Starting /dee2/code/volunteer_pipeline.sh SRR12671351 current disk space = 3053369339904 free memory = 1514613136 SRR12671351 SRAfilesize e37d8f2bf3670d9269e3c085e88fedbf SRR12671351.sra SRR12671351.sra file validated SRR12671351 is paired end SRR12671351 is conventional basespace SRR12671351 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671351_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.6785 37.0 37.0 37.0 37.0 37.0 2 36.38825 37.0 37.0 37.0 37.0 37.0 3 36.4895 37.0 37.0 37.0 37.0 37.0 4 36.6155 37.0 37.0 37.0 37.0 37.0 5 36.5095 37.0 37.0 37.0 37.0 37.0 6 36.663 37.0 37.0 37.0 37.0 37.0 7 36.5465 37.0 37.0 37.0 37.0 37.0 8 36.628 37.0 37.0 37.0 37.0 37.0 9 36.632 37.0 37.0 37.0 37.0 37.0 10-14 36.6342 37.0 37.0 37.0 37.0 37.0 15-19 36.59930000000001 37.0 37.0 37.0 37.0 37.0 20-24 36.5596 37.0 37.0 37.0 37.0 37.0 25-29 36.5603 37.0 37.0 37.0 37.0 37.0 30-34 36.504200000000004 37.0 37.0 37.0 37.0 37.0 35-39 36.5001 37.0 37.0 37.0 37.0 37.0 40-44 36.4612 37.0 37.0 37.0 37.0 37.0 45-49 36.3957 37.0 37.0 37.0 37.0 37.0 50-54 36.3918 37.0 37.0 37.0 37.0 37.0 55-59 36.408500000000004 37.0 37.0 37.0 37.0 37.0 60-64 36.392900000000004 37.0 37.0 37.0 37.0 37.0 65-69 36.3769 37.0 37.0 37.0 37.0 37.0 70-74 36.321000000000005 37.0 37.0 37.0 37.0 37.0 75-79 36.244600000000005 37.0 37.0 37.0 37.0 37.0 80-84 36.3015 37.0 37.0 37.0 37.0 37.0 85-89 36.2768 37.0 37.0 37.0 37.0 37.0 90-94 36.25659999999999 37.0 37.0 37.0 37.0 37.0 95-99 36.189499999999995 37.0 37.0 37.0 37.0 37.0 100-104 36.2379 37.0 37.0 37.0 37.0 37.0 105-109 36.243 37.0 37.0 37.0 37.0 37.0 110-114 36.1169 37.0 37.0 37.0 37.0 37.0 115-119 36.155 37.0 37.0 37.0 37.0 37.0 120-124 36.132099999999994 37.0 37.0 37.0 37.0 37.0 125-129 36.0553 37.0 37.0 37.0 37.0 37.0 130-134 36.0387 37.0 37.0 37.0 37.0 37.0 135-139 36.002300000000005 37.0 37.0 37.0 37.0 37.0 140-144 35.90220000000001 37.0 37.0 37.0 37.0 37.0 145-149 35.8399 37.0 37.0 37.0 37.0 37.0 150-151 35.721999999999994 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 1.0 21 0.0 22 0.0 23 4.0 24 4.0 25 4.0 26 7.0 27 3.0 28 10.0 29 14.0 30 15.0 31 42.0 32 39.0 33 72.0 34 118.0 35 246.0 36 2934.0 37 486.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 52.800000000000004 11.425 5.325 30.45 2 21.530740276035132 11.191969887076537 35.10664993726474 32.17063989962359 3 18.45 16.950000000000003 28.1 36.5 4 23.35 23.674999999999997 25.124999999999996 27.85 5 23.549999999999997 31.4 23.9 21.15 6 19.85 34.425 24.0 21.725 7 15.45 26.724999999999998 41.525 16.3 8 15.725 25.525 33.324999999999996 25.424999999999997 9 15.775 23.625 35.325 25.275 10-14 19.855 30.464999999999996 27.560000000000002 22.12 15-19 20.185 28.655 27.98 23.18 20-24 20.61 28.175 27.744999999999997 23.47 25-29 20.01 27.77 28.065 24.154999999999998 30-34 20.11 28.51 27.935 23.445 35-39 19.96 29.03 27.765 23.244999999999997 40-44 19.86 29.110000000000003 27.505000000000003 23.525 45-49 20.45 28.89 27.284999999999997 23.375 50-54 20.62 28.084999999999997 27.839999999999996 23.455000000000002 55-59 20.285 28.26 27.425 24.03 60-64 20.94 28.4 26.77 23.89 65-69 20.3 28.115000000000002 27.994999999999997 23.59 70-74 20.380000000000003 28.470000000000002 27.395000000000003 23.755000000000003 75-79 20.990000000000002 28.225 27.93 22.855 80-84 20.135 28.345 27.650000000000002 23.87 85-89 20.86 28.605000000000004 27.115000000000002 23.419999999999998 90-94 20.424999999999997 27.750000000000004 28.060000000000002 23.765 95-99 20.68 28.395 27.544999999999998 23.380000000000003 100-104 20.849999999999998 27.79 27.555000000000003 23.805 105-109 20.965 28.26 27.58 23.195 110-114 20.415 27.96 27.71 23.915 115-119 21.12 28.63 27.57 22.68 120-124 21.375 28.255000000000003 27.21 23.16 125-129 20.985 27.560000000000002 27.750000000000004 23.705000000000002 130-134 21.19 27.88 27.665 23.265 135-139 20.580000000000002 28.389999999999997 27.305 23.724999999999998 140-144 21.435000000000002 28.04 26.845000000000002 23.68 145-149 21.415 27.61 27.345000000000002 23.630000000000003 150-151 21.212500000000002 27.737499999999997 27.0 24.05 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 2.0 1 3.0 2 2.0 3 0.0 4 0.0 5 1.0 6 1.0 7 0.0 8 0.5 9 0.5 10 0.5 11 0.5 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 1.0 18 3.0 19 2.5 20 0.5 21 0.5 22 2.0 23 3.0 24 4.5 25 7.5 26 7.5 27 8.0 28 9.0 29 15.5 30 19.0 31 16.0 32 26.5 33 42.5 34 56.0 35 68.0 36 82.5 37 112.0 38 122.0 39 136.0 40 164.0 41 180.0 42 221.5 43 253.5 44 270.5 45 256.5 46 273.0 47 283.0 48 236.0 49 207.5 50 184.0 51 152.0 52 117.5 53 93.5 54 71.5 55 59.5 56 52.0 57 42.0 58 30.0 59 29.5 60 25.5 61 14.5 62 9.5 63 6.5 64 3.5 65 2.0 66 2.0 67 2.0 68 1.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.375 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 84.39999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 85.57464454976304 72.225 2 11.34478672985782 19.15 3 2.3992890995260665 6.075 4 0.4146919431279621 1.4000000000000001 5 0.23696682464454977 1.0 6 0.02962085308056872 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGTCACATAAGGTTCAACCCTGTGAAGCATATTCACGGTTGCCTTGTTTA 6 0.15 No Hit CTCTTCACCTTGACCATCCTTACCCTTGCAACTTATATGCTGTCCAATAG 5 0.125 No Hit TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 5 0.125 No Hit GCTTGCTCGGCGATCTCAGAAAGCTCCCTGTAACTATTCTTTTCAGAAAA 5 0.125 No Hit GAGCAGCTGACACTGCAGCAGAAGGCTTCTTTATCGTTTCCTGTGTCTTT 5 0.125 No Hit TGCAAATCCAAAGTCTGCTACTTTAGCTCTCATACTCTCTGTCAACAGAA 5 0.125 No Hit GGCTAACAGAGGTGTTATTTACAGACCAATCGAAGGAGAAACAATTGAGG 5 0.125 No Hit TGCTTACATATATTAGGACCTTAACATAATGCCAGATGCAGAATGCAATG 5 0.125 No Hit GCCATACTCTTGCAACTAGCTTGGTTTTGTTAACAACATCAATCAATCTG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0125 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.21250000000000002 0.0 0.0 0.0 0.0 90-91 0.3375 0.0 0.0 0.0 0.0 92-93 0.4625 0.0 0.0 0.0 0.0 94-95 0.5125 0.0 0.0 0.0 0.0 96-97 0.5874999999999999 0.0 0.0 0.0 0.0 98-99 0.65 0.0 0.0 0.0 0.0 100-101 0.7124999999999999 0.0 0.0 0.0 0.0 102-103 0.75 0.0 0.0 0.0 0.0 104-105 0.8 0.0 0.0 0.0 0.0 106-107 0.95 0.0 0.0 0.0 0.0 108-109 1.2 0.0 0.0 0.0 0.0 110-111 1.3625 0.0 0.0 0.0 0.0 112-113 1.45 0.0 0.0 0.0 0.0 114-115 1.65 0.0 0.0 0.0 0.0 116-117 1.9 0.0 0.0 0.0 0.0 118-119 2.0625 0.0 0.0 0.0 0.0 120-121 2.25 0.0 0.0 0.0 0.0 122-123 2.4749999999999996 0.0 0.0 0.0 0.0 124-125 2.775 0.0 0.0 0.0 0.0 126-127 2.9749999999999996 0.0 0.0 0.0 0.0 128-129 3.25 0.0 0.0 0.0 0.0 130-131 3.525 0.0 0.0 0.0 0.0 132-133 4.0375 0.0 0.0 0.0 0.0 134-135 4.3375 0.0 0.0 0.0 0.0 136-137 4.6 0.0 0.0 0.0 0.0 138-139 4.8375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCTGATA 10 0.006830828 145.0 2 >>END_MODULE SRR12671351 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671351_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2235 37.0 37.0 37.0 37.0 37.0 2 35.768 37.0 37.0 37.0 37.0 37.0 3 35.9945 37.0 37.0 37.0 37.0 37.0 4 36.087 37.0 37.0 37.0 37.0 37.0 5 36.098 37.0 37.0 37.0 37.0 37.0 6 36.179 37.0 37.0 37.0 37.0 37.0 7 36.0945 37.0 37.0 37.0 37.0 37.0 8 36.2305 37.0 37.0 37.0 37.0 37.0 9 36.234 37.0 37.0 37.0 37.0 37.0 10-14 36.2269 37.0 37.0 37.0 37.0 37.0 15-19 36.2121 37.0 37.0 37.0 37.0 37.0 20-24 36.186699999999995 37.0 37.0 37.0 37.0 37.0 25-29 36.162099999999995 37.0 37.0 37.0 37.0 37.0 30-34 36.0775 37.0 37.0 37.0 37.0 37.0 35-39 36.0563 37.0 37.0 37.0 37.0 37.0 40-44 36.114200000000004 37.0 37.0 37.0 37.0 37.0 45-49 36.0126 37.0 37.0 37.0 37.0 37.0 50-54 35.9957 37.0 37.0 37.0 37.0 37.0 55-59 35.9739 37.0 37.0 37.0 37.0 37.0 60-64 35.9185 37.0 37.0 37.0 37.0 37.0 65-69 35.953799999999994 37.0 37.0 37.0 37.0 37.0 70-74 35.911100000000005 37.0 37.0 37.0 37.0 37.0 75-79 35.9524 37.0 37.0 37.0 37.0 37.0 80-84 35.8597 37.0 37.0 37.0 37.0 37.0 85-89 35.970600000000005 37.0 37.0 37.0 37.0 37.0 90-94 35.8528 37.0 37.0 37.0 37.0 37.0 95-99 35.8524 37.0 37.0 37.0 37.0 37.0 100-104 35.8009 37.0 37.0 37.0 37.0 37.0 105-109 35.7301 37.0 37.0 37.0 37.0 37.0 110-114 35.7158 37.0 37.0 37.0 37.0 37.0 115-119 35.7373 37.0 37.0 37.0 37.0 37.0 120-124 35.7061 37.0 37.0 37.0 37.0 37.0 125-129 35.7292 37.0 37.0 37.0 37.0 37.0 130-134 35.63 37.0 37.0 37.0 37.0 37.0 135-139 35.5535 37.0 37.0 37.0 37.0 37.0 140-144 35.6344 37.0 37.0 37.0 37.0 37.0 145-149 35.6072 37.0 37.0 37.0 37.0 37.0 150-151 35.25125 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 4.0 14 3.0 15 3.0 16 4.0 17 0.0 18 0.0 19 2.0 20 1.0 21 6.0 22 3.0 23 8.0 24 8.0 25 8.0 26 5.0 27 13.0 28 11.0 29 14.0 30 26.0 31 38.0 32 52.0 33 101.0 34 169.0 35 525.0 36 2736.0 37 260.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 48.775 23.150000000000002 7.825 20.25 2 28.375 24.8 29.375 17.45 3 20.75 27.875 34.075 17.299999999999997 4 25.1 32.6 22.875 19.425 5 25.474999999999998 36.15 21.349999999999998 17.025000000000002 6 21.175 39.525 21.825 17.474999999999998 7 21.825 21.75 38.35 18.075 8 19.625 26.025 29.425 24.925 9 22.925 25.6 29.65 21.825 10-14 24.060000000000002 29.205 25.674999999999997 21.060000000000002 15-19 23.905 27.875 27.779999999999998 20.44 20-24 23.925 28.12 26.97 20.985 25-29 23.345 27.839999999999996 27.800000000000004 21.015 30-34 23.0 27.595 27.66 21.745 35-39 22.814999999999998 27.705000000000002 27.700000000000003 21.78 40-44 23.115 28.689999999999998 27.529999999999998 20.665 45-49 23.335 27.715 27.88 21.07 50-54 23.080000000000002 27.900000000000002 27.87 21.15 55-59 23.275000000000002 27.92 27.55 21.255 60-64 23.02 28.925 27.105 20.95 65-69 23.625 27.725 27.384999999999998 21.265 70-74 23.73 27.205000000000002 27.650000000000002 21.415 75-79 23.169999999999998 27.860000000000003 26.99 21.98 80-84 23.21 27.765 27.834999999999997 21.19 85-89 23.575 27.815 27.839999999999996 20.77 90-94 23.25 28.155 27.215 21.38 95-99 23.585 27.994999999999997 26.96 21.46 100-104 23.11 28.02 27.089999999999996 21.78 105-109 23.485 27.915 27.935 20.665 110-114 24.185000000000002 27.465 27.42 20.93 115-119 23.415 28.044999999999998 26.919999999999998 21.62 120-124 24.425 28.189999999999998 26.87 20.515 125-129 24.169999999999998 27.705000000000002 27.18 20.945 130-134 24.115000000000002 27.894999999999996 27.384999999999998 20.605 135-139 23.82 27.655 27.41 21.115000000000002 140-144 24.169999999999998 27.96 26.900000000000002 20.97 145-149 24.169999999999998 27.634999999999998 27.125 21.07 150-151 24.3625 27.237499999999997 27.800000000000004 20.599999999999998 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 1.0 14 0.5 15 0.5 16 0.5 17 0.0 18 0.5 19 2.0 20 2.5 21 3.5 22 4.0 23 4.0 24 3.0 25 4.0 26 6.0 27 8.0 28 11.5 29 11.5 30 12.0 31 16.0 32 20.5 33 33.5 34 45.5 35 50.0 36 67.0 37 94.5 38 139.0 39 170.0 40 171.5 41 210.0 42 244.0 43 248.0 44 274.5 45 278.5 46 268.5 47 250.0 48 235.5 49 214.5 50 170.0 51 152.5 52 125.5 53 89.5 54 85.0 55 69.0 56 45.0 57 35.5 58 26.5 59 23.0 60 16.5 61 12.5 62 8.5 63 4.0 64 4.0 65 2.5 66 0.5 67 2.0 68 2.5 69 1.0 70 0.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.5 81 0.5 82 0.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.5 88 1.0 89 1.0 90 0.5 91 0.0 92 0.5 93 0.5 94 0.5 95 0.5 96 0.5 97 0.5 98 0.5 99 0.5 100 3.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 84.8 #Duplication Level Percentage of deduplicated Percentage of total 1 86.20283018867924 73.1 2 10.731132075471699 18.2 3 2.329009433962264 5.925 4 0.5601415094339622 1.9 5 0.1179245283018868 0.5 6 0.0294811320754717 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0294811320754717 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 9 0.22499999999999998 No Hit AGTGGGCATTGGCCAAGAAGCAGGAGCTTGCTGCTACTAAGAAAAAGAAT 6 0.15 No Hit AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 5 0.125 No Hit GTCAACTATTTAATTGCTTTTGTGTTGCGCATCTCACAACAGAGAAGCAA 5 0.125 No Hit GCTTGATATCCTCAAATTCGCAATCCGCTACATTTTGAGTGGGAAGGCTT 5 0.125 No Hit GTATCACTGACCCAATGGATTTAGAATTCTTGCACACACTTGATGTTCAG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0125 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.21250000000000002 0.0 0.0 0.0 0.0 90-91 0.3375 0.0 0.0 0.0 0.0 92-93 0.4625 0.0 0.0 0.0 0.0 94-95 0.5125 0.0 0.0 0.0 0.0 96-97 0.5874999999999999 0.0 0.0 0.0 0.0 98-99 0.65 0.0 0.0 0.0 0.0 100-101 0.7124999999999999 0.0 0.0 0.0 0.0 102-103 0.75 0.0 0.0 0.0 0.0 104-105 0.8 0.0 0.0 0.0 0.0 106-107 0.95 0.0 0.0 0.0 0.0 108-109 1.2 0.0 0.0 0.0 0.0 110-111 1.3875 0.0 0.0 0.0 0.0 112-113 1.475 0.0 0.0 0.0 0.0 114-115 1.6749999999999998 0.0 0.0 0.0 0.0 116-117 1.925 0.0 0.0 0.0 0.0 118-119 2.0875000000000004 0.0 0.0 0.0 0.0 120-121 2.2750000000000004 0.0 0.0 0.0 0.0 122-123 2.5 0.0 0.0 0.0 0.0 124-125 2.8 0.0 0.0 0.0 0.0 126-127 3.0 0.0 0.0 0.0 0.0 128-129 3.275 0.0 0.0 0.0 0.0 130-131 3.55 0.0 0.0 0.0 0.0 132-133 4.0625 0.0 0.0 0.0 0.0 134-135 4.3625 0.0 0.0 0.0 0.0 136-137 4.625 0.0 0.0 0.0 0.0 138-139 4.862500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAGTGCA 10 0.006830828 145.0 7 TTGAGTG 10 0.006830828 145.0 5 >>END_MODULE Read 1063799 spots for SRR12671351.sra Written 1063799 spots for SRR12671351.sra Read 1063799 spots for SRR12671351.sra Written 1063799 spots for SRR12671351.sra Read 1063799 spots for SRR12671351.sra Written 1063799 spots for SRR12671351.sra Read 1063799 spots for SRR12671351.sra Written 1063799 spots for SRR12671351.sra Read 1063799 spots for SRR12671351.sra Written 1063799 spots for SRR12671351.sra Read 1063799 spots for SRR12671351.sra Written 1063799 spots for SRR12671351.sra Read 1063799 spots for SRR12671351.sra Written 1063799 spots for SRR12671351.sra Read 1063799 spots for SRR12671351.sra Written 1063799 spots for SRR12671351.sra Read 1063799 spots for SRR12671351.sra Written 1063799 spots for SRR12671351.sra Read 1063799 spots for SRR12671351.sra Written 1063799 spots for SRR12671351.sra Read 1063799 spots for SRR12671351.sra Written 1063799 spots for SRR12671351.sra Read 1063799 spots for SRR12671351.sra Written 1063799 spots for SRR12671351.sra Read 1063799 spots for SRR12671351.sra Written 1063799 spots for SRR12671351.sra Read 1063799 spots for SRR12671351.sra Written 1063799 spots for SRR12671351.sra Read 1063799 spots for SRR12671351.sra Written 1063799 spots for SRR12671351.sra Read 1063799 spots for SRR12671351.sra Written 1063799 spots for SRR12671351.sra Read 1063799 spots for SRR12671351.sra Written 1063799 spots for SRR12671351.sra Read 1063799 spots for SRR12671351.sra Written 1063799 spots for SRR12671351.sra Read 1063799 spots for SRR12671351.sra Written 1063799 spots for SRR12671351.sra Read 1063799 spots for SRR12671351.sra Written 1063799 spots for SRR12671351.sra SRR ids: ['SRR12671351.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_0nkxditr SRR12671351.sra spots: 21275980 blocks: [[1, 1063799], [1063800, 2127598], [2127599, 3191397], [3191398, 4255196], [4255197, 5318995], [5318996, 6382794], [6382795, 7446593], [7446594, 8510392], [8510393, 9574191], [9574192, 10637990], [10637991, 11701789], [11701790, 12765588], [12765589, 13829387], [13829388, 14893186], [14893187, 15956985], [15956986, 17020784], [17020785, 18084583], [18084584, 19148382], [19148383, 20212181], [20212182, 21275980]] SRR12671351 file size 7208808 SRR12671351 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671351 SRR12671351_1.fastq SRR12671351_2.fastq Input file: SRR12671351_1.fastq Paired file: SRR12671351_2.fastq trimmed: SRR12671351-trimmed-pair1.fastq, SRR12671351-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 19:18:02 2025 >> started Tue Feb 11 19:18:25 2025 >> done (22.969s) 21275980 read pairs processed; of these: 100 ( 0.00%) short read pairs filtered out after trimming by size control 18585 ( 0.09%) empty read pairs filtered out after trimming by size control 21257295 (99.91%) read pairs available; of these: 1253317 ( 5.90%) trimmed read pairs available after processing 20003978 (94.10%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 9 0.00% 20 17 0.00% 21 11 0.00% 22 15 0.00% 23 23 0.00% 24 20 0.00% 25 28 0.00% 26 18 0.00% 27 37 0.00% 28 34 0.00% 29 36 0.00% 30 37 0.00% 31 30 0.00% 32 31 0.00% 33 34 0.00% 34 44 0.00% 35 28 0.00% 36 32 0.00% 37 23 0.00% 38 41 0.00% 39 47 0.00% 40 42 0.00% 41 34 0.00% 42 41 0.00% 43 47 0.00% 44 48 0.00% 45 49 0.00% 46 52 0.00% 47 61 0.00% 48 55 0.00% 49 76 0.00% 50 109 0.00% 51 124 0.00% 52 103 0.00% 53 138 0.00% 54 139 0.00% 55 138 0.00% 56 179 0.00% 57 201 0.00% 58 263 0.00% 59 267 0.00% 60 348 0.00% 61 375 0.00% 62 393 0.00% 63 482 0.00% 64 541 0.00% 65 584 0.00% 66 586 0.00% 67 708 0.00% 68 822 0.00% 69 973 0.00% 70 1065 0.01% 71 1178 0.01% 72 1344 0.01% 73 1537 0.01% 74 1723 0.01% 75 1986 0.01% 76 2039 0.01% 77 2197 0.01% 78 2426 0.01% 79 2680 0.01% 80 2943 0.01% 81 3280 0.02% 82 3590 0.02% 83 3908 0.02% 84 4397 0.02% 85 4687 0.02% 86 4805 0.02% 87 5195 0.02% 88 5566 0.03% 89 5720 0.03% 90 6001 0.03% 91 6507 0.03% 92 6749 0.03% 93 7320 0.03% 94 7895 0.04% 95 8269 0.04% 96 8547 0.04% 97 8848 0.04% 98 8936 0.04% 99 9430 0.04% 100 9769 0.05% 101 9696 0.05% 102 10629 0.05% 103 10849 0.05% 104 11616 0.05% 105 11761 0.06% 106 12291 0.06% 107 12865 0.06% 108 12996 0.06% 109 13607 0.06% 110 13789 0.06% 111 14071 0.07% 112 14617 0.07% 113 15166 0.07% 114 15697 0.07% 115 15941 0.07% 116 16751 0.08% 117 17102 0.08% 118 17788 0.08% 119 18125 0.09% 120 18635 0.09% 121 19049 0.09% 122 19247 0.09% 123 19990 0.09% 124 20505 0.10% 125 20754 0.10% 126 21558 0.10% 127 22088 0.10% 128 22987 0.11% 129 23401 0.11% 130 23607 0.11% 131 24142 0.11% 132 24452 0.12% 133 24911 0.12% 134 25646 0.12% 135 26592 0.13% 136 26933 0.13% 137 27603 0.13% 138 28289 0.13% 139 29080 0.14% 140 29553 0.14% 141 30198 0.14% 142 30593 0.14% 143 30876 0.15% 144 32120 0.15% 145 32239 0.15% 146 33233 0.16% 147 33693 0.16% 148 35055 0.16% 149 35177 0.17% 150 36636 0.17% 151 20003978 94.10% 21257295 reads passed initial QC criterion=sequence-density sequence-density=0.57 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=20 prefix-density=0.57 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=25 fanout-score=332.80 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=13.5 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTG criterion=sequence-density sequence-density=0.57 sequence-density-rank=1 fanout-score=2.04 fanout-score-rank=24 prefix-density=0.57 prefix-fanout=2.0 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.27 sequence-density-rank=15 fanout-score=9.56 fanout-score-rank=1 prefix-density=0.48 prefix-fanout=5.4 sequence=AAGAAAGCTTACCCTAAC SRR12671351 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 19:19:11 Started mapping on | Feb 11 19:19:11 Finished on | Feb 11 19:21:30 Mapping speed, Million of reads per hour | 550.55 Number of input reads | 21257295 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 19639812 Uniquely mapped reads % | 92.39% Average mapped length | 297.35 Number of splices: Total | 19208677 Number of splices: Annotated (sjdb) | 18827343 Number of splices: GT/AG | 18839059 Number of splices: GC/AG | 306174 Number of splices: AT/AC | 11162 Number of splices: Non-canonical | 52282 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.88 Insertion rate per base | 0.03% Insertion average length | 2.20 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 514909 % of reads mapped to multiple loci | 2.42% Number of reads mapped to too many loci | 86080 % of reads mapped to too many loci | 0.40% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.62% % of reads unmapped: other | 0.16% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1102574 1102574 1102574 N_multimapping 514909 514909 514909 N_noFeature 661274 19273932 772215 N_ambiguous 392443 1771 136691 UnstrandedReadsAssigned:18586095 PositiveStrandReadsAssigned:364109 NegativeStrandReadsAssigned:18730906 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671351 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671351-trimmed-pair1.fastq SRR12671351-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,257,295 reads, 18,755,269 reads pseudoaligned [quant] estimated average fragment length: 283.426 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,145 rounds 52401 SRR12671351.ke.tsv 34699 SRR12671351.se.tsv 87100 total ==> SRR12671351.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1735.57 560 13.4811 Potri.005G024800.1.v4.1 1035 752.574 214 11.8808 Potri.004G059700.1.v4.1 961 678.709 0 0 Potri.007G009000.2.v4.1 1416 1133.57 0 0 Potri.003G141000.2.v4.1 2943 2660.57 830 13.0341 Potri.016G087400.1.v4.1 270 73.7585 1064 602.711 Potri.015G069301.1.v4.1 564 295.801 0 0 Potri.010G195200.1.v4.1 1773 1490.57 156 4.37271 Potri.012G127500.1.v4.1 977 694.658 150 9.02194 ==> SRR12671351.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 254 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 383 Potri.001G212900.v4.1 60 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 6 SRR12671351 completed mapping pipeline successfully