Starting /dee2/code/volunteer_pipeline.sh SRR12671348 current disk space = 3048370196480 free memory = 1420603912 SRR12671348 SRAfilesize 0e4321882ef7a3e0c393f55c8a31e19b SRR12671348.sra SRR12671348.sra file validated SRR12671348 is paired end SRR12671348 is conventional basespace SRR12671348 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671348_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.627 37.0 37.0 37.0 37.0 37.0 2 36.4125 37.0 37.0 37.0 37.0 37.0 3 36.5635 37.0 37.0 37.0 37.0 37.0 4 36.6295 37.0 37.0 37.0 37.0 37.0 5 36.634 37.0 37.0 37.0 37.0 37.0 6 36.592 37.0 37.0 37.0 37.0 37.0 7 36.589 37.0 37.0 37.0 37.0 37.0 8 36.5755 37.0 37.0 37.0 37.0 37.0 9 36.529 37.0 37.0 37.0 37.0 37.0 10-14 36.5643 37.0 37.0 37.0 37.0 37.0 15-19 36.596799999999995 37.0 37.0 37.0 37.0 37.0 20-24 36.5603 37.0 37.0 37.0 37.0 37.0 25-29 36.5044 37.0 37.0 37.0 37.0 37.0 30-34 36.5117 37.0 37.0 37.0 37.0 37.0 35-39 36.491200000000006 37.0 37.0 37.0 37.0 37.0 40-44 36.47 37.0 37.0 37.0 37.0 37.0 45-49 36.4405 37.0 37.0 37.0 37.0 37.0 50-54 36.4842 37.0 37.0 37.0 37.0 37.0 55-59 36.4572 37.0 37.0 37.0 37.0 37.0 60-64 36.3903 37.0 37.0 37.0 37.0 37.0 65-69 36.3852 37.0 37.0 37.0 37.0 37.0 70-74 36.383300000000006 37.0 37.0 37.0 37.0 37.0 75-79 36.363600000000005 37.0 37.0 37.0 37.0 37.0 80-84 36.3141 37.0 37.0 37.0 37.0 37.0 85-89 36.251599999999996 37.0 37.0 37.0 37.0 37.0 90-94 36.296099999999996 37.0 37.0 37.0 37.0 37.0 95-99 36.2282 37.0 37.0 37.0 37.0 37.0 100-104 36.238200000000006 37.0 37.0 37.0 37.0 37.0 105-109 36.2104 37.0 37.0 37.0 37.0 37.0 110-114 36.1134 37.0 37.0 37.0 37.0 37.0 115-119 36.116 37.0 37.0 37.0 37.0 37.0 120-124 36.1187 37.0 37.0 37.0 37.0 37.0 125-129 36.0827 37.0 37.0 37.0 37.0 37.0 130-134 36.0676 37.0 37.0 37.0 37.0 37.0 135-139 36.0236 37.0 37.0 37.0 37.0 37.0 140-144 35.8959 37.0 37.0 37.0 37.0 37.0 145-149 35.9217 37.0 37.0 37.0 37.0 37.0 150-151 35.77875 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 0.0 23 1.0 24 3.0 25 1.0 26 1.0 27 7.0 28 9.0 29 18.0 30 24.0 31 31.0 32 43.0 33 73.0 34 126.0 35 270.0 36 2916.0 37 476.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.800000000000004 11.0 5.225 37.974999999999994 2 19.263527054108216 12.449899799599198 39.879759519038075 28.406813627254508 3 18.075 18.05 28.499999999999996 35.375 4 24.075 25.724999999999998 23.599999999999998 26.6 5 24.425 31.025000000000002 24.25 20.3 6 19.85 33.225 24.099999999999998 22.825 7 14.95 24.474999999999998 43.6 16.975 8 16.45 24.775 35.475 23.3 9 17.5 21.825 37.1 23.575 10-14 19.535 29.145 28.044999999999998 23.275000000000002 15-19 19.900000000000002 28.075 28.225 23.799999999999997 20-24 19.759999999999998 28.205000000000002 28.125 23.91 25-29 20.424999999999997 28.395 27.79 23.39 30-34 20.015 28.42 27.74 23.825 35-39 20.24 29.035 27.529999999999998 23.195 40-44 20.36 28.83 27.485 23.325000000000003 45-49 20.505000000000003 27.63 27.97 23.895 50-54 20.285 28.815 27.634999999999998 23.265 55-59 20.19 28.444999999999997 27.79 23.575 60-64 20.525 28.62 27.13 23.724999999999998 65-69 19.900000000000002 27.905 27.950000000000003 24.245 70-74 19.564999999999998 29.345 26.985 24.104999999999997 75-79 20.525 28.225 27.685 23.565 80-84 21.085 28.754999999999995 26.479999999999997 23.68 85-89 20.810000000000002 28.28 27.534999999999997 23.375 90-94 19.5 28.16 27.889999999999997 24.45 95-99 19.845 28.38 28.139999999999997 23.635 100-104 20.41 28.365000000000002 27.855 23.369999999999997 105-109 20.349999999999998 28.799999999999997 27.339999999999996 23.51 110-114 20.59 29.13 27.67 22.61 115-119 20.8 28.435 27.205000000000002 23.56 120-124 20.23 28.389999999999997 27.43 23.95 125-129 20.44 28.15 27.595 23.815 130-134 20.349999999999998 28.555000000000003 27.36 23.735 135-139 21.22 28.02 27.615000000000002 23.145 140-144 21.965 28.165000000000003 26.155 23.715 145-149 20.505000000000003 28.315 27.22 23.96 150-151 20.7875 28.525 26.3 24.3875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 2.0 22 2.0 23 1.5 24 1.0 25 2.0 26 3.5 27 5.5 28 10.5 29 15.0 30 18.0 31 25.5 32 36.0 33 41.5 34 49.5 35 67.0 36 79.5 37 101.0 38 132.5 39 163.5 40 185.0 41 193.0 42 226.5 43 253.0 44 263.0 45 287.0 46 286.5 47 262.0 48 234.5 49 206.0 50 187.5 51 139.5 52 106.5 53 101.5 54 80.0 55 62.0 56 46.0 57 31.0 58 21.0 59 19.0 60 13.5 61 11.0 62 8.5 63 3.0 64 1.5 65 3.5 66 4.0 67 2.0 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.2 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 85.575 #Duplication Level Percentage of deduplicated Percentage of total 1 86.35699678644464 73.9 2 11.013730645632485 18.85 3 2.1034180543382996 5.4 4 0.46742623429739993 1.6 5 0.05842827928717499 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TAGACGGTTTCTGCTCGTTGCATAACTGAGTTCACCAAGTCGGTTCCATA 5 0.125 No Hit CCCAGCTCTTGCCCCATGAGTTCCTCACAATCCAGTAATCTTTACCCTTT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.21250000000000002 0.0 0.0 0.0 0.0 86-87 0.275 0.0 0.0 0.0 0.0 88-89 0.35 0.0 0.0 0.0 0.0 90-91 0.5125 0.0 0.0 0.0 0.0 92-93 0.625 0.0 0.0 0.0 0.0 94-95 0.7 0.0 0.0 0.0 0.0 96-97 0.825 0.0 0.0 0.0 0.0 98-99 0.9375 0.0 0.0 0.0 0.0 100-101 1.0499999999999998 0.0 0.0 0.0 0.0 102-103 1.15 0.0 0.0 0.0 0.0 104-105 1.2125 0.0 0.0 0.0 0.0 106-107 1.3125 0.0 0.0 0.0 0.0 108-109 1.4625 0.0 0.0 0.0 0.0 110-111 1.6124999999999998 0.0 0.0 0.0 0.0 112-113 1.85 0.0 0.0 0.0 0.0 114-115 2.075 0.0 0.0 0.0 0.0 116-117 2.3875 0.0 0.0 0.0 0.0 118-119 2.6624999999999996 0.0 0.0 0.0 0.0 120-121 2.825 0.0 0.0 0.0 0.0 122-123 3.175 0.0 0.0 0.0 0.0 124-125 3.3625 0.0 0.0 0.0 0.0 126-127 3.7125 0.0 0.0 0.0 0.0 128-129 4.125 0.0 0.0 0.0 0.0 130-131 4.362500000000001 0.0 0.0 0.0 0.0 132-133 4.612500000000001 0.0 0.0 0.0 0.0 134-135 5.1 0.0 0.0 0.0 0.0 136-137 5.5 0.0 0.0 0.0 0.0 138-139 5.8875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12671348 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671348_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.288 37.0 37.0 37.0 37.0 37.0 2 35.9795 37.0 37.0 37.0 37.0 37.0 3 36.1655 37.0 37.0 37.0 37.0 37.0 4 36.2335 37.0 37.0 37.0 37.0 37.0 5 36.382 37.0 37.0 37.0 37.0 37.0 6 36.254 37.0 37.0 37.0 37.0 37.0 7 36.2405 37.0 37.0 37.0 37.0 37.0 8 36.347 37.0 37.0 37.0 37.0 37.0 9 36.3475 37.0 37.0 37.0 37.0 37.0 10-14 36.343599999999995 37.0 37.0 37.0 37.0 37.0 15-19 36.27759999999999 37.0 37.0 37.0 37.0 37.0 20-24 36.2578 37.0 37.0 37.0 37.0 37.0 25-29 36.2075 37.0 37.0 37.0 37.0 37.0 30-34 36.205 37.0 37.0 37.0 37.0 37.0 35-39 36.16610000000001 37.0 37.0 37.0 37.0 37.0 40-44 36.1351 37.0 37.0 37.0 37.0 37.0 45-49 36.1538 37.0 37.0 37.0 37.0 37.0 50-54 36.105000000000004 37.0 37.0 37.0 37.0 37.0 55-59 36.052 37.0 37.0 37.0 37.0 37.0 60-64 36.0278 37.0 37.0 37.0 37.0 37.0 65-69 36.0387 37.0 37.0 37.0 37.0 37.0 70-74 35.9393 37.0 37.0 37.0 37.0 37.0 75-79 35.9867 37.0 37.0 37.0 37.0 37.0 80-84 35.9122 37.0 37.0 37.0 37.0 37.0 85-89 35.973 37.0 37.0 37.0 37.0 37.0 90-94 35.9122 37.0 37.0 37.0 37.0 37.0 95-99 35.835699999999996 37.0 37.0 37.0 37.0 37.0 100-104 35.847500000000004 37.0 37.0 37.0 37.0 37.0 105-109 35.754200000000004 37.0 37.0 37.0 37.0 37.0 110-114 35.720600000000005 37.0 37.0 37.0 37.0 37.0 115-119 35.8135 37.0 37.0 37.0 37.0 37.0 120-124 35.7806 37.0 37.0 37.0 37.0 37.0 125-129 35.7539 37.0 37.0 37.0 37.0 37.0 130-134 35.6785 37.0 37.0 37.0 37.0 37.0 135-139 35.55929999999999 37.0 37.0 37.0 37.0 37.0 140-144 35.6639 37.0 37.0 37.0 37.0 37.0 145-149 35.6105 37.0 37.0 37.0 37.0 37.0 150-151 35.398250000000004 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 1.0 14 2.0 15 3.0 16 2.0 17 1.0 18 1.0 19 0.0 20 2.0 21 2.0 22 3.0 23 3.0 24 8.0 25 6.0 26 13.0 27 13.0 28 11.0 29 16.0 30 31.0 31 26.0 32 64.0 33 83.0 34 187.0 35 475.0 36 2680.0 37 365.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.0 25.674999999999997 8.275 24.05 2 24.9 26.325 32.824999999999996 15.950000000000001 3 22.1 26.55 32.625 18.725 4 23.45 32.875 23.799999999999997 19.875 5 24.675 37.574999999999996 21.9 15.85 6 19.0 39.525 23.674999999999997 17.8 7 19.35 22.55 38.775 19.325 8 19.6 24.3 30.925000000000004 25.174999999999997 9 20.525 25.124999999999996 29.325000000000003 25.025 10-14 21.975 29.315 27.055 21.654999999999998 15-19 22.814999999999998 28.58 27.339999999999996 21.265 20-24 23.32 28.265 28.000000000000004 20.415 25-29 22.915 28.115000000000002 28.185 20.785 30-34 22.24 28.02 28.685 21.055 35-39 22.415 28.884999999999998 27.215 21.485000000000003 40-44 23.04 28.804999999999996 27.365000000000002 20.79 45-49 22.55 28.555000000000003 28.125 20.77 50-54 22.695 27.825 28.189999999999998 21.29 55-59 22.994999999999997 27.71 28.03 21.265 60-64 22.400000000000002 27.93 28.26 21.41 65-69 22.7 27.694999999999997 28.410000000000004 21.195 70-74 23.45 27.839999999999996 27.810000000000002 20.9 75-79 22.905 28.27 27.105 21.72 80-84 23.085 27.98 27.67 21.265 85-89 23.24 28.105000000000004 27.61 21.044999999999998 90-94 22.88 28.525 27.71 20.885 95-99 22.915 28.205000000000002 28.050000000000004 20.830000000000002 100-104 23.380000000000003 27.534999999999997 28.360000000000003 20.724999999999998 105-109 24.025 27.565 27.884999999999998 20.525 110-114 23.169999999999998 27.92 28.075 20.835 115-119 23.595 28.110000000000003 27.72 20.575 120-124 24.65 28.144999999999996 27.639999999999997 19.564999999999998 125-129 23.46 28.499999999999996 27.515 20.525 130-134 24.62 27.455000000000002 27.38 20.544999999999998 135-139 24.21 28.044999999999998 27.185 20.560000000000002 140-144 24.62 28.694999999999997 26.674999999999997 20.01 145-149 24.38987797559512 28.230646129225846 27.110422084416886 20.269053810762152 150-151 24.0 28.537499999999998 27.325 20.1375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 1.0 15 1.0 16 0.0 17 0.0 18 0.0 19 1.0 20 1.0 21 0.5 22 1.5 23 3.5 24 4.0 25 4.5 26 6.5 27 9.0 28 11.0 29 16.0 30 19.0 31 17.0 32 27.0 33 46.5 34 60.0 35 68.5 36 96.5 37 123.0 38 143.5 39 178.5 40 204.5 41 214.5 42 223.0 43 255.0 44 288.0 45 274.0 46 242.5 47 239.5 48 221.5 49 180.0 50 159.0 51 139.5 52 112.5 53 97.5 54 78.5 55 57.0 56 42.5 57 32.5 58 27.0 59 17.0 60 13.5 61 12.5 62 9.0 63 7.5 64 3.0 65 0.0 66 0.5 67 1.0 68 0.5 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.5 76 0.5 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.02 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 85.3 #Duplication Level Percentage of deduplicated Percentage of total 1 86.28370457209847 73.6 2 11.019929660023447 18.8 3 2.0515826494724503 5.25 4 0.5275498241500586 1.7999999999999998 5 0.08792497069167644 0.375 6 0.0 0.0 7 0.029308323563892142 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 7 0.17500000000000002 No Hit GCAGTCGGAACTAAATGGCTGCCTCACTACAAGCAGCAGCTACACTGATG 5 0.125 No Hit TCTTAGAGCTGTATATGAAAATCAATTACGAGTAAGAGAAGAAAACAGAT 5 0.125 No Hit CATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.21250000000000002 0.0 0.0 0.0 0.0 86-87 0.275 0.0 0.0 0.0 0.0 88-89 0.35 0.0 0.0 0.0 0.0 90-91 0.5125 0.0 0.0 0.0 0.0 92-93 0.625 0.0 0.0 0.0 0.0 94-95 0.7 0.0 0.0 0.0 0.0 96-97 0.825 0.0 0.0 0.0 0.0 98-99 0.9375 0.0 0.0 0.0 0.0 100-101 1.0499999999999998 0.0 0.0 0.0 0.0 102-103 1.15 0.0 0.0 0.0 0.0 104-105 1.2125 0.0 0.0 0.0 0.0 106-107 1.3125 0.0 0.0 0.0 0.0 108-109 1.4625 0.0 0.0 0.0 0.0 110-111 1.6124999999999998 0.0 0.0 0.0 0.0 112-113 1.85 0.0 0.0 0.0 0.0 114-115 2.075 0.0 0.0 0.0 0.0 116-117 2.3625 0.0 0.0 0.0 0.0 118-119 2.6375 0.0 0.0 0.0 0.0 120-121 2.8 0.0 0.0 0.0 0.0 122-123 3.1625 0.0 0.0 0.0 0.0 124-125 3.3625 0.0 0.0 0.0 0.0 126-127 3.7125 0.0 0.0 0.0 0.0 128-129 4.15 0.0 0.0 0.0 0.0 130-131 4.4125 0.0 0.0 0.0 0.0 132-133 4.6625 0.0 0.0 0.0 0.0 134-135 5.1625 0.0 0.0 0.0 0.0 136-137 5.574999999999999 0.0 0.0 0.0 0.0 138-139 5.9625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGAATAT 10 0.006830828 145.0 1 CTGTTCT 20 0.00593511 29.0 120-124 >>END_MODULE Read 807183 spots for SRR12671348.sra Written 807183 spots for SRR12671348.sra Read 807183 spots for SRR12671348.sra Written 807183 spots for SRR12671348.sra Read 807183 spots for SRR12671348.sra Written 807183 spots for SRR12671348.sra Read 807183 spots for SRR12671348.sra Written 807183 spots for SRR12671348.sra Read 807183 spots for SRR12671348.sra Written 807183 spots for SRR12671348.sra Read 807183 spots for SRR12671348.sra Written 807183 spots for SRR12671348.sra Read 807183 spots for SRR12671348.sra Written 807183 spots for SRR12671348.sra Read 807183 spots for SRR12671348.sra Written 807183 spots for SRR12671348.sra Read 807183 spots for SRR12671348.sra Written 807183 spots for SRR12671348.sra Read 807183 spots for SRR12671348.sra Written 807183 spots for SRR12671348.sra Read 807183 spots for SRR12671348.sra Written 807183 spots for SRR12671348.sra Read 807183 spots for SRR12671348.sra Written 807183 spots for SRR12671348.sra Read 807183 spots for SRR12671348.sra Written 807183 spots for SRR12671348.sra Read 807183 spots for SRR12671348.sra Written 807183 spots for SRR12671348.sra Read 807183 spots for SRR12671348.sra Written 807183 spots for SRR12671348.sra Read 807183 spots for SRR12671348.sra Written 807183 spots for SRR12671348.sra Read 807183 spots for SRR12671348.sra Written 807183 spots for SRR12671348.sra Read 807183 spots for SRR12671348.sra Written 807183 spots for SRR12671348.sra Read 807196 spots for SRR12671348.sra Written 807196 spots for SRR12671348.sra Read 807183 spots for SRR12671348.sra Written 807183 spots for SRR12671348.sra SRR ids: ['SRR12671348.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_32zbcvdt SRR12671348.sra spots: 16143673 blocks: [[1, 807183], [807184, 1614366], [1614367, 2421549], [2421550, 3228732], [3228733, 4035915], [4035916, 4843098], [4843099, 5650281], [5650282, 6457464], [6457465, 7264647], [7264648, 8071830], [8071831, 8879013], [8879014, 9686196], [9686197, 10493379], [10493380, 11300562], [11300563, 12107745], [12107746, 12914928], [12914929, 13722111], [13722112, 14529294], [14529295, 15336477], [15336478, 16143673]] SRR12671348 file size 5464625 SRR12671348 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671348 SRR12671348_1.fastq SRR12671348_2.fastq Input file: SRR12671348_1.fastq Paired file: SRR12671348_2.fastq trimmed: SRR12671348-trimmed-pair1.fastq, SRR12671348-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 17:07:37 2025 >> started Tue Feb 11 17:07:55 2025 >> done (17.255s) 16143673 read pairs processed; of these: 179 ( 0.00%) short read pairs filtered out after trimming by size control 3264 ( 0.02%) empty read pairs filtered out after trimming by size control 16140230 (99.98%) read pairs available; of these: 1282276 ( 7.94%) trimmed read pairs available after processing 14857954 (92.06%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 15 0.00% 19 8 0.00% 20 9 0.00% 21 13 0.00% 22 14 0.00% 23 33 0.00% 24 32 0.00% 25 18 0.00% 26 34 0.00% 27 24 0.00% 28 29 0.00% 29 35 0.00% 30 33 0.00% 31 33 0.00% 32 48 0.00% 33 22 0.00% 34 26 0.00% 35 44 0.00% 36 35 0.00% 37 34 0.00% 38 30 0.00% 39 38 0.00% 40 56 0.00% 41 54 0.00% 42 51 0.00% 43 53 0.00% 44 55 0.00% 45 60 0.00% 46 83 0.00% 47 63 0.00% 48 81 0.00% 49 103 0.00% 50 111 0.00% 51 120 0.00% 52 130 0.00% 53 157 0.00% 54 156 0.00% 55 158 0.00% 56 186 0.00% 57 270 0.00% 58 290 0.00% 59 301 0.00% 60 383 0.00% 61 414 0.00% 62 449 0.00% 63 516 0.00% 64 645 0.00% 65 694 0.00% 66 724 0.00% 67 834 0.01% 68 930 0.01% 69 1001 0.01% 70 1225 0.01% 71 1295 0.01% 72 1524 0.01% 73 1768 0.01% 74 1966 0.01% 75 2103 0.01% 76 2237 0.01% 77 2546 0.02% 78 2692 0.02% 79 2977 0.02% 80 3092 0.02% 81 3477 0.02% 82 3687 0.02% 83 4020 0.02% 84 4562 0.03% 85 4758 0.03% 86 4997 0.03% 87 5443 0.03% 88 5624 0.03% 89 5784 0.04% 90 6192 0.04% 91 6535 0.04% 92 6885 0.04% 93 7367 0.05% 94 7819 0.05% 95 8325 0.05% 96 8621 0.05% 97 9043 0.06% 98 9145 0.06% 99 9745 0.06% 100 10052 0.06% 101 10201 0.06% 102 10602 0.07% 103 11272 0.07% 104 11401 0.07% 105 11708 0.07% 106 12671 0.08% 107 12992 0.08% 108 13322 0.08% 109 13388 0.08% 110 14144 0.09% 111 14324 0.09% 112 14795 0.09% 113 15167 0.09% 114 15769 0.10% 115 16372 0.10% 116 17102 0.11% 117 17765 0.11% 118 18066 0.11% 119 18721 0.12% 120 18854 0.12% 121 19491 0.12% 122 19954 0.12% 123 20476 0.13% 124 20919 0.13% 125 21189 0.13% 126 22494 0.14% 127 22947 0.14% 128 23524 0.15% 129 24295 0.15% 130 24354 0.15% 131 24959 0.15% 132 25177 0.16% 133 25893 0.16% 134 25926 0.16% 135 27064 0.17% 136 27675 0.17% 137 28650 0.18% 138 28907 0.18% 139 30101 0.19% 140 30323 0.19% 141 30900 0.19% 142 31342 0.19% 143 31236 0.19% 144 32406 0.20% 145 32724 0.20% 146 33603 0.21% 147 34360 0.21% 148 35704 0.22% 149 35273 0.22% 150 36533 0.23% 151 14857954 92.06% 16140230 reads passed initial QC criterion=sequence-density sequence-density=0.33 sequence-density-rank=1 fanout-score=2.44 fanout-score-rank=23 prefix-density=0.37 prefix-fanout=2.2 sequence=TTCCACATAGTCCAGTAGCGTCCATCATAGTACCCTGGTGAGCTGTGGTGCTCACGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTTCGAGCGAAGAAGGTAATCAATTTCCTTGGCCAATTCCTCCTCTGTGAGATCTGGAAGGTAAGAAAGAGTCTCGAACTTCTTCAATCCAGTTGGTGGCCACACCTGCATGCATTGAACTCGTCCACCATTGCTTGCAATGGAAGTAATGTCATTAGCCTTTCTGGTACTGACTGGGAAAGCTGCGGCAGACTTGAGACCATTGAATGGTGCCACCATGTTGGCTTGTGCCGGGGTGCGGTTGACGGTGGCAACGGCTGCCGATGAGATCATAGAGGAGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=633.96 fanout-score-rank=1 prefix-density=0.26 prefix-fanout=18.9 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTG criterion=sequence-density sequence-density=0.49 sequence-density-rank=1 fanout-score=2.08 fanout-score-rank=33 prefix-density=0.50 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.09 sequence-density-rank=28 fanout-score=74.24 fanout-score-rank=1 prefix-density=0.60 prefix-fanout=10.7 sequence=AAAAGAAAAGAAAA SRR12671348 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 17:09:07 Started mapping on | Feb 11 17:09:08 Finished on | Feb 11 17:11:03 Mapping speed, Million of reads per hour | 505.26 Number of input reads | 16140230 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 14925552 Uniquely mapped reads % | 92.47% Average mapped length | 296.18 Number of splices: Total | 14963533 Number of splices: Annotated (sjdb) | 14638656 Number of splices: GT/AG | 14676762 Number of splices: GC/AG | 230104 Number of splices: AT/AC | 9441 Number of splices: Non-canonical | 47226 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.92 Insertion rate per base | 0.02% Insertion average length | 2.25 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 357620 % of reads mapped to multiple loci | 2.22% Number of reads mapped to too many loci | 21874 % of reads mapped to too many loci | 0.14% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.04% % of reads unmapped: other | 0.13% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 857058 857058 857058 N_multimapping 357620 357620 357620 N_noFeature 587628 14696495 668591 N_ambiguous 238840 1012 90272 UnstrandedReadsAssigned:14099084 PositiveStrandReadsAssigned:228045 NegativeStrandReadsAssigned:14166689 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671348 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671348-trimmed-pair1.fastq SRR12671348-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,140,230 reads, 14,119,216 reads pseudoaligned [quant] estimated average fragment length: 275.958 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,034 rounds 52401 SRR12671348.ke.tsv 34699 SRR12671348.se.tsv 87100 total ==> SRR12671348.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1743.04 586 21.7589 Potri.005G024800.1.v4.1 1035 760.042 225 19.1598 Potri.004G059700.1.v4.1 961 686.252 8 0.75449 Potri.007G009000.2.v4.1 1416 1141.04 0 0 Potri.003G141000.2.v4.1 2943 2668.04 745.464 18.0834 Potri.016G087400.1.v4.1 270 80.1619 629 507.843 Potri.015G069301.1.v4.1 564 306.459 0 0 Potri.010G195200.1.v4.1 1773 1498.04 116 5.01165 Potri.012G127500.1.v4.1 977 702.189 57 5.25373 ==> SRR12671348.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 201 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 132 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 3 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 8 SRR12671348 completed mapping pipeline successfully