Starting /dee2/code/volunteer_pipeline.sh SRR12671339 current disk space = 3048753848320 free memory = 1468809652 SRR12671339 SRAfilesize 6729ef97a1bebe7229bed7e9efa165fe SRR12671339.sra SRR12671339.sra file validated SRR12671339 is paired end SRR12671339 is conventional basespace SRR12671339 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671339_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.656 37.0 37.0 37.0 37.0 37.0 2 36.3005 37.0 37.0 37.0 37.0 37.0 3 36.6475 37.0 37.0 37.0 37.0 37.0 4 36.622 37.0 37.0 37.0 37.0 37.0 5 36.68 37.0 37.0 37.0 37.0 37.0 6 36.63 37.0 37.0 37.0 37.0 37.0 7 36.632 37.0 37.0 37.0 37.0 37.0 8 36.642 37.0 37.0 37.0 37.0 37.0 9 36.6245 37.0 37.0 37.0 37.0 37.0 10-14 36.6832 37.0 37.0 37.0 37.0 37.0 15-19 36.6278 37.0 37.0 37.0 37.0 37.0 20-24 36.5975 37.0 37.0 37.0 37.0 37.0 25-29 36.5883 37.0 37.0 37.0 37.0 37.0 30-34 36.624100000000006 37.0 37.0 37.0 37.0 37.0 35-39 36.5413 37.0 37.0 37.0 37.0 37.0 40-44 36.52419999999999 37.0 37.0 37.0 37.0 37.0 45-49 36.505399999999995 37.0 37.0 37.0 37.0 37.0 50-54 36.4634 37.0 37.0 37.0 37.0 37.0 55-59 36.456399999999995 37.0 37.0 37.0 37.0 37.0 60-64 36.4367 37.0 37.0 37.0 37.0 37.0 65-69 36.4397 37.0 37.0 37.0 37.0 37.0 70-74 36.4036 37.0 37.0 37.0 37.0 37.0 75-79 36.362700000000004 37.0 37.0 37.0 37.0 37.0 80-84 36.361000000000004 37.0 37.0 37.0 37.0 37.0 85-89 36.316199999999995 37.0 37.0 37.0 37.0 37.0 90-94 36.3096 37.0 37.0 37.0 37.0 37.0 95-99 36.2736 37.0 37.0 37.0 37.0 37.0 100-104 36.271499999999996 37.0 37.0 37.0 37.0 37.0 105-109 36.2756 37.0 37.0 37.0 37.0 37.0 110-114 36.2014 37.0 37.0 37.0 37.0 37.0 115-119 36.1536 37.0 37.0 37.0 37.0 37.0 120-124 36.1579 37.0 37.0 37.0 37.0 37.0 125-129 36.148300000000006 37.0 37.0 37.0 37.0 37.0 130-134 36.101600000000005 37.0 37.0 37.0 37.0 37.0 135-139 36.0284 37.0 37.0 37.0 37.0 37.0 140-144 35.9832 37.0 37.0 37.0 37.0 37.0 145-149 35.997 37.0 37.0 37.0 37.0 37.0 150-151 35.886 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 1.0 22 2.0 23 2.0 24 3.0 25 1.0 26 4.0 27 7.0 28 5.0 29 8.0 30 18.0 31 19.0 32 38.0 33 70.0 34 93.0 35 276.0 36 3045.0 37 407.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.225 11.225 5.7 40.849999999999994 2 18.574297188755022 11.521084337349398 40.2359437751004 29.668674698795183 3 17.75 17.525 28.65 36.075 4 23.875 24.625 23.25 28.249999999999996 5 23.549999999999997 32.025 24.5 19.925 6 18.125 34.55 24.55 22.775000000000002 7 13.325000000000001 25.825 43.824999999999996 17.025000000000002 8 15.825 25.3 32.800000000000004 26.075 9 15.174999999999999 22.7 37.625 24.5 10-14 19.945 29.2 28.01 22.845 15-19 19.8 28.175 27.639999999999997 24.385 20-24 19.405 27.96 28.439999999999998 24.195 25-29 19.835 27.765 28.765 23.635 30-34 19.37 27.994999999999997 28.58 24.055 35-39 19.98 27.99 28.52 23.51 40-44 19.77 27.51 28.77 23.95 45-49 19.715 28.499999999999996 27.894999999999996 23.89 50-54 20.380000000000003 28.375 28.325 22.919999999999998 55-59 20.205000000000002 27.87 27.775 24.15 60-64 19.515 28.735 27.485 24.265 65-69 20.125 27.92 28.015 23.94 70-74 20.825 27.98 27.735 23.46 75-79 20.064999999999998 27.685 28.000000000000004 24.25 80-84 20.22 28.155 28.03 23.595 85-89 20.825 28.754999999999995 27.334999999999997 23.085 90-94 20.06 27.675 27.860000000000003 24.404999999999998 95-99 20.28 28.1 27.41 24.21 100-104 20.65 28.03 28.24 23.080000000000002 105-109 20.435 28.54 27.415 23.61 110-114 20.810000000000002 28.110000000000003 27.175 23.905 115-119 21.175 27.96 27.634999999999998 23.23 120-124 20.995 27.76 28.050000000000004 23.195 125-129 20.945 27.79 27.98 23.285 130-134 20.355 27.045 28.139999999999997 24.46 135-139 20.91 28.115000000000002 27.525 23.45 140-144 20.5 28.17 28.265 23.064999999999998 145-149 21.27 27.839999999999996 27.279999999999998 23.61 150-151 21.025 28.425 27.037499999999998 23.5125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.5 12 0.5 13 0.5 14 1.0 15 0.5 16 0.0 17 0.0 18 0.5 19 0.5 20 1.0 21 2.5 22 3.0 23 3.5 24 2.5 25 7.0 26 9.5 27 8.5 28 8.0 29 12.5 30 25.5 31 36.5 32 37.0 33 34.0 34 42.0 35 61.5 36 82.0 37 92.0 38 111.5 39 155.5 40 187.0 41 204.0 42 222.5 43 233.0 44 276.0 45 292.0 46 253.0 47 247.5 48 253.5 49 230.0 50 176.5 51 145.5 52 132.0 53 104.0 54 84.0 55 67.0 56 48.5 57 30.0 58 20.0 59 13.0 60 11.0 61 10.5 62 6.0 63 5.0 64 3.0 65 0.5 66 0.5 67 0.5 68 1.0 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.4 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 83.275 #Duplication Level Percentage of deduplicated Percentage of total 1 84.68928249774842 70.525 2 11.798258781146803 19.650000000000002 3 2.4917442209546685 6.225 4 0.9006304413089163 3.0 5 0.03002101471029721 0.125 6 0.06004202942059442 0.3 7 0.03002101471029721 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCTTATATTCATGCACAATAGTAGTAAACTTTGTAGGGTTTAGGGTTTCT 7 0.17500000000000002 No Hit GTCGGCTTTCTTTGATATGTCCTCAAACCAACTGATAATGTCATGTTCAT 6 0.15 No Hit CCAGGAAGAGCCATGCCAGACCATTGAACTTGTAGTCATCGTGCTTCTCA 6 0.15 No Hit CGGGCTCCTTGGCAGTGGGTAAGTAGACTGCAGCATTGCACACCAGCACA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1125 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.225 0.0 0.0 0.0 0.0 94-95 0.2875 0.0 0.0 0.0 0.0 96-97 0.375 0.0 0.0 0.0 0.0 98-99 0.45 0.0 0.0 0.0 0.0 100-101 0.5 0.0 0.0 0.0 0.0 102-103 0.55 0.0 0.0 0.0 0.0 104-105 0.5625 0.0 0.0 0.0 0.0 106-107 0.6 0.0 0.0 0.0 0.0 108-109 0.65 0.0 0.0 0.0 0.0 110-111 0.7124999999999999 0.0 0.0 0.0 0.0 112-113 0.8125 0.0 0.0 0.0 0.0 114-115 0.875 0.0 0.0 0.0 0.0 116-117 0.9624999999999999 0.0 0.0 0.0 0.0 118-119 1.0875 0.0 0.0 0.0 0.0 120-121 1.375 0.0 0.0 0.0 0.0 122-123 1.4625 0.0 0.0 0.0 0.0 124-125 1.75 0.0 0.0 0.0 0.0 126-127 1.7875 0.0 0.0 0.0 0.0 128-129 1.9625 0.0 0.0 0.0 0.0 130-131 2.0875 0.0 0.0 0.0 0.0 132-133 2.325 0.0 0.0 0.0 0.0 134-135 2.55 0.0 0.0 0.0 0.0 136-137 2.8125 0.0 0.0 0.0 0.0 138-139 2.9875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GATACCA 10 0.006830828 145.0 145 TGCTGTG 10 0.006830828 145.0 4 TAATCAG 10 0.006830828 145.0 4 ACAAGTT 10 0.006830828 145.0 7 CTGCTGT 10 0.006830828 145.0 3 TGATGTG 10 0.006830828 145.0 9 >>END_MODULE SRR12671339 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671339_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.329 37.0 37.0 37.0 37.0 37.0 2 35.9935 37.0 37.0 37.0 37.0 37.0 3 36.2295 37.0 37.0 37.0 37.0 37.0 4 36.335 37.0 37.0 37.0 37.0 37.0 5 36.365 37.0 37.0 37.0 37.0 37.0 6 36.264 37.0 37.0 37.0 37.0 37.0 7 36.337 37.0 37.0 37.0 37.0 37.0 8 36.3 37.0 37.0 37.0 37.0 37.0 9 36.358 37.0 37.0 37.0 37.0 37.0 10-14 36.343199999999996 37.0 37.0 37.0 37.0 37.0 15-19 36.3527 37.0 37.0 37.0 37.0 37.0 20-24 36.2618 37.0 37.0 37.0 37.0 37.0 25-29 36.223400000000005 37.0 37.0 37.0 37.0 37.0 30-34 36.2059 37.0 37.0 37.0 37.0 37.0 35-39 36.219100000000005 37.0 37.0 37.0 37.0 37.0 40-44 36.2182 37.0 37.0 37.0 37.0 37.0 45-49 36.1117 37.0 37.0 37.0 37.0 37.0 50-54 36.1456 37.0 37.0 37.0 37.0 37.0 55-59 36.1391 37.0 37.0 37.0 37.0 37.0 60-64 36.069100000000006 37.0 37.0 37.0 37.0 37.0 65-69 36.08409999999999 37.0 37.0 37.0 37.0 37.0 70-74 36.046499999999995 37.0 37.0 37.0 37.0 37.0 75-79 36.0629 37.0 37.0 37.0 37.0 37.0 80-84 35.9184 37.0 37.0 37.0 37.0 37.0 85-89 36.0346 37.0 37.0 37.0 37.0 37.0 90-94 35.971599999999995 37.0 37.0 37.0 37.0 37.0 95-99 35.905100000000004 37.0 37.0 37.0 37.0 37.0 100-104 35.909 37.0 37.0 37.0 37.0 37.0 105-109 35.7469 37.0 37.0 37.0 37.0 37.0 110-114 35.795 37.0 37.0 37.0 37.0 37.0 115-119 35.8845 37.0 37.0 37.0 37.0 37.0 120-124 35.7733 37.0 37.0 37.0 37.0 37.0 125-129 35.8263 37.0 37.0 37.0 37.0 37.0 130-134 35.66799999999999 37.0 37.0 37.0 37.0 37.0 135-139 35.6557 37.0 37.0 37.0 37.0 37.0 140-144 35.707 37.0 37.0 37.0 37.0 37.0 145-149 35.67790000000001 37.0 37.0 37.0 37.0 37.0 150-151 35.396249999999995 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 0.0 16 0.0 17 2.0 18 0.0 19 0.0 20 1.0 21 4.0 22 1.0 23 4.0 24 9.0 25 1.0 26 5.0 27 12.0 28 16.0 29 15.0 30 30.0 31 34.0 32 44.0 33 79.0 34 203.0 35 522.0 36 2799.0 37 218.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.05 23.225 7.475 27.250000000000004 2 23.974999999999998 25.3 34.775 15.950000000000001 3 21.224999999999998 24.65 34.300000000000004 19.825 4 23.175 33.5 24.375 18.95 5 24.65 38.2 21.925 15.225 6 19.325 40.525 22.575 17.575 7 20.1 21.775 38.675 19.45 8 18.325 26.525 30.275000000000002 24.875 9 20.724999999999998 24.85 29.099999999999998 25.324999999999996 10-14 22.59 29.880000000000003 26.27 21.26 15-19 22.67 28.194999999999997 27.775 21.36 20-24 22.075 29.065 27.644999999999996 21.215 25-29 22.695 28.58 27.16 21.565 30-34 21.73 28.475 28.16 21.634999999999998 35-39 22.335 28.525 27.76 21.38 40-44 22.38 27.750000000000004 28.105000000000004 21.765 45-49 22.5 27.939999999999998 28.34 21.22 50-54 23.235 28.34 27.29 21.135 55-59 22.775000000000002 28.044999999999998 27.71 21.47 60-64 22.54 28.144999999999996 27.77 21.545 65-69 23.265 28.035 27.500000000000004 21.2 70-74 23.23 28.675 27.045 21.05 75-79 23.24 28.38 27.275 21.105 80-84 23.52 27.37 27.485 21.625 85-89 23.47 27.35 27.825 21.355 90-94 23.455000000000002 27.705000000000002 27.85 20.990000000000002 95-99 23.185 27.54 27.905 21.37 100-104 23.635 27.775 27.265 21.325 105-109 23.185 27.76 28.335 20.72 110-114 23.355 27.965 28.15 20.53 115-119 23.995 28.235 27.51 20.26 120-124 23.52 28.345 27.67 20.465 125-129 23.35 27.98 27.82 20.849999999999998 130-134 23.94 28.54 27.095000000000002 20.424999999999997 135-139 24.65 27.584999999999997 27.060000000000002 20.705000000000002 140-144 24.52 28.1 27.305 20.075000000000003 145-149 24.457445744574457 28.477847784778476 26.65766576657666 20.407040704070408 150-151 25.0375 27.762500000000003 26.75 20.45 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 1.0 21 2.0 22 1.0 23 1.5 24 2.0 25 4.0 26 9.5 27 10.0 28 9.5 29 14.5 30 19.0 31 17.5 32 20.0 33 34.0 34 51.0 35 57.0 36 75.5 37 105.5 38 137.0 39 169.5 40 199.0 41 249.0 42 262.0 43 250.5 44 272.5 45 266.0 46 239.0 47 248.0 48 238.0 49 202.0 50 176.5 51 132.5 52 107.0 53 95.0 54 78.5 55 67.5 56 47.5 57 33.5 58 22.0 59 15.5 60 12.0 61 12.0 62 12.0 63 6.5 64 4.0 65 2.0 66 0.0 67 1.0 68 1.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.5 94 0.5 95 0.5 96 0.5 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.01 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 83.25 #Duplication Level Percentage of deduplicated Percentage of total 1 84.92492492492492 70.7 2 11.471471471471471 19.1 3 2.5525525525525525 6.375 4 0.7807807807807807 2.6 5 0.18018018018018017 0.75 6 0.06006006006006006 0.3 7 0.03003003003003003 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTCTGGAGGCGTTGATTGGAGAAGACAATTCAACATGTGTGGATGAGACA 7 0.17500000000000002 No Hit AGGGAGCACTGCATAGCTTATAAGCTTGTAAGAGATGGCTTCCTCCTCTA 6 0.15 No Hit CCTTAAGATTAAATTTTCATAATTTAGAGAACGATATCTTTCAAATCTTC 6 0.15 No Hit CTCGAATCTCCAATTCCTCGTGGCCATGGCAGCTCAAGCCTCTCTCTTTA 5 0.125 No Hit GTTTCATTGAGCCAAAATGGTTAGCCTACGGTGAGATCATTAACGGACGA 5 0.125 No Hit AAGCCATCCACTCTGGCAGGAGTTAGATTCTTAGAACTACTAGCAGACGA 5 0.125 No Hit GAAGCAGAAGCTAAGTCAGCAATGGCAGCCTCAGTAATGGCTTCATTGAG 5 0.125 No Hit AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 5 0.125 No Hit GGGAAAGTCCAATGCTTCTCTTAAGGAGACAGGCTTTTTTGGAGTTTCAG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1125 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.225 0.0 0.0 0.0 0.0 94-95 0.2875 0.0 0.0 0.0 0.0 96-97 0.375 0.0 0.0 0.0 0.0 98-99 0.45 0.0 0.0 0.0 0.0 100-101 0.5 0.0 0.0 0.0 0.0 102-103 0.55 0.0 0.0 0.0 0.0 104-105 0.5625 0.0 0.0 0.0 0.0 106-107 0.6 0.0 0.0 0.0 0.0 108-109 0.65 0.0 0.0 0.0 0.0 110-111 0.7124999999999999 0.0 0.0 0.0 0.0 112-113 0.8125 0.0 0.0 0.0 0.0 114-115 0.875 0.0 0.0 0.0 0.0 116-117 0.9624999999999999 0.0 0.0 0.0 0.0 118-119 1.075 0.0 0.0 0.0 0.0 120-121 1.35 0.0 0.0 0.0 0.0 122-123 1.4375 0.0 0.0 0.0 0.0 124-125 1.725 0.0 0.0 0.0 0.0 126-127 1.7625 0.0 0.0 0.0 0.0 128-129 1.9625 0.0 0.0 0.0 0.0 130-131 2.0875 0.0 0.0 0.0 0.0 132-133 2.325 0.0 0.0 0.0 0.0 134-135 2.55 0.0 0.0 0.0 0.0 136-137 2.8125 0.0 0.0 0.0 0.0 138-139 2.9875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGAAAAC 10 0.006830828 145.0 1 TGAGGTG 10 0.006830828 145.0 145 CTTGAGT 10 0.006830828 145.0 6 >>END_MODULE Read 1182416 spots for SRR12671339.sra Written 1182416 spots for SRR12671339.sra Read 1182416 spots for SRR12671339.sra Written 1182416 spots for SRR12671339.sra Read 1182416 spots for SRR12671339.sra Written 1182416 spots for SRR12671339.sra Read 1182416 spots for SRR12671339.sra Written 1182416 spots for SRR12671339.sra Read 1182416 spots for SRR12671339.sra Written 1182416 spots for SRR12671339.sra Read 1182416 spots for SRR12671339.sra Written 1182416 spots for SRR12671339.sra Read 1182416 spots for SRR12671339.sra Written 1182416 spots for SRR12671339.sra Read 1182416 spots for SRR12671339.sra Written 1182416 spots for SRR12671339.sra Read 1182416 spots for SRR12671339.sra Written 1182416 spots for SRR12671339.sra Read 1182416 spots for SRR12671339.sra Written 1182416 spots for SRR12671339.sra Read 1182416 spots for SRR12671339.sra Written 1182416 spots for SRR12671339.sra Read 1182416 spots for SRR12671339.sra Written 1182416 spots for SRR12671339.sra Read 1182416 spots for SRR12671339.sra Written 1182416 spots for SRR12671339.sra Read 1182434 spots for SRR12671339.sra Written 1182434 spots for SRR12671339.sra Read 1182416 spots for SRR12671339.sra Written 1182416 spots for SRR12671339.sra Read 1182416 spots for SRR12671339.sra Written 1182416 spots for SRR12671339.sra Read 1182416 spots for SRR12671339.sra Written 1182416 spots for SRR12671339.sra Read 1182416 spots for SRR12671339.sra Written 1182416 spots for SRR12671339.sra Read 1182416 spots for SRR12671339.sra Written 1182416 spots for SRR12671339.sra Read 1182416 spots for SRR12671339.sra Written 1182416 spots for SRR12671339.sra SRR ids: ['SRR12671339.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_fcuotf4_ SRR12671339.sra spots: 23648338 blocks: [[1, 1182416], [1182417, 2364832], [2364833, 3547248], [3547249, 4729664], [4729665, 5912080], [5912081, 7094496], [7094497, 8276912], [8276913, 9459328], [9459329, 10641744], [10641745, 11824160], [11824161, 13006576], [13006577, 14188992], [14188993, 15371408], [15371409, 16553824], [16553825, 17736240], [17736241, 18918656], [18918657, 20101072], [20101073, 21283488], [21283489, 22465904], [22465905, 23648338]] SRR12671339 file size 8015039 SRR12671339 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671339 SRR12671339_1.fastq SRR12671339_2.fastq Input file: SRR12671339_1.fastq Paired file: SRR12671339_2.fastq trimmed: SRR12671339-trimmed-pair1.fastq, SRR12671339-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 16:38:16 2025 >> started Tue Feb 11 16:38:42 2025 >> done (26.269s) 23648338 read pairs processed; of these: 150 ( 0.00%) short read pairs filtered out after trimming by size control 1142 ( 0.00%) empty read pairs filtered out after trimming by size control 23647046 (99.99%) read pairs available; of these: 1091274 ( 4.61%) trimmed read pairs available after processing 22555772 (95.39%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 10 0.00% 20 15 0.00% 21 17 0.00% 22 8 0.00% 23 9 0.00% 24 12 0.00% 25 10 0.00% 26 15 0.00% 27 30 0.00% 28 24 0.00% 29 14 0.00% 30 22 0.00% 31 17 0.00% 32 23 0.00% 33 25 0.00% 34 21 0.00% 35 31 0.00% 36 28 0.00% 37 22 0.00% 38 37 0.00% 39 30 0.00% 40 31 0.00% 41 26 0.00% 42 37 0.00% 43 41 0.00% 44 35 0.00% 45 50 0.00% 46 47 0.00% 47 45 0.00% 48 70 0.00% 49 60 0.00% 50 73 0.00% 51 85 0.00% 52 92 0.00% 53 77 0.00% 54 148 0.00% 55 107 0.00% 56 108 0.00% 57 120 0.00% 58 161 0.00% 59 159 0.00% 60 213 0.00% 61 240 0.00% 62 281 0.00% 63 307 0.00% 64 301 0.00% 65 356 0.00% 66 336 0.00% 67 400 0.00% 68 462 0.00% 69 490 0.00% 70 592 0.00% 71 691 0.00% 72 792 0.00% 73 917 0.00% 74 962 0.00% 75 1063 0.00% 76 1135 0.00% 77 1265 0.01% 78 1446 0.01% 79 1658 0.01% 80 1714 0.01% 81 2042 0.01% 82 2191 0.01% 83 2350 0.01% 84 2601 0.01% 85 2876 0.01% 86 3077 0.01% 87 3290 0.01% 88 3541 0.01% 89 3761 0.02% 90 4037 0.02% 91 4252 0.02% 92 4677 0.02% 93 5062 0.02% 94 5474 0.02% 95 5822 0.02% 96 6000 0.03% 97 6577 0.03% 98 7029 0.03% 99 7258 0.03% 100 7558 0.03% 101 7841 0.03% 102 8117 0.03% 103 8334 0.04% 104 8995 0.04% 105 9375 0.04% 106 9643 0.04% 107 10229 0.04% 108 10444 0.04% 109 11061 0.05% 110 11112 0.05% 111 11601 0.05% 112 12189 0.05% 113 12354 0.05% 114 12808 0.05% 115 13392 0.06% 116 14286 0.06% 117 14556 0.06% 118 14965 0.06% 119 15474 0.07% 120 16019 0.07% 121 16649 0.07% 122 17290 0.07% 123 17382 0.07% 124 17992 0.08% 125 18545 0.08% 126 19382 0.08% 127 19693 0.08% 128 20367 0.09% 129 20915 0.09% 130 22000 0.09% 131 21687 0.09% 132 22468 0.10% 133 22908 0.10% 134 23595 0.10% 135 23996 0.10% 136 24582 0.10% 137 25349 0.11% 138 26131 0.11% 139 27752 0.12% 140 27477 0.12% 141 28474 0.12% 142 29221 0.12% 143 29741 0.13% 144 30521 0.13% 145 30753 0.13% 146 31706 0.13% 147 32251 0.14% 148 33465 0.14% 149 34113 0.14% 150 34982 0.15% 151 22555772 95.39% 23647046 reads passed initial QC criterion=sequence-density sequence-density=0.75 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=25 prefix-density=0.74 prefix-fanout=2.0 sequence=TTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=15.50 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=1.9 sequence=GACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTG criterion=sequence-density sequence-density=0.84 sequence-density-rank=1 fanout-score=2.08 fanout-score-rank=30 prefix-density=0.84 prefix-fanout=2.1 sequence=CCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=88.72 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=3.4 sequence=AGGAACTCAAACGCATAGCTTCCTACAAATACCCCAGCTAGCCAATACTCTCCACCACTAAACCCAAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTCGTCCCCTTCGCTAGCCGGAAAGGCGGTGAAGCTCAACCCCTCCTCCTCTGAGATCATGGGCAATGGCCGTGTCTCCATGAGGAAAACCACCAAGCCTGTTCCCTCCGGGAGCCCATGGTACGGACCAGACCGTGTTAAATACTTGGGCCCGTTCTCTGGTGAGCCCCCATCCTACTTGACTGGTGAGTTCCCTGGTGACTACGGCTGGGACACTGCTGG SRR12671339 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 16:39:26 Started mapping on | Feb 11 16:39:27 Finished on | Feb 11 16:42:10 Mapping speed, Million of reads per hour | 522.27 Number of input reads | 23647046 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 22103726 Uniquely mapped reads % | 93.47% Average mapped length | 298.40 Number of splices: Total | 22415328 Number of splices: Annotated (sjdb) | 22002943 Number of splices: GT/AG | 21964985 Number of splices: GC/AG | 376136 Number of splices: AT/AC | 12012 Number of splices: Non-canonical | 62195 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.96 Insertion rate per base | 0.02% Insertion average length | 2.21 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 522509 % of reads mapped to multiple loci | 2.21% Number of reads mapped to too many loci | 147600 % of reads mapped to too many loci | 0.62% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.55% % of reads unmapped: other | 0.14% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1020811 1020811 1020811 N_multimapping 522509 522509 522509 N_noFeature 827009 21730844 947466 N_ambiguous 391352 1499 137965 UnstrandedReadsAssigned:20885365 PositiveStrandReadsAssigned:371383 NegativeStrandReadsAssigned:21018295 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671339 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671339-trimmed-pair1.fastq SRR12671339-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,647,046 reads, 21,004,491 reads pseudoaligned [quant] estimated average fragment length: 296.419 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,038 rounds 52401 SRR12671339.ke.tsv 34699 SRR12671339.se.tsv 87100 total ==> SRR12671339.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1722.58 1763 42.1966 Potri.005G024800.1.v4.1 1035 739.581 199 11.0936 Potri.004G059700.1.v4.1 961 665.832 0 0 Potri.007G009000.2.v4.1 1416 1120.58 0 0 Potri.003G141000.2.v4.1 2943 2647.58 1183 18.4222 Potri.016G087400.1.v4.1 270 70.5307 872.152 509.823 Potri.015G069301.1.v4.1 564 287.56 0 0 Potri.010G195200.1.v4.1 1773 1477.58 57 1.59048 Potri.012G127500.1.v4.1 977 681.695 48 2.90306 ==> SRR12671339.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 83 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 328 Potri.001G212900.v4.1 15 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 6 SRR12671339 completed mapping pipeline successfully