Starting /dee2/code/volunteer_pipeline.sh SRR12671340 current disk space = 3052871237632 free memory = 1506743560 SRR12671340 SRAfilesize 8bc56e53bbbd0272bdd95e4029a54afd SRR12671340.sra SRR12671340.sra file validated SRR12671340 is paired end SRR12671340 is conventional basespace SRR12671340 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671340_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.631 37.0 37.0 37.0 37.0 37.0 2 36.5155 37.0 37.0 37.0 37.0 37.0 3 36.5915 37.0 37.0 37.0 37.0 37.0 4 36.6685 37.0 37.0 37.0 37.0 37.0 5 36.6575 37.0 37.0 37.0 37.0 37.0 6 36.6885 37.0 37.0 37.0 37.0 37.0 7 36.611 37.0 37.0 37.0 37.0 37.0 8 36.7015 37.0 37.0 37.0 37.0 37.0 9 36.701 37.0 37.0 37.0 37.0 37.0 10-14 36.6395 37.0 37.0 37.0 37.0 37.0 15-19 36.603300000000004 37.0 37.0 37.0 37.0 37.0 20-24 36.5938 37.0 37.0 37.0 37.0 37.0 25-29 36.528000000000006 37.0 37.0 37.0 37.0 37.0 30-34 36.5139 37.0 37.0 37.0 37.0 37.0 35-39 36.4564 37.0 37.0 37.0 37.0 37.0 40-44 36.3765 37.0 37.0 37.0 37.0 37.0 45-49 36.346399999999996 37.0 37.0 37.0 37.0 37.0 50-54 36.3162 37.0 37.0 37.0 37.0 37.0 55-59 36.316 37.0 37.0 37.0 37.0 37.0 60-64 36.2154 37.0 37.0 37.0 37.0 37.0 65-69 36.2093 37.0 37.0 37.0 37.0 37.0 70-74 36.219800000000006 37.0 37.0 37.0 37.0 37.0 75-79 36.206399999999995 37.0 37.0 37.0 37.0 37.0 80-84 36.224199999999996 37.0 37.0 37.0 37.0 37.0 85-89 36.1684 37.0 37.0 37.0 37.0 37.0 90-94 36.145 37.0 37.0 37.0 37.0 37.0 95-99 36.1322 37.0 37.0 37.0 37.0 37.0 100-104 36.1346 37.0 37.0 37.0 37.0 37.0 105-109 36.089800000000004 37.0 37.0 37.0 37.0 37.0 110-114 35.995900000000006 37.0 37.0 37.0 37.0 37.0 115-119 36.0579 37.0 37.0 37.0 37.0 37.0 120-124 35.9297 37.0 37.0 37.0 37.0 37.0 125-129 35.988299999999995 37.0 37.0 37.0 37.0 37.0 130-134 35.953199999999995 37.0 37.0 37.0 37.0 37.0 135-139 35.987 37.0 37.0 37.0 37.0 37.0 140-144 35.81 37.0 37.0 37.0 37.0 37.0 145-149 35.8051 37.0 37.0 37.0 37.0 37.0 150-151 35.704499999999996 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 2.0 18 0.0 19 2.0 20 2.0 21 5.0 22 7.0 23 6.0 24 9.0 25 5.0 26 9.0 27 6.0 28 9.0 29 10.0 30 24.0 31 25.0 32 49.0 33 67.0 34 120.0 35 208.0 36 2930.0 37 505.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 54.2 11.3 6.550000000000001 27.950000000000003 2 21.996996996996998 10.56056056056056 34.30930930930931 33.133133133133136 3 17.825 17.45 31.6 33.125 4 21.875 23.5 26.174999999999997 28.449999999999996 5 21.9 28.499999999999996 26.974999999999998 22.625 6 21.125 32.15 25.275 21.45 7 14.475 27.800000000000004 41.05 16.675 8 16.5 26.174999999999997 35.15 22.175 9 17.075000000000003 24.525 34.949999999999996 23.45 10-14 19.345000000000002 30.915 28.449999999999996 21.29 15-19 20.265 28.205000000000002 28.505000000000003 23.025000000000002 20-24 19.925 29.345 27.415 23.315 25-29 19.465 29.175 28.405 22.955000000000002 30-34 20.355 28.4 28.349999999999998 22.895 35-39 19.465 28.79 28.265 23.48 40-44 20.69 29.555 27.560000000000002 22.195 45-49 20.075000000000003 28.854999999999997 27.42 23.65 50-54 19.695 28.525 27.42 24.36 55-59 19.725 29.310000000000002 27.634999999999998 23.330000000000002 60-64 19.91 28.794999999999998 27.46 23.835 65-69 20.595 28.73 27.139999999999997 23.535 70-74 20.605 28.9 27.35 23.145 75-79 19.869999999999997 28.845 27.04 24.245 80-84 20.05 28.62 27.62 23.71 85-89 20.560000000000002 28.95 27.334999999999997 23.155 90-94 20.9 28.499999999999996 26.745 23.855 95-99 19.965 28.845 27.089999999999996 24.099999999999998 100-104 20.150000000000002 28.64 27.889999999999997 23.32 105-109 21.195 28.139999999999997 27.284999999999997 23.380000000000003 110-114 20.23 28.470000000000002 27.310000000000002 23.990000000000002 115-119 21.505 28.194999999999997 26.605 23.695 120-124 20.76 27.900000000000002 27.500000000000004 23.84 125-129 21.224999999999998 27.42 27.415 23.94 130-134 21.325 28.65 26.55 23.474999999999998 135-139 20.64 28.475 27.200000000000003 23.685000000000002 140-144 20.79 28.29 27.089999999999996 23.830000000000002 145-149 20.705000000000002 28.610000000000003 26.72 23.965 150-151 20.349999999999998 29.275000000000002 26.6 23.775 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 0.5 2 1.5 3 2.5 4 2.0 5 1.0 6 2.5 7 4.0 8 1.5 9 0.5 10 1.5 11 1.5 12 0.5 13 1.0 14 2.0 15 1.0 16 0.0 17 1.5 18 2.5 19 1.5 20 2.0 21 5.0 22 7.0 23 5.5 24 5.5 25 6.0 26 10.5 27 15.0 28 18.5 29 21.0 30 20.5 31 24.0 32 35.0 33 47.0 34 64.0 35 85.5 36 98.0 37 119.0 38 145.0 39 155.5 40 167.0 41 181.5 42 197.0 43 218.0 44 228.0 45 233.5 46 236.5 47 233.0 48 225.0 49 224.0 50 182.0 51 144.0 52 140.0 53 118.5 54 92.5 55 65.0 56 48.0 57 40.5 58 35.0 59 23.0 60 15.5 61 10.0 62 4.0 63 2.5 64 2.5 65 3.5 66 2.0 67 1.0 68 1.0 69 1.5 70 2.0 71 1.0 72 0.5 73 0.5 74 0.5 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.1 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 84.55 #Duplication Level Percentage of deduplicated Percentage of total 1 85.18628030751036 72.02499999999999 2 12.329982259018331 20.849999999999998 3 1.8628030751034892 4.725 4 0.4435245416913069 1.5 5 0.11827321111768185 0.5 6 0.029568302779420463 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.029568302779420463 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 10 0.25 No Hit GCAACGACAGGATATGATGCACAGGTTGCAATACCACACATGTTCTTCCC 6 0.15 No Hit GCTTGCTTCTGATGGCAGTGGAGAACTTCCTGCTTCTGGTGTAGTGCTAG 5 0.125 No Hit CCTTCACTACCAAGCAAAAACTAATATGCTGCAAAGTACAAGCACGAAGC 5 0.125 No Hit CTTCGGCTTGGAGGCGATAAAACTGATGCACTGCACTTGACGAGTGTTGT 5 0.125 No Hit CCTCCATTGCCTACTTTTTACAATAGTAGATTCTCCTCTTGCGTCAAGCA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.1375 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.2375 0.0 0.0 0.0 0.0 94-95 0.3 0.0 0.0 0.0 0.0 96-97 0.35 0.0 0.0 0.0 0.0 98-99 0.35 0.0 0.0 0.0 0.0 100-101 0.5125 0.0 0.0 0.0 0.0 102-103 0.575 0.0 0.0 0.0 0.0 104-105 0.6875 0.0 0.0 0.0 0.0 106-107 0.775 0.0 0.0 0.0 0.0 108-109 0.875 0.0 0.0 0.0 0.0 110-111 1.0125 0.0 0.0 0.0 0.0 112-113 1.1 0.0 0.0 0.0 0.0 114-115 1.1875 0.0 0.0 0.0 0.0 116-117 1.3125 0.0 0.0 0.0 0.0 118-119 1.45 0.0 0.0 0.0 0.0 120-121 1.6 0.0 0.0 0.0 0.0 122-123 1.85 0.0 0.0 0.0 0.0 124-125 2.1875 0.0 0.0 0.0 0.0 126-127 2.35 0.0 0.0 0.0 0.0 128-129 2.5125 0.0 0.0 0.0 0.0 130-131 2.675 0.0 0.0 0.0 0.0 132-133 2.9875 0.0 0.0 0.0 0.0 134-135 3.3 0.0 0.0 0.0 0.0 136-137 3.5875 0.0 0.0 0.0 0.0 138-139 3.8375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCATGCT 10 0.006830828 145.0 4 ACTTTTA 10 0.006830828 145.0 5 AGACAAT 10 0.006830828 145.0 7 TTTGCAT 10 0.006830828 145.0 9 >>END_MODULE SRR12671340 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671340_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.189 37.0 37.0 37.0 37.0 37.0 2 36.01 37.0 37.0 37.0 37.0 37.0 3 36.159 37.0 37.0 37.0 37.0 37.0 4 36.143 37.0 37.0 37.0 37.0 37.0 5 36.1395 37.0 37.0 37.0 37.0 37.0 6 36.1635 37.0 37.0 37.0 37.0 37.0 7 36.076 37.0 37.0 37.0 37.0 37.0 8 36.1385 37.0 37.0 37.0 37.0 37.0 9 36.2175 37.0 37.0 37.0 37.0 37.0 10-14 36.2162 37.0 37.0 37.0 37.0 37.0 15-19 36.2053 37.0 37.0 37.0 37.0 37.0 20-24 36.1542 37.0 37.0 37.0 37.0 37.0 25-29 36.1146 37.0 37.0 37.0 37.0 37.0 30-34 36.0339 37.0 37.0 37.0 37.0 37.0 35-39 36.0428 37.0 37.0 37.0 37.0 37.0 40-44 35.988899999999994 37.0 37.0 37.0 37.0 37.0 45-49 35.9815 37.0 37.0 37.0 37.0 37.0 50-54 35.9807 37.0 37.0 37.0 37.0 37.0 55-59 35.9465 37.0 37.0 37.0 37.0 37.0 60-64 35.9077 37.0 37.0 37.0 37.0 37.0 65-69 35.8769 37.0 37.0 37.0 37.0 37.0 70-74 35.8529 37.0 37.0 37.0 37.0 37.0 75-79 35.8164 37.0 37.0 37.0 37.0 37.0 80-84 35.77810000000001 37.0 37.0 37.0 37.0 37.0 85-89 35.8453 37.0 37.0 37.0 37.0 37.0 90-94 35.8087 37.0 37.0 37.0 37.0 37.0 95-99 35.773399999999995 37.0 37.0 37.0 37.0 37.0 100-104 35.7548 37.0 37.0 37.0 37.0 37.0 105-109 35.7178 37.0 37.0 37.0 37.0 37.0 110-114 35.6843 37.0 37.0 37.0 37.0 37.0 115-119 35.7819 37.0 37.0 37.0 37.0 37.0 120-124 35.7075 37.0 37.0 37.0 37.0 37.0 125-129 35.637499999999996 37.0 37.0 37.0 37.0 37.0 130-134 35.558299999999996 37.0 37.0 37.0 37.0 37.0 135-139 35.472300000000004 37.0 37.0 37.0 37.0 37.0 140-144 35.561099999999996 37.0 37.0 37.0 37.0 37.0 145-149 35.482299999999995 37.0 37.0 37.0 37.0 37.0 150-151 35.27625 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 3.0 14 6.0 15 3.0 16 4.0 17 3.0 18 2.0 19 1.0 20 3.0 21 5.0 22 6.0 23 7.0 24 11.0 25 10.0 26 9.0 27 10.0 28 12.0 29 24.0 30 21.0 31 29.0 32 59.0 33 83.0 34 182.0 35 482.0 36 2759.0 37 265.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 49.675000000000004 28.275 6.575 15.475 2 29.675 24.325 28.15 17.849999999999998 3 22.3 26.85 34.55 16.3 4 25.924999999999997 33.625 24.099999999999998 16.35 5 26.900000000000002 39.225 19.0 14.875 6 22.3 40.300000000000004 19.7 17.7 7 20.674999999999997 23.9 37.175000000000004 18.25 8 21.25 26.125 28.749999999999996 23.875 9 23.175 24.3 28.95 23.575 10-14 24.560000000000002 28.84 26.284999999999997 20.315 15-19 24.255 27.894999999999996 27.200000000000003 20.65 20-24 23.549999999999997 28.83 26.340000000000003 21.279999999999998 25-29 24.15 28.46 26.765 20.625 30-34 23.78 28.02 27.115000000000002 21.085 35-39 23.830000000000002 27.595 27.07 21.505 40-44 23.580000000000002 27.99 27.615000000000002 20.815 45-49 24.305 27.85 27.35 20.495 50-54 23.27 28.449999999999996 27.38 20.9 55-59 23.635 27.884999999999998 27.46 21.02 60-64 23.75 27.495000000000005 27.355 21.4 65-69 24.05 27.560000000000002 27.08 21.310000000000002 70-74 23.974999999999998 27.3 27.634999999999998 21.09 75-79 23.77 27.534999999999997 27.185 21.51 80-84 23.605 28.15 26.619999999999997 21.625 85-89 24.48 28.24 26.85 20.43 90-94 24.68 27.815 26.93 20.575 95-99 23.445 27.939999999999998 26.745 21.87 100-104 24.235 28.205000000000002 26.775 20.785 105-109 24.415 27.900000000000002 26.935 20.75 110-114 24.474999999999998 27.810000000000002 27.18 20.535 115-119 24.415 28.17 26.77 20.645 120-124 24.205 27.750000000000004 27.425 20.62 125-129 24.224999999999998 28.105000000000004 27.505000000000003 20.165 130-134 24.495 27.015 27.589999999999996 20.9 135-139 24.95 27.305 27.505000000000003 20.24 140-144 24.335 27.334999999999997 27.185 21.145 145-149 24.945 28.255000000000003 26.985 19.814999999999998 150-151 24.875 27.1375 27.8375 20.150000000000002 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 1.0 7 1.0 8 0.0 9 1.0 10 1.0 11 1.5 12 2.0 13 1.0 14 1.0 15 1.0 16 1.0 17 0.5 18 0.0 19 0.5 20 0.5 21 0.5 22 1.5 23 3.0 24 4.0 25 4.0 26 7.0 27 12.5 28 12.0 29 8.5 30 13.0 31 20.5 32 25.5 33 30.0 34 42.0 35 56.0 36 69.0 37 89.0 38 106.0 39 138.5 40 183.5 41 194.0 42 217.0 43 259.0 44 274.5 45 267.0 46 258.5 47 252.0 48 236.5 49 215.0 50 184.0 51 148.0 52 132.0 53 123.5 54 90.5 55 70.0 56 61.5 57 43.0 58 30.5 59 25.5 60 17.5 61 11.0 62 6.5 63 6.0 64 4.0 65 1.5 66 1.5 67 0.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.5 73 1.0 74 0.5 75 0.5 76 0.5 77 0.0 78 0.0 79 1.0 80 1.0 81 0.5 82 2.5 83 2.0 84 1.0 85 1.0 86 0.5 87 0.5 88 0.5 89 0.5 90 0.0 91 1.5 92 1.5 93 0.0 94 0.0 95 1.0 96 1.5 97 0.5 98 0.0 99 0.0 100 4.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 84.425 #Duplication Level Percentage of deduplicated Percentage of total 1 85.22357121705656 71.95 2 12.259401835949067 20.7 3 1.7767249037607342 4.5 4 0.5626295528575659 1.9 5 0.11844832691738229 0.5 6 0.029612081729345572 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.029612081729345572 0.3 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 12 0.3 No Hit GTTAGCGTTGCGTTCGAGGTAGTAGGTAGTTTCCGTCTGTACAAGGAAGG 6 0.15 No Hit AGGGAGCACTGCATAGCTTACAAGCTTGTAAGAGATGGCTTCCTCCTCTA 5 0.125 No Hit GCCATCTCTTTCTGCTCTAATTACCACTCAGAAAAAACTAACTCCTGGTA 5 0.125 No Hit AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 5 0.125 No Hit ATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAAT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.1375 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.2375 0.0 0.0 0.0 0.0 94-95 0.3 0.0 0.0 0.0 0.0 96-97 0.35 0.0 0.0 0.0 0.0 98-99 0.3625 0.0 0.0 0.0 0.0 100-101 0.5375 0.0 0.0 0.0 0.0 102-103 0.6 0.0 0.0 0.0 0.0 104-105 0.7125 0.0 0.0 0.0 0.0 106-107 0.8 0.0 0.0 0.0 0.0 108-109 0.8999999999999999 0.0 0.0 0.0 0.0 110-111 1.0375 0.0 0.0 0.0 0.0 112-113 1.125 0.0 0.0 0.0 0.0 114-115 1.2125 0.0 0.0 0.0 0.0 116-117 1.3375 0.0 0.0 0.0 0.0 118-119 1.475 0.0 0.0 0.0 0.0 120-121 1.625 0.0 0.0 0.0 0.0 122-123 1.85 0.0 0.0 0.0 0.0 124-125 2.1875 0.0 0.0 0.0 0.0 126-127 2.35 0.0 0.0 0.0 0.0 128-129 2.5125 0.0 0.0 0.0 0.0 130-131 2.675 0.0 0.0 0.0 0.0 132-133 2.975 0.0 0.0 0.0 0.0 134-135 3.2750000000000004 0.0 0.0 0.0 0.0 136-137 3.55 0.0 0.0 0.0 0.0 138-139 3.7875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 858014 spots for SRR12671340.sra Written 858014 spots for SRR12671340.sra Read 858014 spots for SRR12671340.sra Written 858014 spots for SRR12671340.sra Read 858014 spots for SRR12671340.sra Written 858014 spots for SRR12671340.sra Read 858014 spots for SRR12671340.sra Written 858014 spots for SRR12671340.sra Read 858014 spots for SRR12671340.sra Written 858014 spots for SRR12671340.sra Read 858014 spots for SRR12671340.sra Written 858014 spots for SRR12671340.sra Read 858014 spots for SRR12671340.sra Written 858014 spots for SRR12671340.sra Read 858014 spots for SRR12671340.sra Written 858014 spots for SRR12671340.sra Read 858014 spots for SRR12671340.sra Written 858014 spots for SRR12671340.sra Read 858014 spots for SRR12671340.sra Written 858014 spots for SRR12671340.sra Read 858014 spots for SRR12671340.sra Written 858014 spots for SRR12671340.sra Read 858014 spots for SRR12671340.sra Written 858014 spots for SRR12671340.sra Read 858014 spots for SRR12671340.sra Written 858014 spots for SRR12671340.sra Read 858014 spots for SRR12671340.sra Written 858014 spots for SRR12671340.sra Read 858014 spots for SRR12671340.sra Written 858014 spots for SRR12671340.sra Read 858014 spots for SRR12671340.sra Written 858014 spots for SRR12671340.sra Read 858014 spots for SRR12671340.sra Written 858014 spots for SRR12671340.sra Read 858014 spots for SRR12671340.sra Written 858014 spots for SRR12671340.sra Read 858014 spots for SRR12671340.sra Written 858014 spots for SRR12671340.sra Read 858014 spots for SRR12671340.sra Written 858014 spots for SRR12671340.sra SRR ids: ['SRR12671340.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_m4t9fbo2 SRR12671340.sra spots: 17160280 blocks: [[1, 858014], [858015, 1716028], [1716029, 2574042], [2574043, 3432056], [3432057, 4290070], [4290071, 5148084], [5148085, 6006098], [6006099, 6864112], [6864113, 7722126], [7722127, 8580140], [8580141, 9438154], [9438155, 10296168], [10296169, 11154182], [11154183, 12012196], [12012197, 12870210], [12870211, 13728224], [13728225, 14586238], [14586239, 15444252], [15444253, 16302266], [16302267, 17160280]] SRR12671340 file size 5810113 SRR12671340 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671340 SRR12671340_1.fastq SRR12671340_2.fastq Input file: SRR12671340_1.fastq Paired file: SRR12671340_2.fastq trimmed: SRR12671340-trimmed-pair1.fastq, SRR12671340-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 17:57:51 2025 >> started Tue Feb 11 17:58:10 2025 >> done (18.978s) 17160280 read pairs processed; of these: 106 ( 0.00%) short read pairs filtered out after trimming by size control 41075 ( 0.24%) empty read pairs filtered out after trimming by size control 17119099 (99.76%) read pairs available; of these: 966191 ( 5.64%) trimmed read pairs available after processing 16152908 (94.36%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 19 0.00% 20 22 0.00% 21 10 0.00% 22 18 0.00% 23 21 0.00% 24 36 0.00% 25 19 0.00% 26 32 0.00% 27 36 0.00% 28 31 0.00% 29 28 0.00% 30 51 0.00% 31 26 0.00% 32 32 0.00% 33 35 0.00% 34 26 0.00% 35 50 0.00% 36 36 0.00% 37 34 0.00% 38 36 0.00% 39 26 0.00% 40 34 0.00% 41 38 0.00% 42 47 0.00% 43 55 0.00% 44 40 0.00% 45 35 0.00% 46 45 0.00% 47 43 0.00% 48 68 0.00% 49 63 0.00% 50 62 0.00% 51 73 0.00% 52 78 0.00% 53 86 0.00% 54 89 0.00% 55 119 0.00% 56 110 0.00% 57 127 0.00% 58 134 0.00% 59 173 0.00% 60 217 0.00% 61 225 0.00% 62 302 0.00% 63 294 0.00% 64 308 0.00% 65 394 0.00% 66 382 0.00% 67 424 0.00% 68 503 0.00% 69 539 0.00% 70 673 0.00% 71 734 0.00% 72 865 0.01% 73 945 0.01% 74 1057 0.01% 75 1251 0.01% 76 1298 0.01% 77 1370 0.01% 78 1589 0.01% 79 1809 0.01% 80 1917 0.01% 81 2075 0.01% 82 2408 0.01% 83 2483 0.01% 84 2732 0.02% 85 2943 0.02% 86 3303 0.02% 87 3476 0.02% 88 3771 0.02% 89 3883 0.02% 90 4133 0.02% 91 4411 0.03% 92 4687 0.03% 93 5032 0.03% 94 5483 0.03% 95 5913 0.03% 96 6181 0.04% 97 6390 0.04% 98 6606 0.04% 99 6728 0.04% 100 7180 0.04% 101 7350 0.04% 102 7645 0.04% 103 8009 0.05% 104 8503 0.05% 105 8883 0.05% 106 9192 0.05% 107 9855 0.06% 108 9778 0.06% 109 10132 0.06% 110 10230 0.06% 111 10434 0.06% 112 11096 0.06% 113 11281 0.07% 114 11818 0.07% 115 12271 0.07% 116 13023 0.08% 117 13221 0.08% 118 13665 0.08% 119 13860 0.08% 120 14131 0.08% 121 14923 0.09% 122 14843 0.09% 123 15497 0.09% 124 16303 0.10% 125 16401 0.10% 126 16836 0.10% 127 17299 0.10% 128 18108 0.11% 129 18242 0.11% 130 18395 0.11% 131 18902 0.11% 132 19474 0.11% 133 19717 0.12% 134 20173 0.12% 135 21033 0.12% 136 21541 0.13% 137 21616 0.13% 138 22574 0.13% 139 22995 0.13% 140 23519 0.14% 141 23813 0.14% 142 23918 0.14% 143 24791 0.14% 144 25299 0.15% 145 25986 0.15% 146 26500 0.15% 147 26963 0.16% 148 28434 0.17% 149 28411 0.17% 150 30245 0.18% 151 16152908 94.36% 17119099 reads passed initial QC criterion=sequence-density sequence-density=0.86 sequence-density-rank=1 fanout-score=2.06 fanout-score-rank=18 prefix-density=0.87 prefix-fanout=2.0 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=205.50 fanout-score-rank=1 prefix-density=0.26 prefix-fanout=10.7 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTC criterion=sequence-density sequence-density=0.84 sequence-density-rank=1 fanout-score=2.19 fanout-score-rank=20 prefix-density=0.86 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=12.02 fanout-score-rank=1 prefix-density=0.03 prefix-fanout=2.7 sequence=CATTTATAGGGAGCACTGCATAGCTTA SRR12671340 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 17:58:53 Started mapping on | Feb 11 17:58:54 Finished on | Feb 11 18:00:54 Mapping speed, Million of reads per hour | 513.57 Number of input reads | 17119099 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 15824738 Uniquely mapped reads % | 92.44% Average mapped length | 297.60 Number of splices: Total | 15719678 Number of splices: Annotated (sjdb) | 15452209 Number of splices: GT/AG | 15388499 Number of splices: GC/AG | 282938 Number of splices: AT/AC | 8262 Number of splices: Non-canonical | 39979 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.82 Insertion rate per base | 0.02% Insertion average length | 2.05 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 350840 % of reads mapped to multiple loci | 2.05% Number of reads mapped to too many loci | 32166 % of reads mapped to too many loci | 0.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.08% % of reads unmapped: other | 0.25% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 943521 943521 943521 N_multimapping 350840 350840 350840 N_noFeature 443336 15506721 525733 N_ambiguous 345914 1421 109603 UnstrandedReadsAssigned:15035488 PositiveStrandReadsAssigned:316596 NegativeStrandReadsAssigned:15189402 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671340 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671340-trimmed-pair1.fastq SRR12671340-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,119,099 reads, 15,251,403 reads pseudoaligned [quant] estimated average fragment length: 285.598 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,029 rounds 52401 SRR12671340.ke.tsv 34699 SRR12671340.se.tsv 87100 total ==> SRR12671340.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1733.4 394 11.185 Potri.005G024800.1.v4.1 1035 750.402 267 17.5087 Potri.004G059700.1.v4.1 961 676.621 1 0.0727264 Potri.007G009000.2.v4.1 1416 1131.4 0 0 Potri.003G141000.2.v4.1 2943 2658.4 555 10.2733 Potri.016G087400.1.v4.1 270 73.551 624 417.478 Potri.015G069301.1.v4.1 564 295.587 0 0 Potri.010G195200.1.v4.1 1773 1488.4 91 3.00856 Potri.012G127500.1.v4.1 977 692.529 39 2.77117 ==> SRR12671340.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 106 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 305 Potri.001G212900.v4.1 4 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 3 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4 SRR12671340 completed mapping pipeline successfully