Mapping speed, Million of reads per hour | 473.42 Number of input reads | 22882053 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 21351332 Uniquely mapped reads % | 93.31% Average mapped length | 294.31 Number of splices: Total | 20981553 Number of splices: Annotated (sjdb) | 20522017 Number of splices: GT/AG | 20554447 Number of splices: GC/AG | 347196 Number of splices: AT/AC | 11492 Number of splices: Non-canonical | 68418 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.88 Insertion rate per base | 0.02% Insertion average length | 2.31 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 543339 % of reads mapped to multiple loci | 2.37% Number of reads mapped to too many loci | 34536 % of reads mapped to too many loci | 0.15% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.05% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 987382 987382 987382 N_multimapping 543339 543339 543339 N_noFeature 835591 21061094 950260 N_ambiguous 311631 1394 135398 UnstrandedReadsAssigned:20204110 PositiveStrandReadsAssigned:288844 NegativeStrandReadsAssigned:20265674 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671338 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671338-trimmed-pair1.fastq SRR12671338-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,882,053 reads, 20,257,927 reads pseudoaligned [quant] estimated average fragment length: 254.916 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 997 rounds 52401 SRR12671338.ke.tsv 34699 SRR12671338.se.tsv 87100 total ==> SRR12671338.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1764.08 761 21.5744 Potri.005G024800.1.v4.1 1035 781.084 261 16.7115 Potri.004G059700.1.v4.1 961 707.276 0 0 Potri.007G009000.2.v4.1 1416 1162.08 0 0 Potri.003G141000.2.v4.1 2943 2689.08 1489.54 27.7026 Potri.016G087400.1.v4.1 270 89.4819 656 366.642 Potri.015G069301.1.v4.1 564 325.787 0 0 Potri.010G195200.1.v4.1 1773 1519.08 162 5.33342 Potri.012G127500.1.v4.1 977 723.204 88 6.08548 ==> SRR12671338.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 127 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 310 Potri.001G212900.v4.1 16 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 23 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 15 SRR12671338 completed mapping pipeline successfully