Starting /dee2/code/volunteer_pipeline.sh SRR12671349 current disk space = 3053440774144 free memory = 1442757876 SRR12671349 SRAfilesize 7831061e66ca7007134543016f85fa0f SRR12671349.sra SRR12671349.sra file validated SRR12671349 is paired end SRR12671349 is conventional basespace SRR12671349 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671349_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5945 37.0 37.0 37.0 37.0 37.0 2 36.324 37.0 37.0 37.0 37.0 37.0 3 36.5 37.0 37.0 37.0 37.0 37.0 4 36.6255 37.0 37.0 37.0 37.0 37.0 5 36.5315 37.0 37.0 37.0 37.0 37.0 6 36.598 37.0 37.0 37.0 37.0 37.0 7 36.494 37.0 37.0 37.0 37.0 37.0 8 36.5695 37.0 37.0 37.0 37.0 37.0 9 36.507 37.0 37.0 37.0 37.0 37.0 10-14 36.5697 37.0 37.0 37.0 37.0 37.0 15-19 36.5422 37.0 37.0 37.0 37.0 37.0 20-24 36.5039 37.0 37.0 37.0 37.0 37.0 25-29 36.4805 37.0 37.0 37.0 37.0 37.0 30-34 36.4821 37.0 37.0 37.0 37.0 37.0 35-39 36.46920000000001 37.0 37.0 37.0 37.0 37.0 40-44 36.4541 37.0 37.0 37.0 37.0 37.0 45-49 36.4033 37.0 37.0 37.0 37.0 37.0 50-54 36.394400000000005 37.0 37.0 37.0 37.0 37.0 55-59 36.376999999999995 37.0 37.0 37.0 37.0 37.0 60-64 36.3541 37.0 37.0 37.0 37.0 37.0 65-69 36.31 37.0 37.0 37.0 37.0 37.0 70-74 36.2921 37.0 37.0 37.0 37.0 37.0 75-79 36.31999999999999 37.0 37.0 37.0 37.0 37.0 80-84 36.294200000000004 37.0 37.0 37.0 37.0 37.0 85-89 36.2615 37.0 37.0 37.0 37.0 37.0 90-94 36.22840000000001 37.0 37.0 37.0 37.0 37.0 95-99 36.173700000000004 37.0 37.0 37.0 37.0 37.0 100-104 36.174800000000005 37.0 37.0 37.0 37.0 37.0 105-109 36.1777 37.0 37.0 37.0 37.0 37.0 110-114 36.043899999999994 37.0 37.0 37.0 37.0 37.0 115-119 36.1311 37.0 37.0 37.0 37.0 37.0 120-124 36.031400000000005 37.0 37.0 37.0 37.0 37.0 125-129 36.0785 37.0 37.0 37.0 37.0 37.0 130-134 36.019400000000005 37.0 37.0 37.0 37.0 37.0 135-139 36.030300000000004 37.0 37.0 37.0 37.0 37.0 140-144 35.9731 37.0 37.0 37.0 37.0 37.0 145-149 35.8634 37.0 37.0 37.0 37.0 37.0 150-151 35.77175 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 0.0 21 1.0 22 2.0 23 3.0 24 4.0 25 3.0 26 6.0 27 5.0 28 9.0 29 16.0 30 26.0 31 34.0 32 46.0 33 59.0 34 109.0 35 297.0 36 2993.0 37 386.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 51.15 10.525 5.4 32.925 2 20.672353236327147 12.167586552935274 38.45960863020572 28.700451580531862 3 18.7 18.075 27.125 36.1 4 23.95 26.1 23.825 26.125 5 22.825 32.225 23.9 21.05 6 18.675 33.975 24.125 23.225 7 14.75 26.325 43.175000000000004 15.75 8 15.225 23.724999999999998 33.675 27.375 9 15.2 23.400000000000002 35.475 25.924999999999997 10-14 19.675 30.044999999999998 28.294999999999998 21.985 15-19 20.01 27.74 28.02 24.23 20-24 19.72 28.345 28.405 23.53 25-29 20.015 28.22 28.025 23.74 30-34 19.865 28.415000000000003 27.744999999999997 23.974999999999998 35-39 19.955000000000002 28.38 28.005000000000003 23.66 40-44 19.794999999999998 28.910000000000004 28.305000000000003 22.99 45-49 19.68 28.599999999999998 28.16 23.56 50-54 19.939999999999998 28.815 27.794999999999998 23.45 55-59 20.025000000000002 28.475 28.015 23.485 60-64 20.49 28.349999999999998 27.279999999999998 23.880000000000003 65-69 19.470000000000002 28.74 27.634999999999998 24.154999999999998 70-74 20.345 28.199999999999996 27.765 23.69 75-79 20.13 28.52 27.47 23.880000000000003 80-84 19.634999999999998 28.73 27.965 23.669999999999998 85-89 20.330000000000002 28.455000000000002 27.49 23.724999999999998 90-94 19.975 28.044999999999998 27.97 24.01 95-99 20.169999999999998 29.09 27.22 23.52 100-104 20.175 28.575 27.725 23.525 105-109 21.175 28.115000000000002 27.495000000000005 23.215 110-114 20.445 28.235 28.194999999999997 23.125 115-119 20.14 28.675 27.515 23.669999999999998 120-124 19.96 29.185 27.034999999999997 23.82 125-129 20.895 28.275 27.305 23.525 130-134 20.385 27.58 27.805000000000003 24.23 135-139 21.365000000000002 28.375 27.015 23.244999999999997 140-144 21.175 28.34 27.27 23.215 145-149 21.265 28.65 26.529999999999998 23.555 150-151 20.150000000000002 27.1375 28.175 24.5375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.5 5 0.5 6 0.0 7 0.5 8 0.5 9 0.5 10 1.0 11 0.5 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 2.0 20 2.0 21 0.5 22 1.5 23 2.0 24 1.0 25 3.5 26 6.0 27 5.5 28 12.0 29 19.5 30 20.5 31 28.5 32 39.0 33 50.5 34 57.0 35 61.0 36 78.0 37 104.0 38 134.5 39 172.0 40 200.0 41 213.5 42 229.0 43 238.5 44 252.5 45 256.5 46 255.0 47 268.5 48 241.5 49 190.5 50 167.5 51 151.0 52 122.0 53 89.5 54 76.0 55 66.0 56 52.0 57 39.0 58 28.0 59 21.0 60 13.0 61 9.0 62 5.0 63 1.5 64 1.5 65 2.5 66 1.5 67 0.0 68 0.5 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.35000000000000003 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 82.8 #Duplication Level Percentage of deduplicated Percentage of total 1 83.87681159420289 69.45 2 12.620772946859905 20.9 3 2.6268115942028984 6.525 4 0.6340579710144928 2.1 5 0.2113526570048309 0.8750000000000001 6 0.030193236714975844 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTAGAATTGGATGGTAATGTTTCTTTTCTTGGGTAATGGGTGAACCTTCA 6 0.15 No Hit GCATGAGTTATCTTCACTGATCATTGTCTCTCGAGGACGAGATGCCCAGA 5 0.125 No Hit TGTAGTTACAACAGTAGTCTCACGAATAATTTGCTTCACTGATTTTTGGA 5 0.125 No Hit GGGGTGTCCACTGTTTGCAAATTTCACAGCAAGTGAAGCAGCACAGCTCG 5 0.125 No Hit CGGACAGGATATGTATATGCTTCATAATTGATTTGTTGGCCCATGGAACT 5 0.125 No Hit GTTTCATCAATGGCACTCTCTCACAGCCAATAACTTCAACAACTTCCCTA 5 0.125 No Hit GTGGACCTCTCAATCATGTTGTCACCCTCAAATCCAGAGATTGGGACAAA 5 0.125 No Hit GTGTAAACAAGAAGTGCACCTCCTGCAAGGATTCCAGCTAGGGTAACAGC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.07500000000000001 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.3 0.0 0.0 0.0 0.0 90-91 0.3375 0.0 0.0 0.0 0.0 92-93 0.375 0.0 0.0 0.0 0.0 94-95 0.45 0.0 0.0 0.0 0.0 96-97 0.4875 0.0 0.0 0.0 0.0 98-99 0.575 0.0 0.0 0.0 0.0 100-101 0.7124999999999999 0.0 0.0 0.0 0.0 102-103 0.75 0.0 0.0 0.0 0.0 104-105 0.9624999999999999 0.0 0.0 0.0 0.0 106-107 1.175 0.0 0.0 0.0 0.0 108-109 1.325 0.0 0.0 0.0 0.0 110-111 1.4874999999999998 0.0 0.0 0.0 0.0 112-113 1.6124999999999998 0.0 0.0 0.0 0.0 114-115 1.725 0.0 0.0 0.0 0.0 116-117 1.8875 0.0 0.0 0.0 0.0 118-119 1.9874999999999998 0.0 0.0 0.0 0.0 120-121 2.0625 0.0 0.0 0.0 0.0 122-123 2.3375 0.0 0.0 0.0 0.0 124-125 2.55 0.0 0.0 0.0 0.0 126-127 2.9 0.0 0.0 0.0 0.0 128-129 3.175 0.0 0.0 0.0 0.0 130-131 3.45 0.0 0.0 0.0 0.0 132-133 3.8125 0.0 0.0 0.0 0.0 134-135 4.1375 0.0 0.0 0.0 0.0 136-137 4.45 0.0 0.0 0.0 0.0 138-139 4.675 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCCACAT 10 0.006830828 145.0 1 >>END_MODULE SRR12671349 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671349_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.289 37.0 37.0 37.0 37.0 37.0 2 36.077 37.0 37.0 37.0 37.0 37.0 3 36.1475 37.0 37.0 37.0 37.0 37.0 4 36.3715 37.0 37.0 37.0 37.0 37.0 5 36.2825 37.0 37.0 37.0 37.0 37.0 6 36.284 37.0 37.0 37.0 37.0 37.0 7 36.203 37.0 37.0 37.0 37.0 37.0 8 36.188 37.0 37.0 37.0 37.0 37.0 9 36.165 37.0 37.0 37.0 37.0 37.0 10-14 36.2868 37.0 37.0 37.0 37.0 37.0 15-19 36.240300000000005 37.0 37.0 37.0 37.0 37.0 20-24 36.197300000000006 37.0 37.0 37.0 37.0 37.0 25-29 36.207699999999996 37.0 37.0 37.0 37.0 37.0 30-34 36.1264 37.0 37.0 37.0 37.0 37.0 35-39 36.179 37.0 37.0 37.0 37.0 37.0 40-44 36.1271 37.0 37.0 37.0 37.0 37.0 45-49 36.0969 37.0 37.0 37.0 37.0 37.0 50-54 36.0343 37.0 37.0 37.0 37.0 37.0 55-59 36.017999999999994 37.0 37.0 37.0 37.0 37.0 60-64 35.9658 37.0 37.0 37.0 37.0 37.0 65-69 36.01520000000001 37.0 37.0 37.0 37.0 37.0 70-74 35.9612 37.0 37.0 37.0 37.0 37.0 75-79 35.9865 37.0 37.0 37.0 37.0 37.0 80-84 35.938 37.0 37.0 37.0 37.0 37.0 85-89 35.9268 37.0 37.0 37.0 37.0 37.0 90-94 35.938 37.0 37.0 37.0 37.0 37.0 95-99 35.850300000000004 37.0 37.0 37.0 37.0 37.0 100-104 35.8543 37.0 37.0 37.0 37.0 37.0 105-109 35.7677 37.0 37.0 37.0 37.0 37.0 110-114 35.7742 37.0 37.0 37.0 37.0 37.0 115-119 35.8466 37.0 37.0 37.0 37.0 37.0 120-124 35.756600000000006 37.0 37.0 37.0 37.0 37.0 125-129 35.631899999999995 37.0 37.0 37.0 37.0 37.0 130-134 35.518100000000004 37.0 37.0 37.0 37.0 37.0 135-139 35.503699999999995 37.0 37.0 37.0 37.0 37.0 140-144 35.5888 37.0 37.0 37.0 37.0 37.0 145-149 35.35699999999999 37.0 37.0 37.0 34.6 37.0 150-151 35.095 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 2.0 14 3.0 15 0.0 16 1.0 17 0.0 18 2.0 19 2.0 20 2.0 21 2.0 22 11.0 23 3.0 24 3.0 25 5.0 26 7.0 27 7.0 28 18.0 29 18.0 30 32.0 31 41.0 32 60.0 33 103.0 34 177.0 35 516.0 36 2654.0 37 329.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.675000000000004 23.974999999999998 9.6 23.75 2 26.3 24.85 33.074999999999996 15.775 3 21.2 27.075 33.525 18.2 4 23.474999999999998 36.1 22.8 17.625 5 24.474999999999998 38.550000000000004 20.5 16.475 6 19.400000000000002 40.1 22.45 18.05 7 19.400000000000002 20.625 40.2 19.775000000000002 8 18.05 26.224999999999998 30.25 25.474999999999998 9 21.75 24.099999999999998 30.775000000000002 23.375 10-14 22.439999999999998 29.965000000000003 26.61 20.985 15-19 22.82 28.48 27.54 21.16 20-24 22.509999999999998 28.58 27.884999999999998 21.025 25-29 22.475 29.104999999999997 28.175 20.244999999999997 30-34 21.82 28.815 28.18 21.185000000000002 35-39 22.36 28.715000000000003 27.91 21.015 40-44 22.64 27.83 28.299999999999997 21.23 45-49 22.445 28.18 27.97 21.404999999999998 50-54 22.12 28.075 28.810000000000002 20.995 55-59 22.675 28.515 27.525 21.285 60-64 22.325 28.015 28.165000000000003 21.495 65-69 22.39 27.58 28.62 21.41 70-74 22.985 27.465 27.860000000000003 21.69 75-79 22.95 27.915 27.595 21.54 80-84 22.575 28.325 27.315 21.785 85-89 23.215 28.384999999999998 27.485 20.915 90-94 23.365 27.595 28.08 20.96 95-99 22.98 27.93 27.884999999999998 21.205 100-104 23.965 27.27 28.235 20.53 105-109 23.880000000000003 27.445000000000004 27.900000000000002 20.775 110-114 23.745 27.905 27.63 20.72 115-119 23.585 28.345 27.465 20.605 120-124 23.685000000000002 27.82 27.72 20.775 125-129 23.715 28.910000000000004 26.735 20.64 130-134 24.585 28.139999999999997 27.05 20.225 135-139 24.695 27.52 27.38 20.405 140-144 25.455 27.41 27.58 19.555 145-149 24.312431243124312 28.57285728572857 27.122712271227122 19.99199919991999 150-151 25.3 27.6125 26.5625 20.525 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 1.0 11 1.0 12 0.5 13 0.5 14 1.0 15 1.5 16 1.0 17 0.5 18 1.0 19 0.5 20 1.0 21 1.0 22 0.5 23 1.5 24 2.0 25 3.0 26 4.0 27 8.0 28 10.0 29 12.0 30 16.0 31 23.0 32 36.0 33 49.5 34 57.5 35 70.5 36 95.5 37 118.0 38 136.5 39 170.0 40 203.0 41 234.5 42 266.5 43 269.0 44 274.0 45 288.5 46 263.5 47 224.0 48 205.0 49 178.5 50 154.0 51 140.5 52 104.5 53 71.0 54 63.0 55 57.0 56 48.0 57 36.0 58 22.0 59 18.5 60 15.0 61 6.0 62 6.0 63 6.0 64 5.5 65 4.5 66 1.5 67 0.0 68 0.5 69 1.0 70 0.5 71 0.0 72 0.0 73 0.5 74 0.5 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 1.0 87 1.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.01 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 82.6 #Duplication Level Percentage of deduplicated Percentage of total 1 84.07990314769975 69.45 2 12.378934624697337 20.45 3 2.4818401937046004 6.15 4 0.665859564164649 2.1999999999999997 5 0.3026634382566586 1.25 6 0.06053268765133172 0.3 7 0.0 0.0 8 0.03026634382566586 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 8 0.2 No Hit TCCAAACATTTCCCATCCAATTCCATTCCACAAAAATTATTTGCCCTTTT 6 0.15 No Hit GCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTTTCCTTCT 6 0.15 No Hit CTTATATTTAAAGACAAAAAGAAGTGTCTAACAACAACATCCACACTACT 5 0.125 No Hit TGTCAAGGCTGCACAAGGACGAGTTCCAGTGTTCTTGGATGGTGGTGTAA 5 0.125 No Hit CACCACTCCAAAATACTCCAAGGCAAGGTATGATGAAATTGTCAAGGAAG 5 0.125 No Hit GCTCTCTTTTGCACCAAAAACTTCAAGCTTTATCCTTCACTCTATCAAGC 5 0.125 No Hit TGCAGGTTAATCCTGTGATTATAGAGGATACCGTGGCTCCTCATCTGCTT 5 0.125 No Hit CAGCCTGCAACAATCTTCACAGCAAGCAGAAGAGGCTCTCTCCCAAGGCC 5 0.125 No Hit CGGTAATGAACAGAAAGGAAGCATATTGTACTCCGCATATGGATCCAGTG 5 0.125 No Hit CAGGAGATTGTGAAAAAAGAAAGGCAGAAGCAAGTTCAGCAATGGCAGCC 5 0.125 No Hit GTAAAAATATCCTCCCCCCTTCTCTCCTCCTCTTTCTCTCTCTTTCAAAC 5 0.125 No Hit TACACTACCAAGGAGTATTATATTGAGTTGAAACCTCTGTTTTCAGCTTT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0125 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.16249999999999998 0.0 0.0 0.0 0.0 86-87 0.21250000000000002 0.0 0.0 0.0 0.0 88-89 0.325 0.0 0.0 0.0 0.0 90-91 0.3625 0.0 0.0 0.0 0.0 92-93 0.4 0.0 0.0 0.0 0.0 94-95 0.475 0.0 0.0 0.0 0.0 96-97 0.5125 0.0 0.0 0.0 0.0 98-99 0.6000000000000001 0.0 0.0 0.0 0.0 100-101 0.7375 0.0 0.0 0.0 0.0 102-103 0.775 0.0 0.0 0.0 0.0 104-105 0.9875 0.0 0.0 0.0 0.0 106-107 1.2 0.0 0.0 0.0 0.0 108-109 1.375 0.0 0.0 0.0 0.0 110-111 1.5375 0.0 0.0 0.0 0.0 112-113 1.7125 0.0 0.0 0.0 0.0 114-115 1.825 0.0 0.0 0.0 0.0 116-117 1.9875 0.0 0.0 0.0 0.0 118-119 2.0875 0.0 0.0 0.0 0.0 120-121 2.1625 0.0 0.0 0.0 0.0 122-123 2.4375 0.0 0.0 0.0 0.0 124-125 2.65 0.0 0.0 0.0 0.0 126-127 3.0125 0.0 0.0 0.0 0.0 128-129 3.3125 0.0 0.0 0.0 0.0 130-131 3.5999999999999996 0.0 0.0 0.0 0.0 132-133 3.9875000000000003 0.0 0.0 0.0 0.0 134-135 4.325 0.0 0.0 0.0 0.0 136-137 4.65 0.0 0.0 0.0 0.0 138-139 4.9 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGGTTAG 10 0.006830828 145.0 7 >>END_MODULE Read 1262930 spots for SRR12671349.sra Written 1262930 spots for SRR12671349.sra Read 1262930 spots for SRR12671349.sra Written 1262930 spots for SRR12671349.sra Read 1262930 spots for SRR12671349.sra Written 1262930 spots for SRR12671349.sra Read 1262930 spots for SRR12671349.sra Written 1262930 spots for SRR12671349.sra Read 1262930 spots for SRR12671349.sra Written 1262930 spots for SRR12671349.sra Read 1262930 spots for SRR12671349.sra Written 1262930 spots for SRR12671349.sra Read 1262930 spots for SRR12671349.sra Written 1262930 spots for SRR12671349.sra Read 1262930 spots for SRR12671349.sra Written 1262930 spots for SRR12671349.sra Read 1262930 spots for SRR12671349.sra Written 1262930 spots for SRR12671349.sra Read 1262930 spots for SRR12671349.sra Written 1262930 spots for SRR12671349.sra Read 1262930 spots for SRR12671349.sra Written 1262930 spots for SRR12671349.sra Read 1262932 spots for SRR12671349.sra Written 1262932 spots for SRR12671349.sra Read 1262930 spots for SRR12671349.sra Written 1262930 spots for SRR12671349.sra Read 1262930 spots for SRR12671349.sra Written 1262930 spots for SRR12671349.sra Read 1262930 spots for SRR12671349.sra Written 1262930 spots for SRR12671349.sra Read 1262930 spots for SRR12671349.sra Written 1262930 spots for SRR12671349.sra Read 1262930 spots for SRR12671349.sra Written 1262930 spots for SRR12671349.sra Read 1262930 spots for SRR12671349.sra Written 1262930 spots for SRR12671349.sra Read 1262930 spots for SRR12671349.sra Written 1262930 spots for SRR12671349.sra Read 1262930 spots for SRR12671349.sra Written 1262930 spots for SRR12671349.sra SRR ids: ['SRR12671349.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_fciint25 SRR12671349.sra spots: 25258602 blocks: [[1, 1262930], [1262931, 2525860], [2525861, 3788790], [3788791, 5051720], [5051721, 6314650], [6314651, 7577580], [7577581, 8840510], [8840511, 10103440], [10103441, 11366370], [11366371, 12629300], [12629301, 13892230], [13892231, 15155160], [15155161, 16418090], [16418091, 17681020], [17681021, 18943950], [18943951, 20206880], [20206881, 21469810], [21469811, 22732740], [22732741, 23995670], [23995671, 25258602]] SRR12671349 file size 8562277 SRR12671349 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671349 SRR12671349_1.fastq SRR12671349_2.fastq Input file: SRR12671349_1.fastq Paired file: SRR12671349_2.fastq trimmed: SRR12671349-trimmed-pair1.fastq, SRR12671349-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 18:20:53 2025 >> started Tue Feb 11 18:21:19 2025 >> done (26.357s) 25258602 read pairs processed; of these: 262 ( 0.00%) short read pairs filtered out after trimming by size control 7060 ( 0.03%) empty read pairs filtered out after trimming by size control 25251280 (99.97%) read pairs available; of these: 1597410 ( 6.33%) trimmed read pairs available after processing 23653870 (93.67%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 15 0.00% 19 32 0.00% 20 19 0.00% 21 32 0.00% 22 30 0.00% 23 37 0.00% 24 38 0.00% 25 46 0.00% 26 44 0.00% 27 42 0.00% 28 60 0.00% 29 43 0.00% 30 48 0.00% 31 61 0.00% 32 57 0.00% 33 42 0.00% 34 49 0.00% 35 42 0.00% 36 46 0.00% 37 64 0.00% 38 46 0.00% 39 71 0.00% 40 61 0.00% 41 73 0.00% 42 44 0.00% 43 58 0.00% 44 68 0.00% 45 63 0.00% 46 60 0.00% 47 84 0.00% 48 84 0.00% 49 114 0.00% 50 114 0.00% 51 127 0.00% 52 122 0.00% 53 165 0.00% 54 126 0.00% 55 157 0.00% 56 174 0.00% 57 213 0.00% 58 217 0.00% 59 245 0.00% 60 337 0.00% 61 354 0.00% 62 412 0.00% 63 468 0.00% 64 510 0.00% 65 487 0.00% 66 588 0.00% 67 624 0.00% 68 773 0.00% 69 792 0.00% 70 962 0.00% 71 1088 0.00% 72 1228 0.00% 73 1461 0.01% 74 1535 0.01% 75 1703 0.01% 76 1948 0.01% 77 2114 0.01% 78 2221 0.01% 79 2487 0.01% 80 2771 0.01% 81 3103 0.01% 82 3503 0.01% 83 3778 0.01% 84 4187 0.02% 85 4551 0.02% 86 5033 0.02% 87 5289 0.02% 88 5638 0.02% 89 5997 0.02% 90 6525 0.03% 91 7041 0.03% 92 7476 0.03% 93 8055 0.03% 94 8865 0.04% 95 9359 0.04% 96 9661 0.04% 97 10486 0.04% 98 10636 0.04% 99 11156 0.04% 100 11871 0.05% 101 12034 0.05% 102 12938 0.05% 103 13817 0.05% 104 14180 0.06% 105 14774 0.06% 106 15628 0.06% 107 16062 0.06% 108 16559 0.07% 109 16893 0.07% 110 17339 0.07% 111 17584 0.07% 112 18671 0.07% 113 19245 0.08% 114 19957 0.08% 115 20634 0.08% 116 21370 0.08% 117 22347 0.09% 118 22779 0.09% 119 23315 0.09% 120 24170 0.10% 121 24627 0.10% 122 25550 0.10% 123 25894 0.10% 124 27060 0.11% 125 27440 0.11% 126 28271 0.11% 127 29370 0.12% 128 29674 0.12% 129 30346 0.12% 130 30860 0.12% 131 31424 0.12% 132 32400 0.13% 133 33406 0.13% 134 33962 0.13% 135 34965 0.14% 136 35368 0.14% 137 36469 0.14% 138 37353 0.15% 139 38456 0.15% 140 38850 0.15% 141 39562 0.16% 142 40154 0.16% 143 41331 0.16% 144 42003 0.17% 145 43427 0.17% 146 43666 0.17% 147 44624 0.18% 148 46302 0.18% 149 46340 0.18% 150 47554 0.19% 151 23653870 93.67% 25251280 reads passed initial QC criterion=sequence-density sequence-density=0.43 sequence-density-rank=1 fanout-score=2.21 fanout-score-rank=32 prefix-density=0.45 prefix-fanout=2.1 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=40 fanout-score=49.16 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=5.6 sequence=AAACAGAATATTTACTTTTAGCGCAAGTTTCAATTCATGAGCTCGTTACATCACAAGTTAACATTACAAGCCAATAGTCCCAGCACAGAAAAAACTCTTTTGTTGCTCACTTTCCGGGAACGAAGTTTGTGGCATATGCCCAGGCGTTGTTGTTTACTGGGTCAGAAAGGTGGTCAGCCAGGTTCTCCAGTGGTCCCTTTCCGGTCACAATGGCCTGGACAAAGAATCCGAACATTGAGAACATAGCCAACCT criterion=sequence-density sequence-density=0.69 sequence-density-rank=1 fanout-score=2.15 fanout-score-rank=31 prefix-density=0.70 prefix-fanout=2.1 sequence=CCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATC criterion=fanout-score sequence-density=0.14 sequence-density-rank=22 fanout-score=31.89 fanout-score-rank=1 prefix-density=0.38 prefix-fanout=11.7 sequence=AAAGAAAAGAAAA SRR12671349 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 18:22:13 Started mapping on | Feb 11 18:22:13 Finished on | Feb 11 18:25:01 Mapping speed, Million of reads per hour | 541.10 Number of input reads | 25251280 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 23122361 Uniquely mapped reads % | 91.57% Average mapped length | 297.16 Number of splices: Total | 23356640 Number of splices: Annotated (sjdb) | 22860937 Number of splices: GT/AG | 22904642 Number of splices: GC/AG | 368252 Number of splices: AT/AC | 13603 Number of splices: Non-canonical | 70143 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.99 Insertion rate per base | 0.02% Insertion average length | 2.33 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 563331 % of reads mapped to multiple loci | 2.23% Number of reads mapped to too many loci | 63041 % of reads mapped to too many loci | 0.25% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.81% % of reads unmapped: other | 0.14% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1565588 1565588 1565588 N_multimapping 563331 563331 563331 N_noFeature 836005 22800719 945357 N_ambiguous 362636 1513 149588 UnstrandedReadsAssigned:21923720 PositiveStrandReadsAssigned:320129 NegativeStrandReadsAssigned:22027416 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671349 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671349-trimmed-pair1.fastq SRR12671349-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 25,251,280 reads, 22,029,563 reads pseudoaligned [quant] estimated average fragment length: 283.858 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,124 rounds 52401 SRR12671349.ke.tsv 34699 SRR12671349.se.tsv 87100 total ==> SRR12671349.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1735.14 1057 25.791 Potri.005G024800.1.v4.1 1035 752.142 579 32.5917 Potri.004G059700.1.v4.1 961 678.394 16 0.998542 Potri.007G009000.2.v4.1 1416 1133.14 0 0 Potri.003G141000.2.v4.1 2943 2660.14 1123 17.8733 Potri.016G087400.1.v4.1 270 76.5256 715 395.574 Potri.015G069301.1.v4.1 564 300.049 0 0 Potri.010G195200.1.v4.1 1773 1490.14 247 7.01775 Potri.012G127500.1.v4.1 977 694.267 145 8.8424 ==> SRR12671349.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 437 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 312 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 43 Potri.001G416900.v4.1 3 Potri.001G452600.v4.1 20 SRR12671349 completed mapping pipeline successfully