Starting /dee2/code/volunteer_pipeline.sh SRR12671346 current disk space = 3051449950208 free memory = 1471020952 SRR12671346 SRAfilesize fe6a0d7c70c0358fcbc217f3dfab5504 SRR12671346.sra SRR12671346.sra file validated SRR12671346 is paired end SRR12671346 is conventional basespace SRR12671346 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671346_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.55 37.0 37.0 37.0 37.0 37.0 2 36.3695 37.0 37.0 37.0 37.0 37.0 3 36.589 37.0 37.0 37.0 37.0 37.0 4 36.6015 37.0 37.0 37.0 37.0 37.0 5 36.604 37.0 37.0 37.0 37.0 37.0 6 36.6385 37.0 37.0 37.0 37.0 37.0 7 36.5475 37.0 37.0 37.0 37.0 37.0 8 36.598 37.0 37.0 37.0 37.0 37.0 9 36.594 37.0 37.0 37.0 37.0 37.0 10-14 36.6176 37.0 37.0 37.0 37.0 37.0 15-19 36.6318 37.0 37.0 37.0 37.0 37.0 20-24 36.6194 37.0 37.0 37.0 37.0 37.0 25-29 36.580600000000004 37.0 37.0 37.0 37.0 37.0 30-34 36.5299 37.0 37.0 37.0 37.0 37.0 35-39 36.50320000000001 37.0 37.0 37.0 37.0 37.0 40-44 36.4886 37.0 37.0 37.0 37.0 37.0 45-49 36.452799999999996 37.0 37.0 37.0 37.0 37.0 50-54 36.4692 37.0 37.0 37.0 37.0 37.0 55-59 36.4067 37.0 37.0 37.0 37.0 37.0 60-64 36.425399999999996 37.0 37.0 37.0 37.0 37.0 65-69 36.4082 37.0 37.0 37.0 37.0 37.0 70-74 36.3528 37.0 37.0 37.0 37.0 37.0 75-79 36.3338 37.0 37.0 37.0 37.0 37.0 80-84 36.3721 37.0 37.0 37.0 37.0 37.0 85-89 36.2962 37.0 37.0 37.0 37.0 37.0 90-94 36.30970000000001 37.0 37.0 37.0 37.0 37.0 95-99 36.26809999999999 37.0 37.0 37.0 37.0 37.0 100-104 36.245799999999996 37.0 37.0 37.0 37.0 37.0 105-109 36.2444 37.0 37.0 37.0 37.0 37.0 110-114 36.153200000000005 37.0 37.0 37.0 37.0 37.0 115-119 36.1908 37.0 37.0 37.0 37.0 37.0 120-124 36.1868 37.0 37.0 37.0 37.0 37.0 125-129 36.0537 37.0 37.0 37.0 37.0 37.0 130-134 36.0387 37.0 37.0 37.0 37.0 37.0 135-139 36.0139 37.0 37.0 37.0 37.0 37.0 140-144 35.921499999999995 37.0 37.0 37.0 37.0 37.0 145-149 35.8184 37.0 37.0 37.0 37.0 37.0 150-151 35.653 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 1.0 22 3.0 23 0.0 24 2.0 25 4.0 26 2.0 27 1.0 28 7.0 29 16.0 30 17.0 31 28.0 32 44.0 33 73.0 34 127.0 35 258.0 36 2965.0 37 451.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.425 10.525 5.4 39.65 2 19.57831325301205 11.6214859437751 38.22791164658634 30.57228915662651 3 18.55 18.2 28.000000000000004 35.25 4 22.7 26.25 23.150000000000002 27.900000000000002 5 24.224999999999998 32.425 23.05 20.3 6 19.3 33.675 24.675 22.35 7 14.674999999999999 24.25 44.025 17.05 8 15.8 23.875 33.15 27.175 9 16.950000000000003 22.325 36.1 24.625 10-14 19.509999999999998 30.69 27.534999999999997 22.264999999999997 15-19 20.11 28.03 28.389999999999997 23.47 20-24 20.495 28.415000000000003 27.72 23.369999999999997 25-29 20.294999999999998 28.01 27.79 23.905 30-34 20.195 28.415000000000003 27.325 24.065 35-39 20.815 28.194999999999997 27.43 23.56 40-44 19.865 28.499999999999996 28.27 23.365 45-49 19.785 28.77 27.21 24.235 50-54 20.29 28.57 27.589999999999996 23.549999999999997 55-59 20.055 28.09 27.76 24.095 60-64 20.51 27.83 27.560000000000002 24.099999999999998 65-69 20.965 28.65 27.185 23.200000000000003 70-74 20.59 28.48 27.060000000000002 23.87 75-79 20.89 27.6 27.744999999999997 23.765 80-84 20.25 28.549999999999997 27.450000000000003 23.75 85-89 20.549999999999997 29.325000000000003 27.1 23.025000000000002 90-94 20.95 28.4 27.48 23.169999999999998 95-99 20.62 28.315 27.685 23.380000000000003 100-104 21.32 28.794999999999998 26.695 23.189999999999998 105-109 20.915 27.744999999999997 28.17 23.169999999999998 110-114 20.57 28.16 27.685 23.585 115-119 21.525 28.03 27.145000000000003 23.3 120-124 21.315 28.53 26.465 23.69 125-129 21.38 28.185 27.305 23.13 130-134 21.475 27.875 27.0 23.65 135-139 21.555 28.22 27.055 23.169999999999998 140-144 21.26 28.43 26.985 23.325000000000003 145-149 20.97 28.549999999999997 26.779999999999998 23.7 150-151 20.7125 29.0875 26.05 24.15 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 1.0 14 0.5 15 0.0 16 1.5 17 2.0 18 1.0 19 1.0 20 1.5 21 3.0 22 3.5 23 2.5 24 1.5 25 4.0 26 5.5 27 5.5 28 7.5 29 15.0 30 25.5 31 27.0 32 26.0 33 32.5 34 49.0 35 60.5 36 71.5 37 108.5 38 134.5 39 160.5 40 192.5 41 202.5 42 225.0 43 246.5 44 243.0 45 253.5 46 242.5 47 245.5 48 253.0 49 226.5 50 198.0 51 160.0 52 119.0 53 94.0 54 87.0 55 67.5 56 56.5 57 44.0 58 23.5 59 16.0 60 13.5 61 9.0 62 7.5 63 7.5 64 6.0 65 4.0 66 3.0 67 0.0 68 0.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.4 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 86.7 #Duplication Level Percentage of deduplicated Percentage of total 1 86.96655132641293 75.4 2 11.245674740484429 19.5 3 1.384083044982699 3.5999999999999996 4 0.31718569780853517 1.0999999999999999 5 0.05767012687427912 0.25 6 0.02883506343713956 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ATTGACATTCTGAAATGAATGAATTTCCCATTGAAAATAAAAAAACCGAA 6 0.15 No Hit GCTCCGTCTCATATATCTTCTTCACCAGTTCCGCATCAAACCCCCTCCTC 5 0.125 No Hit CATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.0625 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.1125 0.0 0.0 0.0 0.0 74-75 0.1375 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.21250000000000002 0.0 0.0 0.0 0.0 80-81 0.32499999999999996 0.0 0.0 0.0 0.0 82-83 0.3875 0.0 0.0 0.0 0.0 84-85 0.4 0.0 0.0 0.0 0.0 86-87 0.45 0.0 0.0 0.0 0.0 88-89 0.5625 0.0 0.0 0.0 0.0 90-91 0.6499999999999999 0.0 0.0 0.0 0.0 92-93 0.75 0.0 0.0 0.0 0.0 94-95 0.875 0.0 0.0 0.0 0.0 96-97 1.0875 0.0 0.0 0.0 0.0 98-99 1.2 0.0 0.0 0.0 0.0 100-101 1.2875 0.0 0.0 0.0 0.0 102-103 1.475 0.0 0.0 0.0 0.0 104-105 1.8625 0.0 0.0 0.0 0.0 106-107 2.225 0.0 0.0 0.0 0.0 108-109 2.725 0.0 0.0 0.0 0.0 110-111 3.0999999999999996 0.0 0.0 0.0 0.0 112-113 3.4375 0.0 0.0 0.0 0.0 114-115 4.05 0.0 0.0 0.0 0.0 116-117 4.625 0.0 0.0 0.0 0.0 118-119 5.125 0.0 0.0 0.0 0.0 120-121 5.55 0.0 0.0 0.0 0.0 122-123 5.987500000000001 0.0 0.0 0.0 0.0 124-125 6.4375 0.0 0.0 0.0 0.0 126-127 6.9625 0.0 0.0 0.0 0.0 128-129 7.65 0.0 0.0 0.0 0.0 130-131 8.125 0.0 0.0 0.0 0.0 132-133 8.6125 0.0 0.0 0.0 0.0 134-135 9.2 0.0 0.0 0.0 0.0 136-137 9.75 0.0 0.0 0.0 0.0 138-139 10.4 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCCCGGG 10 0.006830828 145.0 9 AGCAAGC 10 0.006830828 145.0 4 AAGCCCG 10 0.006830828 145.0 7 GTCAGCA 10 0.006830828 145.0 1 CAAGCCC 10 0.006830828 145.0 6 >>END_MODULE SRR12671346 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671346_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.377 37.0 37.0 37.0 37.0 37.0 2 36.18 37.0 37.0 37.0 37.0 37.0 3 36.2415 37.0 37.0 37.0 37.0 37.0 4 36.2905 37.0 37.0 37.0 37.0 37.0 5 36.3535 37.0 37.0 37.0 37.0 37.0 6 36.3035 37.0 37.0 37.0 37.0 37.0 7 36.3585 37.0 37.0 37.0 37.0 37.0 8 36.3715 37.0 37.0 37.0 37.0 37.0 9 36.4135 37.0 37.0 37.0 37.0 37.0 10-14 36.4049 37.0 37.0 37.0 37.0 37.0 15-19 36.3885 37.0 37.0 37.0 37.0 37.0 20-24 36.377599999999994 37.0 37.0 37.0 37.0 37.0 25-29 36.2838 37.0 37.0 37.0 37.0 37.0 30-34 36.2327 37.0 37.0 37.0 37.0 37.0 35-39 36.1944 37.0 37.0 37.0 37.0 37.0 40-44 36.2131 37.0 37.0 37.0 37.0 37.0 45-49 36.1892 37.0 37.0 37.0 37.0 37.0 50-54 36.151599999999995 37.0 37.0 37.0 37.0 37.0 55-59 36.117599999999996 37.0 37.0 37.0 37.0 37.0 60-64 36.0868 37.0 37.0 37.0 37.0 37.0 65-69 36.1027 37.0 37.0 37.0 37.0 37.0 70-74 36.056099999999994 37.0 37.0 37.0 37.0 37.0 75-79 36.066199999999995 37.0 37.0 37.0 37.0 37.0 80-84 35.973299999999995 37.0 37.0 37.0 37.0 37.0 85-89 36.048500000000004 37.0 37.0 37.0 37.0 37.0 90-94 36.0127 37.0 37.0 37.0 37.0 37.0 95-99 35.9833 37.0 37.0 37.0 37.0 37.0 100-104 35.9447 37.0 37.0 37.0 37.0 37.0 105-109 35.8823 37.0 37.0 37.0 37.0 37.0 110-114 35.821999999999996 37.0 37.0 37.0 37.0 37.0 115-119 35.943599999999996 37.0 37.0 37.0 37.0 37.0 120-124 35.8349 37.0 37.0 37.0 37.0 37.0 125-129 35.8257 37.0 37.0 37.0 37.0 37.0 130-134 35.6755 37.0 37.0 37.0 37.0 37.0 135-139 35.5698 37.0 37.0 37.0 37.0 37.0 140-144 35.6584 37.0 37.0 37.0 37.0 37.0 145-149 35.470600000000005 37.0 37.0 37.0 37.0 37.0 150-151 35.22725 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 2.0 14 0.0 15 2.0 16 1.0 17 1.0 18 0.0 19 2.0 20 3.0 21 0.0 22 4.0 23 2.0 24 4.0 25 6.0 26 6.0 27 12.0 28 20.0 29 19.0 30 16.0 31 38.0 32 56.0 33 89.0 34 162.0 35 447.0 36 2781.0 37 326.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.949999999999996 22.975 8.55 27.525 2 25.575 26.450000000000003 33.225 14.75 3 20.875 27.800000000000004 32.875 18.45 4 23.275000000000002 35.525 23.1 18.099999999999998 5 26.174999999999997 37.0 21.25 15.575 6 20.45 41.099999999999994 21.325 17.125 7 19.15 20.849999999999998 39.550000000000004 20.45 8 17.95 26.1 30.525000000000002 25.424999999999997 9 20.75 24.725 30.525000000000002 24.0 10-14 22.42 29.865000000000002 26.215 21.5 15-19 23.07 28.499999999999996 27.47 20.96 20-24 22.405 28.79 28.025 20.78 25-29 22.06 28.585 28.15 21.205 30-34 22.595000000000002 28.765 27.815 20.825 35-39 22.805 28.035 27.560000000000002 21.6 40-44 22.785 27.950000000000003 28.64 20.625 45-49 22.765 27.275 29.020000000000003 20.94 50-54 22.485 27.43 29.195 20.89 55-59 22.85 27.224999999999998 28.310000000000002 21.615000000000002 60-64 23.1 27.529999999999998 28.335 21.035 65-69 23.0 26.935 28.310000000000002 21.755 70-74 23.21 27.529999999999998 27.815 21.445 75-79 23.53 27.400000000000002 27.77 21.3 80-84 22.715 27.655 27.61 22.02 85-89 23.205000000000002 27.73 27.93 21.135 90-94 23.23 28.16 27.62 20.990000000000002 95-99 22.93 28.54 27.405 21.125 100-104 24.099999999999998 27.894999999999996 27.089999999999996 20.915 105-109 23.54 27.779999999999998 27.67 21.01 110-114 24.03 27.815 27.35 20.805 115-119 24.175 28.21 26.845000000000002 20.77 120-124 24.85 28.435 27.065 19.650000000000002 125-129 24.41 28.185 26.674999999999997 20.73 130-134 25.31 27.765 26.775 20.150000000000002 135-139 24.925 28.299999999999997 26.69 20.085 140-144 25.14 28.115000000000002 26.32 20.424999999999997 145-149 26.405 27.36 26.205000000000002 20.03 150-151 26.887499999999996 28.599999999999998 26.7125 17.8 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 1.0 21 2.0 22 2.0 23 2.0 24 2.0 25 2.0 26 3.5 27 7.0 28 8.5 29 9.5 30 18.0 31 25.5 32 28.0 33 35.0 34 49.5 35 71.0 36 92.0 37 112.0 38 146.0 39 190.0 40 227.5 41 229.0 42 248.5 43 276.5 44 256.0 45 235.5 46 219.5 47 222.5 48 227.5 49 216.0 50 176.0 51 138.5 52 117.0 53 93.5 54 86.5 55 64.5 56 39.0 57 27.0 58 21.5 59 20.5 60 15.0 61 8.0 62 4.5 63 3.5 64 3.0 65 1.5 66 1.5 67 1.0 68 0.0 69 0.0 70 0.5 71 0.5 72 0.5 73 1.0 74 0.5 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.5 87 0.5 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.5 96 0.5 97 0.0 98 0.0 99 0.0 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 86.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 87.05848291835552 75.175 2 10.828025477707007 18.7 3 1.5923566878980893 4.125 4 0.4053271569195136 1.4000000000000001 5 0.05790387955993051 0.25 6 0.028951939779965255 0.15 7 0.0 0.0 8 0.028951939779965255 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 8 0.2 No Hit CACTGACATGGGAAGTCTAACAAATGAACAGAGGAACTCATAGTGTTGAC 6 0.15 No Hit CAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTA 5 0.125 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.0625 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.1125 0.0 0.0 0.0 0.0 74-75 0.1375 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.21250000000000002 0.0 0.0 0.0 0.0 80-81 0.32499999999999996 0.0 0.0 0.0 0.0 82-83 0.3875 0.0 0.0 0.0 0.0 84-85 0.4 0.0 0.0 0.0 0.0 86-87 0.45 0.0 0.0 0.0 0.0 88-89 0.5625 0.0 0.0 0.0 0.0 90-91 0.6499999999999999 0.0 0.0 0.0 0.0 92-93 0.75 0.0 0.0 0.0 0.0 94-95 0.875 0.0 0.0 0.0 0.0 96-97 1.0875 0.0 0.0 0.0 0.0 98-99 1.2 0.0 0.0 0.0 0.0 100-101 1.2875 0.0 0.0 0.0 0.0 102-103 1.5 0.0 0.0 0.0 0.0 104-105 1.8875 0.0 0.0 0.0 0.0 106-107 2.25 0.0 0.0 0.0 0.0 108-109 2.775 0.0 0.0 0.0 0.0 110-111 3.1500000000000004 0.0 0.0 0.0 0.0 112-113 3.4875 0.0 0.0 0.0 0.0 114-115 4.1125 0.0 0.0 0.0 0.0 116-117 4.699999999999999 0.0 0.0 0.0 0.0 118-119 5.199999999999999 0.0 0.0 0.0 0.0 120-121 5.625 0.0 0.0 0.0 0.0 122-123 6.0625 0.0 0.0 0.0 0.0 124-125 6.5125 0.0 0.0 0.0 0.0 126-127 7.0625 0.0 0.0 0.0 0.0 128-129 7.75 0.0 0.0 0.0 0.0 130-131 8.2 0.0 0.0 0.0 0.0 132-133 8.6875 0.0 0.0 0.0 0.0 134-135 9.3 0.0 0.0 0.0 0.0 136-137 9.850000000000001 0.0 0.0 0.0 0.0 138-139 10.5 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATAAGTC 10 0.006830828 145.0 2 GATAAGT 10 0.006830828 145.0 1 AGTCTTC 10 0.006830828 145.0 5 AAAAAAA 85 5.955226E-7 17.058823 20-24 >>END_MODULE Read 884149 spots for SRR12671346.sra Written 884149 spots for SRR12671346.sra Read 884149 spots for SRR12671346.sra Written 884149 spots for SRR12671346.sra Read 884149 spots for SRR12671346.sra Written 884149 spots for SRR12671346.sra Read 884149 spots for SRR12671346.sra Written 884149 spots for SRR12671346.sra Read 884149 spots for SRR12671346.sra Written 884149 spots for SRR12671346.sra Read 884149 spots for SRR12671346.sra Written 884149 spots for SRR12671346.sra Read 884149 spots for SRR12671346.sra Written 884149 spots for SRR12671346.sra Read 884149 spots for SRR12671346.sra Written 884149 spots for SRR12671346.sra Read 884149 spots for SRR12671346.sra Written 884149 spots for SRR12671346.sra Read 884149 spots for SRR12671346.sra Written 884149 spots for SRR12671346.sra Read 884149 spots for SRR12671346.sra Written 884149 spots for SRR12671346.sra Read 884149 spots for SRR12671346.sra Written 884149 spots for SRR12671346.sra Read 884149 spots for SRR12671346.sra Written 884149 spots for SRR12671346.sra Read 884149 spots for SRR12671346.sra Written 884149 spots for SRR12671346.sra Read 884149 spots for SRR12671346.sra Written 884149 spots for SRR12671346.sra Read 884168 spots for SRR12671346.sra Written 884168 spots for SRR12671346.sra Read 884149 spots for SRR12671346.sra Written 884149 spots for SRR12671346.sra Read 884149 spots for SRR12671346.sra Written 884149 spots for SRR12671346.sra Read 884149 spots for SRR12671346.sra Written 884149 spots for SRR12671346.sra Read 884149 spots for SRR12671346.sra Written 884149 spots for SRR12671346.sra SRR ids: ['SRR12671346.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_j_c_663v SRR12671346.sra spots: 17682999 blocks: [[1, 884149], [884150, 1768298], [1768299, 2652447], [2652448, 3536596], [3536597, 4420745], [4420746, 5304894], [5304895, 6189043], [6189044, 7073192], [7073193, 7957341], [7957342, 8841490], [8841491, 9725639], [9725640, 10609788], [10609789, 11493937], [11493938, 12378086], [12378087, 13262235], [13262236, 14146384], [14146385, 15030533], [15030534, 15914682], [15914683, 16798831], [16798832, 17682999]] SRR12671346 file size 5987756 SRR12671346 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671346 SRR12671346_1.fastq SRR12671346_2.fastq Input file: SRR12671346_1.fastq Paired file: SRR12671346_2.fastq trimmed: SRR12671346-trimmed-pair1.fastq, SRR12671346-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 17:43:35 2025 >> started Tue Feb 11 17:44:05 2025 >> done (29.875s) 17682999 read pairs processed; of these: 100 ( 0.00%) short read pairs filtered out after trimming by size control 4723 ( 0.03%) empty read pairs filtered out after trimming by size control 17678176 (99.97%) read pairs available; of these: 2363367 (13.37%) trimmed read pairs available after processing 15314809 (86.63%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 10 0.00% 19 12 0.00% 20 6 0.00% 21 4 0.00% 22 12 0.00% 23 13 0.00% 24 7 0.00% 25 16 0.00% 26 7 0.00% 27 8 0.00% 28 25 0.00% 29 22 0.00% 30 10 0.00% 31 15 0.00% 32 23 0.00% 33 19 0.00% 34 19 0.00% 35 21 0.00% 36 24 0.00% 37 22 0.00% 38 23 0.00% 39 26 0.00% 40 45 0.00% 41 37 0.00% 42 53 0.00% 43 36 0.00% 44 40 0.00% 45 42 0.00% 46 54 0.00% 47 76 0.00% 48 75 0.00% 49 90 0.00% 50 108 0.00% 51 140 0.00% 52 164 0.00% 53 145 0.00% 54 158 0.00% 55 216 0.00% 56 220 0.00% 57 259 0.00% 58 330 0.00% 59 348 0.00% 60 456 0.00% 61 532 0.00% 62 629 0.00% 63 645 0.00% 64 709 0.00% 65 807 0.00% 66 896 0.01% 67 1066 0.01% 68 1157 0.01% 69 1447 0.01% 70 1633 0.01% 71 1758 0.01% 72 2078 0.01% 73 2425 0.01% 74 2677 0.02% 75 3074 0.02% 76 3387 0.02% 77 3675 0.02% 78 3920 0.02% 79 4482 0.03% 80 4991 0.03% 81 5587 0.03% 82 6161 0.03% 83 6653 0.04% 84 7528 0.04% 85 7898 0.04% 86 8687 0.05% 87 9027 0.05% 88 9676 0.05% 89 10422 0.06% 90 11268 0.06% 91 11660 0.07% 92 12578 0.07% 93 13599 0.08% 94 14594 0.08% 95 15745 0.09% 96 15791 0.09% 97 17133 0.10% 98 17589 0.10% 99 18412 0.10% 100 19205 0.11% 101 19846 0.11% 102 20904 0.12% 103 21736 0.12% 104 23034 0.13% 105 23927 0.14% 106 24392 0.14% 107 26119 0.15% 108 26356 0.15% 109 27173 0.15% 110 27850 0.16% 111 28884 0.16% 112 29633 0.17% 113 29945 0.17% 114 31809 0.18% 115 32864 0.19% 116 33906 0.19% 117 35058 0.20% 118 35959 0.20% 119 36887 0.21% 120 37782 0.21% 121 38402 0.22% 122 39083 0.22% 123 40044 0.23% 124 41046 0.23% 125 41668 0.24% 126 43750 0.25% 127 43790 0.25% 128 45340 0.26% 129 45616 0.26% 130 46797 0.26% 131 46500 0.26% 132 47373 0.27% 133 48120 0.27% 134 48191 0.27% 135 49960 0.28% 136 50630 0.29% 137 52229 0.30% 138 53104 0.30% 139 54756 0.31% 140 54265 0.31% 141 54232 0.31% 142 55581 0.31% 143 55372 0.31% 144 56320 0.32% 145 57000 0.32% 146 57329 0.32% 147 57862 0.33% 148 59642 0.34% 149 59334 0.34% 150 61330 0.35% 151 15314809 86.63% 17678176 reads passed initial QC criterion=sequence-density sequence-density=0.63 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=17 prefix-density=0.64 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=22 fanout-score=576.42 fanout-score-rank=1 prefix-density=0.28 prefix-fanout=18.6 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAG criterion=sequence-density sequence-density=0.89 sequence-density-rank=1 fanout-score=2.23 fanout-score-rank=18 prefix-density=0.92 prefix-fanout=2.2 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=48.45 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=6.5 sequence=AAAGGATGGTAGAGTAGCATCCTTAGCGTTGCTGGTTTACTTTCCTAACAATCCTCAAAACCATTCTTCTTAGACTCTCTATACATTCCAAATAACC SRR12671346 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 17:44:58 Started mapping on | Feb 11 17:44:58 Finished on | Feb 11 17:47:36 Mapping speed, Million of reads per hour | 402.79 Number of input reads | 17678176 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 16513143 Uniquely mapped reads % | 93.41% Average mapped length | 293.40 Number of splices: Total | 15880777 Number of splices: Annotated (sjdb) | 15574062 Number of splices: GT/AG | 15561393 Number of splices: GC/AG | 265020 Number of splices: AT/AC | 9578 Number of splices: Non-canonical | 44786 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.97 Insertion rate per base | 0.03% Insertion average length | 2.21 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 382517 % of reads mapped to multiple loci | 2.16% Number of reads mapped to too many loci | 21581 % of reads mapped to too many loci | 0.12% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.21% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 782516 782516 782516 N_multimapping 382517 382517 382517 N_noFeature 602307 16273082 699359 N_ambiguous 244232 810 100726 UnstrandedReadsAssigned:15666604 PositiveStrandReadsAssigned:239251 NegativeStrandReadsAssigned:15713058 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671346 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671346-trimmed-pair1.fastq SRR12671346-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,678,176 reads, 15,755,740 reads pseudoaligned [quant] estimated average fragment length: 254.052 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,213 rounds 52401 SRR12671346.ke.tsv 34699 SRR12671346.se.tsv 87100 total ==> SRR12671346.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1764.95 546 20.0447 Potri.005G024800.1.v4.1 1035 781.948 179 14.8325 Potri.004G059700.1.v4.1 961 708.224 4 0.365955 Potri.007G009000.2.v4.1 1416 1162.95 0 0 Potri.003G141000.2.v4.1 2943 2689.95 838 20.1855 Potri.016G087400.1.v4.1 270 92.1626 503 353.633 Potri.015G069301.1.v4.1 564 328.137 0 0 Potri.010G195200.1.v4.1 1773 1519.95 24 1.02311 Potri.012G127500.1.v4.1 977 724.094 108 9.66424 ==> SRR12671346.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 206 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 252 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 7 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 2 SRR12671346 completed mapping pipeline successfully