Starting /dee2/code/volunteer_pipeline.sh SRR12671341 current disk space = 3049141305344 free memory = 1475777776 SRR12671341 SRAfilesize 41212e4499d89a1d6318460d56e73025 SRR12671341.sra SRR12671341.sra file validated SRR12671341 is paired end SRR12671341 is conventional basespace SRR12671341 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671341_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5865 37.0 37.0 37.0 37.0 37.0 2 36.34325 37.0 37.0 37.0 37.0 37.0 3 36.583 37.0 37.0 37.0 37.0 37.0 4 36.589 37.0 37.0 37.0 37.0 37.0 5 36.634 37.0 37.0 37.0 37.0 37.0 6 36.6085 37.0 37.0 37.0 37.0 37.0 7 36.55 37.0 37.0 37.0 37.0 37.0 8 36.6365 37.0 37.0 37.0 37.0 37.0 9 36.6255 37.0 37.0 37.0 37.0 37.0 10-14 36.6221 37.0 37.0 37.0 37.0 37.0 15-19 36.5839 37.0 37.0 37.0 37.0 37.0 20-24 36.56849999999999 37.0 37.0 37.0 37.0 37.0 25-29 36.5218 37.0 37.0 37.0 37.0 37.0 30-34 36.5269 37.0 37.0 37.0 37.0 37.0 35-39 36.4521 37.0 37.0 37.0 37.0 37.0 40-44 36.472300000000004 37.0 37.0 37.0 37.0 37.0 45-49 36.4465 37.0 37.0 37.0 37.0 37.0 50-54 36.41930000000001 37.0 37.0 37.0 37.0 37.0 55-59 36.3403 37.0 37.0 37.0 37.0 37.0 60-64 36.3882 37.0 37.0 37.0 37.0 37.0 65-69 36.331 37.0 37.0 37.0 37.0 37.0 70-74 36.3345 37.0 37.0 37.0 37.0 37.0 75-79 36.3078 37.0 37.0 37.0 37.0 37.0 80-84 36.307100000000005 37.0 37.0 37.0 37.0 37.0 85-89 36.2476 37.0 37.0 37.0 37.0 37.0 90-94 36.257099999999994 37.0 37.0 37.0 37.0 37.0 95-99 36.242000000000004 37.0 37.0 37.0 37.0 37.0 100-104 36.235400000000006 37.0 37.0 37.0 37.0 37.0 105-109 36.2582 37.0 37.0 37.0 37.0 37.0 110-114 36.16610000000001 37.0 37.0 37.0 37.0 37.0 115-119 36.125099999999996 37.0 37.0 37.0 37.0 37.0 120-124 36.1394 37.0 37.0 37.0 37.0 37.0 125-129 36.0666 37.0 37.0 37.0 37.0 37.0 130-134 36.102599999999995 37.0 37.0 37.0 37.0 37.0 135-139 36.0647 37.0 37.0 37.0 37.0 37.0 140-144 35.9939 37.0 37.0 37.0 37.0 37.0 145-149 35.9891 37.0 37.0 37.0 37.0 37.0 150-151 35.8775 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 0.0 22 2.0 23 4.0 24 2.0 25 5.0 26 1.0 27 6.0 28 13.0 29 24.0 30 21.0 31 25.0 32 44.0 33 60.0 34 108.0 35 239.0 36 2967.0 37 478.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 52.5 10.174999999999999 5.325 32.0 2 20.627352572145547 11.066499372647428 36.31116687578419 31.994981179422837 3 17.474999999999998 18.65 29.875 34.0 4 23.575 25.05 24.25 27.125 5 22.95 33.4 23.05 20.599999999999998 6 18.675 34.8 24.099999999999998 22.425 7 14.549999999999999 25.575 43.625 16.25 8 15.15 24.825 34.849999999999994 25.174999999999997 9 17.575 22.85 34.875 24.7 10-14 19.25 30.025000000000002 27.544999999999998 23.18 15-19 20.275000000000002 28.095 27.965 23.665 20-24 19.965 28.299999999999997 27.875 23.86 25-29 20.41 28.194999999999997 26.995 24.4 30-34 19.650000000000002 28.310000000000002 28.04 24.0 35-39 20.565 27.93 27.815 23.69 40-44 20.155 28.744999999999997 26.88 24.22 45-49 20.150000000000002 29.015 27.029999999999998 23.805 50-54 19.885 28.449999999999996 28.015 23.65 55-59 20.465 28.515 27.439999999999998 23.580000000000002 60-64 20.305 28.735 27.6 23.36 65-69 20.015 28.875 27.034999999999997 24.075 70-74 20.01 28.384999999999998 27.189999999999998 24.415 75-79 20.150000000000002 28.74 27.560000000000002 23.549999999999997 80-84 20.325 28.89 26.834999999999997 23.95 85-89 20.255000000000003 28.025 27.955000000000002 23.765 90-94 20.29 28.405 27.615000000000002 23.69 95-99 20.53 27.955000000000002 28.494999999999997 23.02 100-104 20.75 28.139999999999997 27.38 23.73 105-109 20.27 28.455000000000002 26.974999999999998 24.3 110-114 20.835 27.855 27.505000000000003 23.805 115-119 20.45 27.66 27.865000000000002 24.025 120-124 20.745 28.665000000000003 26.41 24.18 125-129 20.755000000000003 28.775000000000002 26.900000000000002 23.57 130-134 20.724999999999998 28.360000000000003 26.979999999999997 23.935000000000002 135-139 21.335 27.88 27.3 23.485 140-144 20.830000000000002 27.6 27.165 24.404999999999998 145-149 21.105 27.77 26.63 24.495 150-151 21.45 28.5625 26.5 23.4875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 3.0 1 1.5 2 0.0 3 0.0 4 0.5 5 1.0 6 0.5 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 1.5 19 0.5 20 0.5 21 0.5 22 0.5 23 0.5 24 4.0 25 6.0 26 7.0 27 12.0 28 13.0 29 12.5 30 18.0 31 29.5 32 33.0 33 43.0 34 51.0 35 63.5 36 90.5 37 107.5 38 131.5 39 155.5 40 179.5 41 198.0 42 208.5 43 246.5 44 261.0 45 254.5 46 245.0 47 233.5 48 224.0 49 196.0 50 176.5 51 160.0 52 137.5 53 115.5 54 101.5 55 78.5 56 59.5 57 44.5 58 26.5 59 20.0 60 13.5 61 12.0 62 8.0 63 2.0 64 1.5 65 2.0 66 2.5 67 0.5 68 0.5 69 0.5 70 0.0 71 1.0 72 1.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.375 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 84.1 #Duplication Level Percentage of deduplicated Percentage of total 1 84.98810939357907 71.475 2 11.831153388822829 19.900000000000002 3 2.6456599286563613 6.675000000000001 4 0.4161712247324614 1.4000000000000001 5 0.089179548156956 0.375 6 0.0 0.0 7 0.029726516052318665 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGACAAGCAACAAGTCTCAACGACAGTTAGTCAAAAATATAGTTCTTCAA 7 0.17500000000000002 No Hit GCCTGTCCTTGGTTCAATGTTTATGAAGATCCCAACTCCTTGCAAATTTC 5 0.125 No Hit GTCTGACTTGTGGTGGTCTCGGAGAAACTCAAGTCTGGGTACATGCTGCA 5 0.125 No Hit GCCCAGCATACTCTCCAGCAGCACCAGCATTTGGTTGGAATGAGAAAGAG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.35 0.0 0.0 0.0 0.0 92-93 0.4625 0.0 0.0 0.0 0.0 94-95 0.5874999999999999 0.0 0.0 0.0 0.0 96-97 0.7 0.0 0.0 0.0 0.0 98-99 0.7875000000000001 0.0 0.0 0.0 0.0 100-101 0.8 0.0 0.0 0.0 0.0 102-103 0.9375 0.0 0.0 0.0 0.0 104-105 1.0750000000000002 0.0 0.0 0.0 0.0 106-107 1.2000000000000002 0.0 0.0 0.0 0.0 108-109 1.3375 0.0 0.0 0.0 0.0 110-111 1.4125 0.0 0.0 0.0 0.0 112-113 1.5875 0.0 0.0 0.0 0.0 114-115 1.725 0.0 0.0 0.0 0.0 116-117 1.9375 0.0 0.0 0.0 0.0 118-119 2.2125 0.0 0.0 0.0 0.0 120-121 2.55 0.0 0.0 0.0 0.0 122-123 2.775 0.0 0.0 0.0 0.0 124-125 3.075 0.0 0.0 0.0 0.0 126-127 3.325 0.0 0.0 0.0 0.0 128-129 3.5 0.0 0.0 0.0 0.0 130-131 3.875 0.0 0.0 0.0 0.0 132-133 4.1875 0.0 0.0 0.0 0.0 134-135 4.65 0.0 0.0 0.0 0.0 136-137 4.875 0.0 0.0 0.0 0.0 138-139 5.275 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12671341 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671341_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.143 37.0 37.0 37.0 37.0 37.0 2 35.9695 37.0 37.0 37.0 37.0 37.0 3 36.1325 37.0 37.0 37.0 37.0 37.0 4 36.238 37.0 37.0 37.0 37.0 37.0 5 36.299 37.0 37.0 37.0 37.0 37.0 6 36.1375 37.0 37.0 37.0 37.0 37.0 7 36.092 37.0 37.0 37.0 37.0 37.0 8 36.261 37.0 37.0 37.0 37.0 37.0 9 36.324 37.0 37.0 37.0 37.0 37.0 10-14 36.266200000000005 37.0 37.0 37.0 37.0 37.0 15-19 36.2005 37.0 37.0 37.0 37.0 37.0 20-24 36.1583 37.0 37.0 37.0 37.0 37.0 25-29 36.137600000000006 37.0 37.0 37.0 37.0 37.0 30-34 36.1554 37.0 37.0 37.0 37.0 37.0 35-39 36.098699999999994 37.0 37.0 37.0 37.0 37.0 40-44 36.0552 37.0 37.0 37.0 37.0 37.0 45-49 36.1017 37.0 37.0 37.0 37.0 37.0 50-54 36.0484 37.0 37.0 37.0 37.0 37.0 55-59 36.033300000000004 37.0 37.0 37.0 37.0 37.0 60-64 35.9371 37.0 37.0 37.0 37.0 37.0 65-69 35.991 37.0 37.0 37.0 37.0 37.0 70-74 35.9893 37.0 37.0 37.0 37.0 37.0 75-79 35.922000000000004 37.0 37.0 37.0 37.0 37.0 80-84 35.892199999999995 37.0 37.0 37.0 37.0 37.0 85-89 35.9239 37.0 37.0 37.0 37.0 37.0 90-94 35.8922 37.0 37.0 37.0 37.0 37.0 95-99 35.8851 37.0 37.0 37.0 37.0 37.0 100-104 35.8395 37.0 37.0 37.0 37.0 37.0 105-109 35.775999999999996 37.0 37.0 37.0 37.0 37.0 110-114 35.72410000000001 37.0 37.0 37.0 37.0 37.0 115-119 35.8288 37.0 37.0 37.0 37.0 37.0 120-124 35.8092 37.0 37.0 37.0 37.0 37.0 125-129 35.6648 37.0 37.0 37.0 37.0 37.0 130-134 35.627700000000004 37.0 37.0 37.0 37.0 37.0 135-139 35.5249 37.0 37.0 37.0 37.0 37.0 140-144 35.598200000000006 37.0 37.0 37.0 37.0 37.0 145-149 35.5959 37.0 37.0 37.0 37.0 37.0 150-151 35.238749999999996 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 4.0 14 6.0 15 3.0 16 5.0 17 1.0 18 2.0 19 4.0 20 0.0 21 5.0 22 6.0 23 9.0 24 2.0 25 5.0 26 9.0 27 19.0 28 10.0 29 16.0 30 19.0 31 36.0 32 52.0 33 79.0 34 136.0 35 474.0 36 2789.0 37 309.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 50.675000000000004 21.65 8.825 18.85 2 27.125 24.224999999999998 31.0 17.65 3 20.4 27.625 35.325 16.650000000000002 4 24.85 34.0 23.35 17.8 5 27.200000000000003 37.3 19.35 16.150000000000002 6 21.125 38.125 21.8 18.95 7 20.724999999999998 20.4 39.025 19.85 8 18.55 25.174999999999997 29.475 26.8 9 22.05 25.874999999999996 28.249999999999996 23.825 10-14 23.645 29.020000000000003 26.650000000000002 20.685000000000002 15-19 23.89 28.42 26.669999999999998 21.02 20-24 23.235 28.365000000000002 27.275 21.125 25-29 22.93 27.51 28.205000000000002 21.355 30-34 23.215 27.650000000000002 27.76 21.375 35-39 23.39 28.38 27.560000000000002 20.669999999999998 40-44 23.11 28.555000000000003 27.139999999999997 21.195 45-49 23.405 28.255000000000003 27.525 20.815 50-54 22.66 28.63 27.77 20.94 55-59 22.919999999999998 28.535 27.58 20.965 60-64 23.36 27.935 27.500000000000004 21.205 65-69 23.28 27.900000000000002 28.1 20.72 70-74 23.435 27.52 27.575 21.47 75-79 23.235 28.225 27.589999999999996 20.95 80-84 23.82 28.38 26.805 20.995 85-89 23.48 28.505000000000003 27.105 20.91 90-94 24.21 27.97 26.77 21.05 95-99 23.599999999999998 28.144999999999996 27.46 20.794999999999998 100-104 23.89 27.11 27.47 21.529999999999998 105-109 24.015 27.435 27.500000000000004 21.05 110-114 23.880000000000003 27.644999999999996 27.445000000000004 21.029999999999998 115-119 23.875 28.42 26.669999999999998 21.035 120-124 24.46 27.345000000000002 27.58 20.615 125-129 24.0 28.95 26.5 20.549999999999997 130-134 25.235000000000003 27.845 26.334999999999997 20.585 135-139 24.77 27.805000000000003 27.275 20.150000000000002 140-144 25.21 28.325 26.465 20.0 145-149 25.669999999999998 27.38 26.845000000000002 20.105 150-151 25.074999999999996 28.037499999999998 27.487499999999997 19.400000000000002 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.5 3 1.0 4 0.5 5 0.0 6 0.0 7 0.0 8 1.0 9 2.0 10 1.5 11 0.5 12 0.5 13 2.5 14 2.0 15 1.0 16 2.0 17 3.5 18 3.5 19 1.0 20 1.0 21 1.5 22 2.0 23 2.5 24 3.0 25 2.5 26 1.5 27 2.5 28 6.5 29 9.0 30 9.0 31 21.0 32 34.0 33 41.0 34 53.0 35 64.0 36 80.5 37 94.5 38 120.5 39 168.0 40 200.5 41 206.0 42 210.5 43 240.0 44 263.5 45 282.0 46 286.5 47 261.0 48 218.0 49 199.0 50 181.0 51 139.0 52 108.0 53 88.0 54 85.5 55 72.0 56 48.5 57 40.0 58 34.5 59 24.0 60 16.5 61 13.0 62 10.5 63 8.5 64 4.5 65 0.5 66 0.5 67 0.0 68 0.5 69 0.5 70 0.5 71 0.5 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 1.0 90 1.0 91 0.0 92 0.0 93 0.5 94 1.5 95 1.5 96 0.5 97 0.0 98 0.0 99 1.0 100 3.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 84.375 #Duplication Level Percentage of deduplicated Percentage of total 1 85.54074074074074 72.175 2 11.288888888888888 19.05 3 2.666666666666667 6.75 4 0.2962962962962963 1.0 5 0.08888888888888889 0.375 6 0.05925925925925926 0.3 7 0.05925925925925926 0.35000000000000003 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 7 0.17500000000000002 No Hit GTTACTGCAAACCAGGAAGACATTGAGCTTCCAGAAGAGAGTGACTCTGA 7 0.17500000000000002 No Hit GAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCA 6 0.15 No Hit ACCAGGTCCAGACATAGTAAGGATTGACAGACTGAGAGCTCTTTCTTGAT 6 0.15 No Hit AGAGAACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 5 0.125 No Hit GATGCTTTCTACTCTCGGGGATCCTTTTACTCGGATTATCAGTCCAAAGG 5 0.125 No Hit CTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88-89 0.30000000000000004 0.0 0.0 0.0 0.0 90-91 0.375 0.0 0.0 0.0 0.0 92-93 0.5 0.0 0.0 0.0 0.0 94-95 0.6375 0.0 0.0 0.0 0.0 96-97 0.75 0.0 0.0 0.0 0.0 98-99 0.8374999999999999 0.0 0.0 0.0 0.0 100-101 0.85 0.0 0.0 0.0 0.0 102-103 0.9874999999999999 0.0 0.0 0.0 0.0 104-105 1.125 0.0 0.0 0.0 0.0 106-107 1.25 0.0 0.0 0.0 0.0 108-109 1.3875000000000002 0.0 0.0 0.0 0.0 110-111 1.4625 0.0 0.0 0.0 0.0 112-113 1.6375 0.0 0.0 0.0 0.0 114-115 1.775 0.0 0.0 0.0 0.0 116-117 1.9625 0.0 0.0 0.0 0.0 118-119 2.2375 0.0 0.0 0.0 0.0 120-121 2.575 0.0 0.0 0.0 0.0 122-123 2.8 0.0 0.0 0.0 0.0 124-125 3.0999999999999996 0.0 0.0 0.0 0.0 126-127 3.3625 0.0 0.0 0.0 0.0 128-129 3.575 0.0 0.0 0.0 0.0 130-131 3.975 0.0 0.0 0.0 0.0 132-133 4.3125 0.0 0.0 0.0 0.0 134-135 4.725 0.0 0.0 0.0 0.0 136-137 4.949999999999999 0.0 0.0 0.0 0.0 138-139 5.35 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1329847 spots for SRR12671341.sra Written 1329847 spots for SRR12671341.sra Read 1329847 spots for SRR12671341.sra Written 1329847 spots for SRR12671341.sra Read 1329847 spots for SRR12671341.sra Written 1329847 spots for SRR12671341.sra Read 1329847 spots for SRR12671341.sra Written 1329847 spots for SRR12671341.sra Read 1329847 spots for SRR12671341.sra Written 1329847 spots for SRR12671341.sra Read 1329847 spots for SRR12671341.sra Written 1329847 spots for SRR12671341.sra Read 1329847 spots for SRR12671341.sra Written 1329847 spots for SRR12671341.sra Read 1329847 spots for SRR12671341.sra Written 1329847 spots for SRR12671341.sra Read 1329847 spots for SRR12671341.sra Written 1329847 spots for SRR12671341.sra Read 1329847 spots for SRR12671341.sra Written 1329847 spots for SRR12671341.sra Read 1329847 spots for SRR12671341.sra Written 1329847 spots for SRR12671341.sra Read 1329851 spots for SRR12671341.sra Written 1329851 spots for SRR12671341.sra Read 1329847 spots for SRR12671341.sra Written 1329847 spots for SRR12671341.sra Read 1329847 spots for SRR12671341.sra Written 1329847 spots for SRR12671341.sra Read 1329847 spots for SRR12671341.sra Written 1329847 spots for SRR12671341.sra Read 1329847 spots for SRR12671341.sra Written 1329847 spots for SRR12671341.sra Read 1329847 spots for SRR12671341.sra Written 1329847 spots for SRR12671341.sra Read 1329847 spots for SRR12671341.sra Written 1329847 spots for SRR12671341.sra Read 1329847 spots for SRR12671341.sra Written 1329847 spots for SRR12671341.sra Read 1329847 spots for SRR12671341.sra Written 1329847 spots for SRR12671341.sra SRR ids: ['SRR12671341.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_mptyne12 SRR12671341.sra spots: 26596944 blocks: [[1, 1329847], [1329848, 2659694], [2659695, 3989541], [3989542, 5319388], [5319389, 6649235], [6649236, 7979082], [7979083, 9308929], [9308930, 10638776], [10638777, 11968623], [11968624, 13298470], [13298471, 14628317], [14628318, 15958164], [15958165, 17288011], [17288012, 18617858], [18617859, 19947705], [19947706, 21277552], [21277553, 22607399], [22607400, 23937246], [23937247, 25267093], [25267094, 26596944]] SRR12671341 file size 9017104 SRR12671341 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671341 SRR12671341_1.fastq SRR12671341_2.fastq Input file: SRR12671341_1.fastq Paired file: SRR12671341_2.fastq trimmed: SRR12671341-trimmed-pair1.fastq, SRR12671341-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 16:16:01 2025 >> started Tue Feb 11 16:16:29 2025 >> done (28.897s) 26596944 read pairs processed; of these: 158 ( 0.00%) short read pairs filtered out after trimming by size control 13775 ( 0.05%) empty read pairs filtered out after trimming by size control 26583011 (99.95%) read pairs available; of these: 2078832 ( 7.82%) trimmed read pairs available after processing 24504179 (92.18%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 10 0.00% 20 26 0.00% 21 9 0.00% 22 26 0.00% 23 22 0.00% 24 32 0.00% 25 21 0.00% 26 29 0.00% 27 28 0.00% 28 27 0.00% 29 28 0.00% 30 35 0.00% 31 36 0.00% 32 35 0.00% 33 29 0.00% 34 37 0.00% 35 29 0.00% 36 21 0.00% 37 25 0.00% 38 36 0.00% 39 35 0.00% 40 39 0.00% 41 42 0.00% 42 50 0.00% 43 51 0.00% 44 54 0.00% 45 67 0.00% 46 79 0.00% 47 86 0.00% 48 101 0.00% 49 90 0.00% 50 102 0.00% 51 137 0.00% 52 142 0.00% 53 152 0.00% 54 170 0.00% 55 206 0.00% 56 223 0.00% 57 199 0.00% 58 252 0.00% 59 301 0.00% 60 405 0.00% 61 422 0.00% 62 481 0.00% 63 537 0.00% 64 620 0.00% 65 646 0.00% 66 712 0.00% 67 814 0.00% 68 898 0.00% 69 1142 0.00% 70 1272 0.00% 71 1442 0.01% 72 1678 0.01% 73 1803 0.01% 74 2094 0.01% 75 2256 0.01% 76 2603 0.01% 77 2767 0.01% 78 2953 0.01% 79 3312 0.01% 80 3626 0.01% 81 4130 0.02% 82 4503 0.02% 83 4821 0.02% 84 5519 0.02% 85 6023 0.02% 86 6260 0.02% 87 6773 0.03% 88 7342 0.03% 89 7436 0.03% 90 8319 0.03% 91 8842 0.03% 92 9015 0.03% 93 10135 0.04% 94 10952 0.04% 95 11953 0.04% 96 11986 0.05% 97 12582 0.05% 98 13314 0.05% 99 13881 0.05% 100 14615 0.05% 101 15078 0.06% 102 15905 0.06% 103 16692 0.06% 104 17488 0.07% 105 18028 0.07% 106 19182 0.07% 107 19961 0.08% 108 20262 0.08% 109 21311 0.08% 110 21258 0.08% 111 22522 0.08% 112 23451 0.09% 113 23942 0.09% 114 24939 0.09% 115 26226 0.10% 116 27422 0.10% 117 28340 0.11% 118 28876 0.11% 119 29051 0.11% 120 30781 0.12% 121 31890 0.12% 122 32000 0.12% 123 33331 0.13% 124 35271 0.13% 125 35414 0.13% 126 37557 0.14% 127 38006 0.14% 128 39073 0.15% 129 40452 0.15% 130 40992 0.15% 131 41112 0.15% 132 42481 0.16% 133 43942 0.17% 134 44455 0.17% 135 46425 0.17% 136 47087 0.18% 137 48223 0.18% 138 49785 0.19% 139 51895 0.20% 140 51442 0.19% 141 52826 0.20% 142 53872 0.20% 143 54493 0.20% 144 57200 0.22% 145 57438 0.22% 146 58633 0.22% 147 60090 0.23% 148 61984 0.23% 149 62495 0.24% 150 64243 0.24% 151 24504179 92.18% 26583011 reads passed initial QC criterion=sequence-density sequence-density=0.68 sequence-density-rank=1 fanout-score=1.97 fanout-score-rank=35 prefix-density=0.69 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=78.65 fanout-score-rank=1 prefix-density=0.31 prefix-fanout=2.8 sequence=ATCAAGCTTCCGATTAAAGATACATAATTCCATGGAATGGAACCAACAAAGCAGCAGGAAATACAAGACACTTACAGATTACTAGCCATCAAATGAGATCCTGTAGAAAGGATTTGAGGAGGCCATGGCTAGCTAACTGTACTTTAATTTACAGCAAATACTATATTAGACAAACATGGAGTGACCAGACTTCTTCTTTTTATTTATTATAGTTCCATAAAACTGCTTGGTTGGAGCCATGCGGCGACGTTTTCTCATTTGCAGGAGCATGGATCACAGGTGCAGTTTGATCCACATTTGCAGCCATTCTCAGCACCAAAGTTCATCTCAGAGCTCTCGTAGAACATCCTAACTGGAGCTACACCAGCAATGATTGTCTGACTTGTGGTGGTCTCGGAGAAACTCAAGTCTGGGTACATGCTGCATCCATTGCAGCCACTGCCGCACTTGCA criterion=sequence-density sequence-density=1.09 sequence-density-rank=1 fanout-score=2.04 fanout-score-rank=29 prefix-density=1.09 prefix-fanout=2.0 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=66.81 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=9.5 sequence=AAACCCAAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTCCTCCCCTTCGCTAGCCGGAAAGGCGGTGAAGCTCAACCCCTCCTCCTCTGAGATCATGGGCAATGGCCGTGTCTCCATGAGGAAAACCACCAAGCCTGTTCCCTCCGGGAGCCCATGGTACGGACCAGACCGTGTTAAATACTTGGGCCCGTTCTCTGGTGAGCCCCCATCCTACTTGACTGGTGAGTTCCCTGGTGACTACGGCTGGGACACTGCTGG SRR12671341 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 16:17:18 Started mapping on | Feb 11 16:17:18 Finished on | Feb 11 16:20:09 Mapping speed, Million of reads per hour | 559.64 Number of input reads | 26583011 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 24361256 Uniquely mapped reads % | 91.64% Average mapped length | 296.58 Number of splices: Total | 24432989 Number of splices: Annotated (sjdb) | 23985991 Number of splices: GT/AG | 23922451 Number of splices: GC/AG | 427966 Number of splices: AT/AC | 13444 Number of splices: Non-canonical | 69128 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.02% Deletion average length | 2.86 Insertion rate per base | 0.02% Insertion average length | 2.20 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 607164 % of reads mapped to multiple loci | 2.28% Number of reads mapped to too many loci | 154870 % of reads mapped to too many loci | 0.58% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.30% % of reads unmapped: other | 0.19% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1614591 1614591 1614591 N_multimapping 607164 607164 607164 N_noFeature 818504 23931177 967007 N_ambiguous 435318 2015 152679 UnstrandedReadsAssigned:23107434 PositiveStrandReadsAssigned:428064 NegativeStrandReadsAssigned:23241570 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671341 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671341-trimmed-pair1.fastq SRR12671341-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 26,583,011 reads, 23,268,561 reads pseudoaligned [quant] estimated average fragment length: 265.585 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,110 rounds 52401 SRR12671341.ke.tsv 34699 SRR12671341.se.tsv 87100 total ==> SRR12671341.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1753.42 1056 21.8797 Potri.005G024800.1.v4.1 1035 770.415 333 15.7029 Potri.004G059700.1.v4.1 961 696.561 1 0.0521557 Potri.007G009000.2.v4.1 1416 1151.42 0 0 Potri.003G141000.2.v4.1 2943 2678.42 959 13.0078 Potri.016G087400.1.v4.1 270 79.7877 1012.47 461.007 Potri.015G069301.1.v4.1 564 312.538 0 0 Potri.010G195200.1.v4.1 1773 1508.42 128 3.08284 Potri.012G127500.1.v4.1 977 712.494 44 2.24353 ==> SRR12671341.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 99 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 371 Potri.001G212900.v4.1 160 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 7 SRR12671341 completed mapping pipeline successfully