Starting /dee2/code/volunteer_pipeline.sh SRR12671343 current disk space = 3049591189504 free memory = 1247367420 SRR12671343 SRAfilesize 1f24a4532abf20053d0822d05e093e2e SRR12671343.sra SRR12671343.sra file validated SRR12671343 is paired end SRR12671343 is conventional basespace SRR12671343 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671343_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5925 37.0 37.0 37.0 37.0 37.0 2 36.157 37.0 37.0 37.0 37.0 37.0 3 36.4165 37.0 37.0 37.0 37.0 37.0 4 36.551 37.0 37.0 37.0 37.0 37.0 5 36.559 37.0 37.0 37.0 37.0 37.0 6 36.611 37.0 37.0 37.0 37.0 37.0 7 36.461 37.0 37.0 37.0 37.0 37.0 8 36.543 37.0 37.0 37.0 37.0 37.0 9 36.576 37.0 37.0 37.0 37.0 37.0 10-14 36.5921 37.0 37.0 37.0 37.0 37.0 15-19 36.5766 37.0 37.0 37.0 37.0 37.0 20-24 36.537 37.0 37.0 37.0 37.0 37.0 25-29 36.550000000000004 37.0 37.0 37.0 37.0 37.0 30-34 36.4803 37.0 37.0 37.0 37.0 37.0 35-39 36.4326 37.0 37.0 37.0 37.0 37.0 40-44 36.44930000000001 37.0 37.0 37.0 37.0 37.0 45-49 36.440599999999996 37.0 37.0 37.0 37.0 37.0 50-54 36.3899 37.0 37.0 37.0 37.0 37.0 55-59 36.3991 37.0 37.0 37.0 37.0 37.0 60-64 36.369299999999996 37.0 37.0 37.0 37.0 37.0 65-69 36.3549 37.0 37.0 37.0 37.0 37.0 70-74 36.3272 37.0 37.0 37.0 37.0 37.0 75-79 36.3042 37.0 37.0 37.0 37.0 37.0 80-84 36.2304 37.0 37.0 37.0 37.0 37.0 85-89 36.1756 37.0 37.0 37.0 37.0 37.0 90-94 36.19330000000001 37.0 37.0 37.0 37.0 37.0 95-99 36.1188 37.0 37.0 37.0 37.0 37.0 100-104 36.1657 37.0 37.0 37.0 37.0 37.0 105-109 36.1045 37.0 37.0 37.0 37.0 37.0 110-114 36.07789999999999 37.0 37.0 37.0 37.0 37.0 115-119 36.0683 37.0 37.0 37.0 37.0 37.0 120-124 36.0449 37.0 37.0 37.0 37.0 37.0 125-129 35.9824 37.0 37.0 37.0 37.0 37.0 130-134 35.9281 37.0 37.0 37.0 37.0 37.0 135-139 35.940599999999996 37.0 37.0 37.0 37.0 37.0 140-144 35.8907 37.0 37.0 37.0 37.0 37.0 145-149 35.82280000000001 37.0 37.0 37.0 37.0 37.0 150-151 35.714749999999995 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 3.0 21 2.0 22 1.0 23 2.0 24 2.0 25 0.0 26 4.0 27 3.0 28 12.0 29 24.0 30 15.0 31 23.0 32 53.0 33 72.0 34 132.0 35 315.0 36 2937.0 37 399.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 55.35 9.45 4.475 30.725 2 19.15160642570281 10.140562248995984 39.3574297188755 31.350401606425706 3 16.475 17.025000000000002 29.025000000000002 37.475 4 22.425 25.124999999999996 24.224999999999998 28.225 5 22.775000000000002 31.175000000000004 24.85 21.2 6 17.224999999999998 34.875 26.625 21.275 7 14.2 26.075 43.05 16.675 8 14.424999999999999 23.200000000000003 34.699999999999996 27.675 9 15.85 23.125 37.6 23.425 10-14 19.165 29.505 28.82 22.509999999999998 15-19 20.005 27.85 28.305000000000003 23.84 20-24 19.645000000000003 28.4 28.105000000000004 23.849999999999998 25-29 19.59 28.185 28.59 23.635 30-34 19.775000000000002 28.525 28.02 23.68 35-39 19.950000000000003 28.405 27.675 23.97 40-44 20.215 28.24 27.944999999999997 23.599999999999998 45-49 19.42 28.515 28.1 23.965 50-54 20.19 27.894999999999996 27.79 24.125 55-59 19.46 28.555000000000003 28.435 23.549999999999997 60-64 20.285 28.050000000000004 28.38 23.285 65-69 19.465 28.65 28.09 23.794999999999998 70-74 19.85 28.225 28.315 23.61 75-79 20.075000000000003 28.015 28.34 23.57 80-84 19.805 27.77 28.84 23.585 85-89 20.075000000000003 27.76 28.04 24.125 90-94 20.119999999999997 28.425 27.415 24.04 95-99 20.375 28.32 27.584999999999997 23.72 100-104 20.515 28.720000000000002 27.315 23.45 105-109 20.315 27.744999999999997 28.475 23.465 110-114 20.25 27.615000000000002 28.205000000000002 23.93 115-119 19.965 28.315 27.96 23.76 120-124 21.02 28.025 27.775 23.18 125-129 19.82 28.685 27.525 23.97 130-134 20.419999999999998 28.035 28.115000000000002 23.43 135-139 20.695 28.775000000000002 27.02 23.51 140-144 20.4 27.935 27.625 24.04 145-149 20.669999999999998 28.525 27.3 23.505000000000003 150-151 21.212500000000002 27.8625 27.05 23.875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 2.0 1 1.0 2 0.0 3 1.0 4 1.0 5 0.0 6 0.5 7 0.5 8 0.0 9 1.0 10 1.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.5 16 0.5 17 2.0 18 2.0 19 0.5 20 1.0 21 1.0 22 2.0 23 2.0 24 2.0 25 4.5 26 6.5 27 9.0 28 14.5 29 16.5 30 20.5 31 27.0 32 35.0 33 36.0 34 50.0 35 75.5 36 89.5 37 88.5 38 106.5 39 149.5 40 186.0 41 214.5 42 235.5 43 261.0 44 277.5 45 267.5 46 264.0 47 278.0 48 249.0 49 200.5 50 173.0 51 151.5 52 124.5 53 89.0 54 70.5 55 56.5 56 45.0 57 35.5 58 20.0 59 20.0 60 16.0 61 5.0 62 1.5 63 2.0 64 2.0 65 1.5 66 1.0 67 0.5 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.4 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 83.275 #Duplication Level Percentage of deduplicated Percentage of total 1 83.63854698288802 69.65 2 13.419393575502852 22.35 3 2.281597117982588 5.7 4 0.570399279495647 1.9 5 0.06004202942059442 0.25 6 0.03002101471029721 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGCTGCGGTTGGTGATGTGTACGTCCTCAGTCTTAATTTCTCCCCCCTAA 6 0.15 No Hit CTCCTTTTCCTCTTGCAACCACCAAGTCTTGTTTTTTCTGTGAAGTAGAA 5 0.125 No Hit CTCTCATGTTGGCCAGGAAGAACTGGCCTTGTGCAAGGCTCGCAACCAAT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.0625 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.1375 0.0 0.0 0.0 0.0 100-101 0.25 0.0 0.0 0.0 0.0 102-103 0.275 0.0 0.0 0.0 0.0 104-105 0.3125 0.0 0.0 0.0 0.0 106-107 0.375 0.0 0.0 0.0 0.0 108-109 0.4 0.0 0.0 0.0 0.0 110-111 0.42500000000000004 0.0 0.0 0.0 0.0 112-113 0.45 0.0 0.0 0.0 0.0 114-115 0.5375000000000001 0.0 0.0 0.0 0.0 116-117 0.55 0.0 0.0 0.0 0.0 118-119 0.6375 0.0 0.0 0.0 0.0 120-121 0.8125 0.0 0.0 0.0 0.0 122-123 0.9375 0.0 0.0 0.0 0.0 124-125 1.0 0.0 0.0 0.0 0.0 126-127 1.1625 0.0 0.0 0.0 0.0 128-129 1.2000000000000002 0.0 0.0 0.0 0.0 130-131 1.35 0.0 0.0 0.0 0.0 132-133 1.4500000000000002 0.0 0.0 0.0 0.0 134-135 1.5 0.0 0.0 0.0 0.0 136-137 1.625 0.0 0.0 0.0 0.0 138-139 1.7125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTCCATG 10 0.006830828 145.0 1 TTTTTTT 55 0.0025160722 15.818182 100-104 >>END_MODULE SRR12671343 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671343_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.0605 37.0 37.0 37.0 37.0 37.0 2 35.394 37.0 37.0 37.0 37.0 37.0 3 35.6975 37.0 37.0 37.0 37.0 37.0 4 35.8475 37.0 37.0 37.0 37.0 37.0 5 35.763 37.0 37.0 37.0 37.0 37.0 6 35.7885 37.0 37.0 37.0 37.0 37.0 7 35.8 37.0 37.0 37.0 37.0 37.0 8 35.8385 37.0 37.0 37.0 37.0 37.0 9 35.8265 37.0 37.0 37.0 37.0 37.0 10-14 35.8236 37.0 37.0 37.0 37.0 37.0 15-19 35.8799 37.0 37.0 37.0 37.0 37.0 20-24 35.7938 37.0 37.0 37.0 37.0 37.0 25-29 35.7453 37.0 37.0 37.0 37.0 37.0 30-34 35.6835 37.0 37.0 37.0 37.0 37.0 35-39 35.724900000000005 37.0 37.0 37.0 37.0 37.0 40-44 35.702999999999996 37.0 37.0 37.0 37.0 37.0 45-49 35.6343 37.0 37.0 37.0 37.0 37.0 50-54 35.6725 37.0 37.0 37.0 37.0 37.0 55-59 35.570800000000006 37.0 37.0 37.0 37.0 37.0 60-64 35.57379999999999 37.0 37.0 37.0 37.0 37.0 65-69 35.597500000000004 37.0 37.0 37.0 37.0 37.0 70-74 35.5018 37.0 37.0 37.0 37.0 37.0 75-79 35.4865 37.0 37.0 37.0 37.0 37.0 80-84 35.4057 37.0 37.0 37.0 37.0 37.0 85-89 35.5444 37.0 37.0 37.0 37.0 37.0 90-94 35.427 37.0 37.0 37.0 34.6 37.0 95-99 35.3168 37.0 37.0 37.0 37.0 37.0 100-104 35.35850000000001 37.0 37.0 37.0 34.6 37.0 105-109 35.2787 37.0 37.0 37.0 32.2 37.0 110-114 35.2879 37.0 37.0 37.0 32.2 37.0 115-119 35.3412 37.0 37.0 37.0 34.6 37.0 120-124 35.3532 37.0 37.0 37.0 37.0 37.0 125-129 35.2458 37.0 37.0 37.0 32.2 37.0 130-134 35.1477 37.0 37.0 37.0 29.8 37.0 135-139 35.1449 37.0 37.0 37.0 29.8 37.0 140-144 35.0985 37.0 37.0 37.0 27.4 37.0 145-149 35.1514 37.0 37.0 37.0 29.8 37.0 150-151 34.803749999999994 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 7.0 13 7.0 14 2.0 15 1.0 16 1.0 17 1.0 18 1.0 19 3.0 20 3.0 21 5.0 22 5.0 23 9.0 24 9.0 25 11.0 26 13.0 27 18.0 28 19.0 29 24.0 30 38.0 31 60.0 32 86.0 33 156.0 34 296.0 35 705.0 36 2386.0 37 134.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 50.74999999999999 23.9 6.45 18.9 2 26.150000000000002 23.9 33.800000000000004 16.150000000000002 3 20.424999999999997 27.0 35.125 17.45 4 24.15 34.475 23.625 17.75 5 24.375 39.85 20.375 15.4 6 20.5 38.95 22.825 17.724999999999998 7 20.549999999999997 21.625 39.125 18.7 8 19.05 27.0 29.575000000000003 24.375 9 21.175 23.5 30.049999999999997 25.275 10-14 23.355 29.82 26.615 20.21 15-19 23.75 27.845 27.925 20.48 20-24 23.085 28.355000000000004 28.17 20.39 25-29 22.73 28.52 28.38 20.369999999999997 30-34 22.985 28.720000000000002 27.685 20.61 35-39 23.085 27.639999999999997 28.475 20.8 40-44 22.91 27.87 28.435 20.785 45-49 22.46 27.325 28.99 21.224999999999998 50-54 22.865 27.805000000000003 28.449999999999996 20.880000000000003 55-59 22.735 28.22 27.525 21.52 60-64 23.305 27.48 28.000000000000004 21.215 65-69 22.755 27.12 28.32 21.805 70-74 22.665 28.115000000000002 27.92 21.3 75-79 22.865 27.965 27.810000000000002 21.36 80-84 23.185 28.89 26.729999999999997 21.195 85-89 22.875 27.62 27.694999999999997 21.81 90-94 23.485 28.82 26.63 21.065 95-99 22.97 28.055000000000003 27.715 21.26 100-104 22.85 27.93 28.000000000000004 21.22 105-109 23.51 27.500000000000004 28.33 20.66 110-114 23.45 28.035 27.46 21.055 115-119 23.56 29.065 27.07 20.305 120-124 23.645 27.93 27.639999999999997 20.785 125-129 24.145 27.965 27.435 20.455000000000002 130-134 24.355 27.11 28.194999999999997 20.34 135-139 24.255 27.400000000000002 27.400000000000002 20.945 140-144 24.07 27.005000000000003 28.444999999999997 20.48 145-149 24.287428742874287 27.432743274327432 27.49274927492749 20.787078707870787 150-151 24.45 29.6875 26.5125 19.35 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.5 13 1.0 14 0.5 15 0.0 16 0.5 17 1.5 18 1.5 19 1.5 20 2.0 21 2.0 22 1.5 23 2.5 24 5.0 25 6.5 26 5.5 27 6.5 28 14.0 29 16.5 30 19.0 31 20.0 32 24.0 33 36.5 34 53.0 35 72.0 36 87.5 37 98.0 38 122.0 39 169.5 40 211.0 41 245.5 42 261.0 43 254.5 44 252.5 45 256.5 46 271.0 47 255.5 48 227.0 49 203.5 50 156.5 51 120.0 52 103.0 53 88.0 54 80.5 55 66.5 56 57.0 57 43.5 58 18.5 59 13.5 60 8.5 61 5.5 62 3.5 63 1.0 64 2.0 65 2.5 66 2.5 67 2.5 68 2.0 69 0.5 70 1.0 71 1.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.5 80 0.5 81 0.0 82 0.5 83 0.5 84 0.0 85 1.0 86 1.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.5 92 1.0 93 1.0 94 0.5 95 0.0 96 0.5 97 0.5 98 0.0 99 0.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.01 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 84.275 #Duplication Level Percentage of deduplicated Percentage of total 1 85.31592999110056 71.89999999999999 2 11.806585582913081 19.900000000000002 3 2.135864728567191 5.4 4 0.5636309700385642 1.9 5 0.08899436369029962 0.375 6 0.05932957579353308 0.3 7 0.0 0.0 8 0.0 0.0 9 0.02966478789676654 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 9 0.22499999999999998 No Hit AGGGAGCACTGCATAGCTTATAAGCTTGTAAGAGATGGCTTCCTCCTCTA 6 0.15 No Hit ACTGATTGGAAGATAGTCTTTTGGCAAAAAAAAAATGGCTGCTGTTTGTG 6 0.15 No Hit AAGGAACAAGGGTTTATTCTCCTTTTACGAGGATGGGCATCAGGAGTGCT 5 0.125 No Hit AGAGTACCGAGTTCACTAATCCCTGTTTCCTATGTGGGTTCTTCTTATTT 5 0.125 No Hit ATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAAT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.0625 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.1375 0.0 0.0 0.0 0.0 100-101 0.25 0.0 0.0 0.0 0.0 102-103 0.275 0.0 0.0 0.0 0.0 104-105 0.3125 0.0 0.0 0.0 0.0 106-107 0.375 0.0 0.0 0.0 0.0 108-109 0.4 0.0 0.0 0.0 0.0 110-111 0.42500000000000004 0.0 0.0 0.0 0.0 112-113 0.45 0.0 0.0 0.0 0.0 114-115 0.5375000000000001 0.0 0.0 0.0 0.0 116-117 0.575 0.0 0.0 0.0 0.0 118-119 0.6625000000000001 0.0 0.0 0.0 0.0 120-121 0.8375 0.0 0.0 0.0 0.0 122-123 0.9624999999999999 0.0 0.0 0.0 0.0 124-125 1.025 0.0 0.0 0.0 0.0 126-127 1.1875 0.0 0.0 0.0 0.0 128-129 1.225 0.0 0.0 0.0 0.0 130-131 1.375 0.0 0.0 0.0 0.0 132-133 1.475 0.0 0.0 0.0 0.0 134-135 1.525 0.0 0.0 0.0 0.0 136-137 1.6749999999999998 0.0 0.0 0.0 0.0 138-139 1.7625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACCCTCC 10 0.006830828 145.0 145 >>END_MODULE Read 1087569 spots for SRR12671343.sra Written 1087569 spots for SRR12671343.sra Read 1087569 spots for SRR12671343.sra Written 1087569 spots for SRR12671343.sra Read 1087569 spots for SRR12671343.sra Written 1087569 spots for SRR12671343.sra Read 1087569 spots for SRR12671343.sra Written 1087569 spots for SRR12671343.sra Read 1087569 spots for SRR12671343.sra Written 1087569 spots for SRR12671343.sra Read 1087569 spots for SRR12671343.sra Written 1087569 spots for SRR12671343.sra Read 1087569 spots for SRR12671343.sra Written 1087569 spots for SRR12671343.sra Read 1087569 spots for SRR12671343.sra Written 1087569 spots for SRR12671343.sra Read 1087569 spots for SRR12671343.sra Written 1087569 spots for SRR12671343.sra Read 1087569 spots for SRR12671343.sra Written 1087569 spots for SRR12671343.sra Read 1087569 spots for SRR12671343.sra Written 1087569 spots for SRR12671343.sra Read 1087569 spots for SRR12671343.sra Written 1087569 spots for SRR12671343.sra Read 1087569 spots for SRR12671343.sra Written 1087569 spots for SRR12671343.sra Read 1087569 spots for SRR12671343.sra Written 1087569 spots for SRR12671343.sra Read 1087569 spots for SRR12671343.sra Written 1087569 spots for SRR12671343.sra Read 1087569 spots for SRR12671343.sra Written 1087569 spots for SRR12671343.sra Read 1087569 spots for SRR12671343.sra Written 1087569 spots for SRR12671343.sra Read 1087578 spots for SRR12671343.sra Written 1087578 spots for SRR12671343.sra Read 1087569 spots for SRR12671343.sra Written 1087569 spots for SRR12671343.sra Read 1087569 spots for SRR12671343.sra Written 1087569 spots for SRR12671343.sra SRR ids: ['SRR12671343.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_npw7ar7p SRR12671343.sra spots: 21751389 blocks: [[1, 1087569], [1087570, 2175138], [2175139, 3262707], [3262708, 4350276], [4350277, 5437845], [5437846, 6525414], [6525415, 7612983], [7612984, 8700552], [8700553, 9788121], [9788122, 10875690], [10875691, 11963259], [11963260, 13050828], [13050829, 14138397], [14138398, 15225966], [15225967, 16313535], [16313536, 17401104], [17401105, 18488673], [18488674, 19576242], [19576243, 20663811], [20663812, 21751389]] SRR12671343 file size 7370373 SRR12671343 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671343 SRR12671343_1.fastq SRR12671343_2.fastq Input file: SRR12671343_1.fastq Paired file: SRR12671343_2.fastq trimmed: SRR12671343-trimmed-pair1.fastq, SRR12671343-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 17:31:53 2025 >> started Tue Feb 11 17:32:19 2025 >> done (25.443s) 21751389 read pairs processed; of these: 167 ( 0.00%) short read pairs filtered out after trimming by size control 2364 ( 0.01%) empty read pairs filtered out after trimming by size control 21748858 (99.99%) read pairs available; of these: 632985 ( 2.91%) trimmed read pairs available after processing 21115873 (97.09%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 15 0.00% 19 15 0.00% 20 18 0.00% 21 18 0.00% 22 20 0.00% 23 32 0.00% 24 45 0.00% 25 28 0.00% 26 37 0.00% 27 40 0.00% 28 41 0.00% 29 40 0.00% 30 37 0.00% 31 57 0.00% 32 34 0.00% 33 30 0.00% 34 41 0.00% 35 39 0.00% 36 42 0.00% 37 48 0.00% 38 29 0.00% 39 33 0.00% 40 44 0.00% 41 40 0.00% 42 47 0.00% 43 32 0.00% 44 37 0.00% 45 51 0.00% 46 37 0.00% 47 54 0.00% 48 55 0.00% 49 62 0.00% 50 51 0.00% 51 64 0.00% 52 61 0.00% 53 68 0.00% 54 93 0.00% 55 86 0.00% 56 90 0.00% 57 93 0.00% 58 100 0.00% 59 138 0.00% 60 140 0.00% 61 209 0.00% 62 203 0.00% 63 202 0.00% 64 244 0.00% 65 268 0.00% 66 306 0.00% 67 305 0.00% 68 326 0.00% 69 386 0.00% 70 449 0.00% 71 503 0.00% 72 622 0.00% 73 656 0.00% 74 736 0.00% 75 798 0.00% 76 911 0.00% 77 1007 0.00% 78 1112 0.01% 79 1220 0.01% 80 1193 0.01% 81 1419 0.01% 82 1493 0.01% 83 1655 0.01% 84 1787 0.01% 85 2051 0.01% 86 2053 0.01% 87 2263 0.01% 88 2399 0.01% 89 2495 0.01% 90 2659 0.01% 91 2841 0.01% 92 2907 0.01% 93 3313 0.02% 94 3390 0.02% 95 3584 0.02% 96 3703 0.02% 97 3974 0.02% 98 4115 0.02% 99 4197 0.02% 100 4573 0.02% 101 4389 0.02% 102 4815 0.02% 103 5170 0.02% 104 5358 0.02% 105 5350 0.02% 106 5567 0.03% 107 5936 0.03% 108 6027 0.03% 109 6231 0.03% 110 6360 0.03% 111 6632 0.03% 112 6990 0.03% 113 7155 0.03% 114 7435 0.03% 115 7435 0.03% 116 7898 0.04% 117 8296 0.04% 118 8573 0.04% 119 8694 0.04% 120 9143 0.04% 121 9355 0.04% 122 9420 0.04% 123 9871 0.05% 124 9984 0.05% 125 10486 0.05% 126 10942 0.05% 127 11215 0.05% 128 11562 0.05% 129 11776 0.05% 130 12178 0.06% 131 12129 0.06% 132 12834 0.06% 133 13155 0.06% 134 13415 0.06% 135 14093 0.06% 136 14238 0.07% 137 14168 0.07% 138 14648 0.07% 139 15651 0.07% 140 15639 0.07% 141 16195 0.07% 142 16808 0.08% 143 17029 0.08% 144 17648 0.08% 145 17774 0.08% 146 18465 0.08% 147 18684 0.09% 148 19257 0.09% 149 19444 0.09% 150 20759 0.10% 151 21115873 97.09% 21748858 reads passed initial QC criterion=sequence-density sequence-density=0.65 sequence-density-rank=1 fanout-score=1.95 fanout-score-rank=36 prefix-density=0.65 prefix-fanout=1.9 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTTCGAGCGAAGAAGGTAATCAATTTCCTTGGCCAATTCCTCCTCTGTGAGATCTGGAAGGTAAGAAAGAGTCTCGAACTTCTTCAATCCAGTTGG criterion=fanout-score sequence-density=0.02 sequence-density-rank=37 fanout-score=12.36 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=2.6 sequence=ATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAG criterion=sequence-density sequence-density=0.96 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=28 prefix-density=0.96 prefix-fanout=2.0 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTT criterion=fanout-score sequence-density=0.09 sequence-density-rank=22 fanout-score=72.50 fanout-score-rank=1 prefix-density=0.68 prefix-fanout=9.5 sequence=AAAAGAAAAGAAAA SRR12671343 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 17:33:03 Started mapping on | Feb 11 17:33:04 Finished on | Feb 11 17:35:49 Mapping speed, Million of reads per hour | 474.52 Number of input reads | 21748858 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 19863025 Uniquely mapped reads % | 91.33% Average mapped length | 298.55 Number of splices: Total | 19834055 Number of splices: Annotated (sjdb) | 19434994 Number of splices: GT/AG | 19444404 Number of splices: GC/AG | 323395 Number of splices: AT/AC | 11466 Number of splices: Non-canonical | 54790 Mismatch rate per base, % | 0.43% Deletion rate per base | 0.03% Deletion average length | 2.95 Insertion rate per base | 0.02% Insertion average length | 2.23 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 514231 % of reads mapped to multiple loci | 2.36% Number of reads mapped to too many loci | 28931 % of reads mapped to too many loci | 0.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.06% % of reads unmapped: other | 0.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1371602 1371602 1371602 N_multimapping 514231 514231 514231 N_noFeature 698612 19572898 777677 N_ambiguous 339916 1198 128417 UnstrandedReadsAssigned:18824497 PositiveStrandReadsAssigned:288929 NegativeStrandReadsAssigned:18956931 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671343 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671343-trimmed-pair1.fastq SRR12671343-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,748,858 reads, 18,928,794 reads pseudoaligned [quant] estimated average fragment length: 329.049 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,225 rounds 52401 SRR12671343.ke.tsv 34699 SRR12671343.se.tsv 87100 total ==> SRR12671343.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1689.95 697 19.6401 Potri.005G024800.1.v4.1 1035 706.951 514 34.6225 Potri.004G059700.1.v4.1 961 633.337 0 0 Potri.007G009000.2.v4.1 1416 1087.95 0 0 Potri.003G141000.2.v4.1 2943 2614.95 967 17.6095 Potri.016G087400.1.v4.1 270 65.85 688 497.528 Potri.015G069301.1.v4.1 564 266.507 0 0 Potri.010G195200.1.v4.1 1773 1444.95 195 6.42638 Potri.012G127500.1.v4.1 977 649.117 77 5.64876 ==> SRR12671343.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 257 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 227 Potri.001G212900.v4.1 52 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 13 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 1 SRR12671343 completed mapping pipeline successfully