Starting /dee2/code/volunteer_pipeline.sh SRR12671352 current disk space = 3053387612160 free memory = 1512419720 SRR12671352 SRAfilesize fbe379a2ff119056218d1af742f05825 SRR12671352.sra SRR12671352.sra file validated SRR12671352 is paired end SRR12671352 is conventional basespace SRR12671352 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671352_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5975 37.0 37.0 37.0 37.0 37.0 2 36.484 37.0 37.0 37.0 37.0 37.0 3 36.473 37.0 37.0 37.0 37.0 37.0 4 36.5195 37.0 37.0 37.0 37.0 37.0 5 36.5645 37.0 37.0 37.0 37.0 37.0 6 36.649 37.0 37.0 37.0 37.0 37.0 7 36.5325 37.0 37.0 37.0 37.0 37.0 8 36.5715 37.0 37.0 37.0 37.0 37.0 9 36.5025 37.0 37.0 37.0 37.0 37.0 10-14 36.5773 37.0 37.0 37.0 37.0 37.0 15-19 36.5988 37.0 37.0 37.0 37.0 37.0 20-24 36.5869 37.0 37.0 37.0 37.0 37.0 25-29 36.5189 37.0 37.0 37.0 37.0 37.0 30-34 36.500099999999996 37.0 37.0 37.0 37.0 37.0 35-39 36.5077 37.0 37.0 37.0 37.0 37.0 40-44 36.520300000000006 37.0 37.0 37.0 37.0 37.0 45-49 36.448299999999996 37.0 37.0 37.0 37.0 37.0 50-54 36.440799999999996 37.0 37.0 37.0 37.0 37.0 55-59 36.4112 37.0 37.0 37.0 37.0 37.0 60-64 36.3891 37.0 37.0 37.0 37.0 37.0 65-69 36.331 37.0 37.0 37.0 37.0 37.0 70-74 36.3673 37.0 37.0 37.0 37.0 37.0 75-79 36.3316 37.0 37.0 37.0 37.0 37.0 80-84 36.3198 37.0 37.0 37.0 37.0 37.0 85-89 36.284800000000004 37.0 37.0 37.0 37.0 37.0 90-94 36.3349 37.0 37.0 37.0 37.0 37.0 95-99 36.2752 37.0 37.0 37.0 37.0 37.0 100-104 36.2318 37.0 37.0 37.0 37.0 37.0 105-109 36.2629 37.0 37.0 37.0 37.0 37.0 110-114 36.1362 37.0 37.0 37.0 37.0 37.0 115-119 36.1931 37.0 37.0 37.0 37.0 37.0 120-124 36.148 37.0 37.0 37.0 37.0 37.0 125-129 36.0659 37.0 37.0 37.0 37.0 37.0 130-134 35.88549999999999 37.0 37.0 37.0 37.0 37.0 135-139 35.7411 37.0 37.0 37.0 37.0 37.0 140-144 35.5398 37.0 37.0 37.0 37.0 37.0 145-149 35.4047 37.0 37.0 37.0 37.0 37.0 150-151 35.22925 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 2.0 23 0.0 24 2.0 25 1.0 26 1.0 27 11.0 28 7.0 29 18.0 30 28.0 31 30.0 32 40.0 33 87.0 34 152.0 35 289.0 36 2877.0 37 454.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.825 9.85 7.775 48.55 2 18.393393393393392 13.613613613613614 38.53853853853854 29.454454454454453 3 18.65 17.375 27.200000000000003 36.775000000000006 4 24.525 27.1 21.325 27.05 5 24.625 31.900000000000002 23.875 19.6 6 18.85 35.75 25.15 20.25 7 14.424999999999999 24.45 43.85 17.275 8 16.675 23.724999999999998 34.725 24.875 9 16.775000000000002 23.75 35.625 23.849999999999998 10-14 19.655 30.159999999999997 27.405 22.78 15-19 19.855 27.794999999999998 28.189999999999998 24.16 20-24 19.93 28.549999999999997 28.125 23.395 25-29 20.21 27.939999999999998 28.035 23.815 30-34 19.37 28.860000000000003 28.1 23.669999999999998 35-39 20.44 28.53 27.325 23.705000000000002 40-44 20.505000000000003 28.549999999999997 27.99 22.955000000000002 45-49 20.03 28.65 27.51 23.810000000000002 50-54 20.255000000000003 28.715000000000003 28.09 22.939999999999998 55-59 20.205000000000002 28.349999999999998 28.23 23.215 60-64 21.02 28.12 27.389999999999997 23.47 65-69 19.615 28.549999999999997 28.33 23.505000000000003 70-74 20.880000000000003 28.4 27.165 23.555 75-79 20.24 28.88 27.76 23.119999999999997 80-84 20.93 27.805000000000003 27.68 23.585 85-89 20.380000000000003 29.375 27.150000000000002 23.095 90-94 20.96 29.235 26.8 23.005 95-99 21.485000000000003 28.065 27.095000000000002 23.355 100-104 20.785 28.345 27.515 23.355 105-109 20.580000000000002 28.999999999999996 27.060000000000002 23.36 110-114 20.665 29.005 26.745 23.585 115-119 20.87 29.21 26.435 23.485 120-124 20.535 29.005 26.055 24.404999999999998 125-129 21.22 28.735 25.979999999999997 24.065 130-134 21.09 28.794999999999998 26.584999999999997 23.53 135-139 20.905 28.26 26.6 24.235 140-144 21.695 28.025 26.284999999999997 23.995 145-149 21.69 27.93 25.95 24.43 150-151 21.975 27.700000000000003 26.2875 24.0375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.5 21 0.5 22 1.5 23 2.5 24 3.0 25 4.0 26 5.5 27 9.0 28 13.0 29 14.0 30 18.0 31 30.5 32 39.5 33 48.5 34 54.5 35 74.5 36 99.0 37 110.0 38 129.5 39 154.0 40 190.0 41 220.0 42 229.0 43 231.0 44 246.0 45 263.5 46 268.0 47 264.0 48 228.0 49 197.5 50 172.0 51 127.5 52 106.5 53 96.0 54 78.0 55 66.0 56 56.0 57 43.0 58 28.0 59 22.0 60 17.5 61 11.5 62 8.5 63 4.5 64 3.0 65 1.5 66 1.5 67 1.0 68 1.5 69 1.0 70 0.0 71 0.0 72 0.0 73 1.0 74 1.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.5 98 0.5 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.1 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 84.89999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 85.6301531213192 72.7 2 11.66077738515901 19.8 3 2.1201413427561837 5.4 4 0.47114252061248524 1.6 5 0.11778563015312131 0.5 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGACCTTAACATAATGCCAGATGCAGAATGCAATGATAAATGATAAGTG 5 0.125 No Hit CTCCACTCTGTACTGACTTCAGCCGATTTAGGCTCCAATTCTTTAAGCTT 5 0.125 No Hit CTTTGTTGGAGGATAAATCATAGCCCTTGCTTTATTTAAGGATTCAGCAA 5 0.125 No Hit CCGCCACTTGATCAGTCAAAATATCCCCAAAGCCACCTGCTTTGAAGACT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0125 0.0 12-13 0.0 0.0 0.0 0.025 0.0 14-15 0.0 0.0 0.0 0.025 0.0 16-17 0.0 0.0 0.0 0.025 0.0 18-19 0.0 0.0 0.0 0.025 0.0 20-21 0.0 0.0 0.0 0.025 0.0 22-23 0.0 0.0 0.0 0.025 0.0 24-25 0.0 0.0 0.0 0.025 0.0 26-27 0.0 0.0 0.0 0.025 0.0 28-29 0.0 0.0 0.0 0.025 0.0 30-31 0.0 0.0 0.0 0.025 0.0 32-33 0.0 0.0 0.0 0.025 0.0 34-35 0.0 0.0 0.0 0.025 0.0 36-37 0.0 0.0 0.0 0.025 0.0 38-39 0.0 0.0 0.0 0.025 0.0 40-41 0.0 0.0 0.0 0.025 0.0 42-43 0.0 0.0 0.0 0.025 0.0 44-45 0.0 0.0 0.0 0.025 0.0 46-47 0.0 0.0 0.0 0.025 0.0 48-49 0.0 0.0 0.0 0.025 0.0 50-51 0.0 0.0 0.0 0.025 0.0 52-53 0.0 0.0 0.0 0.025 0.0 54-55 0.0 0.0 0.0 0.025 0.0 56-57 0.0 0.0 0.0 0.025 0.0 58-59 0.0 0.0 0.0 0.025 0.0 60-61 0.025 0.0 0.0 0.025 0.0 62-63 0.075 0.0 0.0 0.025 0.0 64-65 0.1 0.0 0.0 0.025 0.0 66-67 0.125 0.0 0.0 0.025 0.0 68-69 0.15 0.0 0.0 0.025 0.0 70-71 0.2 0.0 0.0 0.025 0.0 72-73 0.2625 0.0 0.0 0.025 0.0 74-75 0.3 0.0 0.0 0.025 0.0 76-77 0.4 0.0 0.0 0.025 0.0 78-79 0.55 0.0 0.0 0.025 0.0 80-81 0.825 0.0 0.0 0.025 0.0 82-83 0.9875 0.0 0.0 0.025 0.0 84-85 1.2625000000000002 0.0 0.0 0.025 0.0 86-87 1.6875 0.0 0.0 0.025 0.0 88-89 2.05 0.0 0.0 0.025 0.0 90-91 2.4749999999999996 0.0 0.0 0.025 0.0 92-93 2.775 0.0 0.0 0.025 0.0 94-95 3.0375 0.0 0.0 0.025 0.0 96-97 3.4875 0.0 0.0 0.025 0.0 98-99 3.9375 0.0 0.0 0.025 0.0 100-101 4.4375 0.0 0.0 0.025 0.0 102-103 5.125 0.0 0.0 0.025 0.0 104-105 5.525 0.0 0.0 0.025 0.0 106-107 6.2875 0.0 0.0 0.025 0.0 108-109 6.824999999999999 0.0 0.0 0.025 0.0 110-111 7.3125 0.0 0.0 0.025 0.0 112-113 7.9 0.0 0.0 0.025 0.0 114-115 8.4625 0.0 0.0 0.025 0.0 116-117 9.337499999999999 0.0 0.0 0.025 0.0 118-119 10.037500000000001 0.0 0.0 0.025 0.0 120-121 10.9875 0.0 0.0 0.025 0.0 122-123 11.75 0.0 0.0 0.025 0.0 124-125 12.55 0.0 0.0 0.025 0.0 126-127 13.1125 0.0 0.0 0.025 0.0 128-129 13.587499999999999 0.0 0.0 0.025 0.0 130-131 14.425 0.0 0.0 0.025 0.0 132-133 15.575 0.0 0.0 0.025 0.0 134-135 16.275 0.0 0.0 0.025 0.0 136-137 17.1125 0.0 0.0 0.025 0.0 138-139 17.637500000000003 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTCCTGT 10 0.006830828 145.0 1 >>END_MODULE SRR12671352 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671352_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.365 37.0 37.0 37.0 37.0 37.0 2 36.2185 37.0 37.0 37.0 37.0 37.0 3 36.394 37.0 37.0 37.0 37.0 37.0 4 36.298 37.0 37.0 37.0 37.0 37.0 5 36.3405 37.0 37.0 37.0 37.0 37.0 6 36.282 37.0 37.0 37.0 37.0 37.0 7 36.312 37.0 37.0 37.0 37.0 37.0 8 36.4125 37.0 37.0 37.0 37.0 37.0 9 36.4475 37.0 37.0 37.0 37.0 37.0 10-14 36.373000000000005 37.0 37.0 37.0 37.0 37.0 15-19 36.3607 37.0 37.0 37.0 37.0 37.0 20-24 36.280199999999994 37.0 37.0 37.0 37.0 37.0 25-29 36.237199999999994 37.0 37.0 37.0 37.0 37.0 30-34 36.2684 37.0 37.0 37.0 37.0 37.0 35-39 36.2573 37.0 37.0 37.0 37.0 37.0 40-44 36.1919 37.0 37.0 37.0 37.0 37.0 45-49 36.195299999999996 37.0 37.0 37.0 37.0 37.0 50-54 36.1691 37.0 37.0 37.0 37.0 37.0 55-59 36.144099999999995 37.0 37.0 37.0 37.0 37.0 60-64 36.1693 37.0 37.0 37.0 37.0 37.0 65-69 36.1222 37.0 37.0 37.0 37.0 37.0 70-74 36.127 37.0 37.0 37.0 37.0 37.0 75-79 36.0506 37.0 37.0 37.0 37.0 37.0 80-84 36.0138 37.0 37.0 37.0 37.0 37.0 85-89 36.0812 37.0 37.0 37.0 37.0 37.0 90-94 36.0741 37.0 37.0 37.0 37.0 37.0 95-99 35.9902 37.0 37.0 37.0 37.0 37.0 100-104 35.93920000000001 37.0 37.0 37.0 37.0 37.0 105-109 35.8345 37.0 37.0 37.0 37.0 37.0 110-114 35.775 37.0 37.0 37.0 37.0 37.0 115-119 35.7773 37.0 37.0 37.0 37.0 37.0 120-124 35.64 37.0 37.0 37.0 37.0 37.0 125-129 35.3806 37.0 37.0 37.0 37.0 37.0 130-134 35.1723 37.0 37.0 37.0 34.6 37.0 135-139 34.9976 37.0 37.0 37.0 25.0 37.0 140-144 34.875299999999996 37.0 37.0 37.0 25.0 37.0 145-149 34.6922 37.0 37.0 37.0 25.0 37.0 150-151 34.15875 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 1.0 15 2.0 16 0.0 17 1.0 18 1.0 19 1.0 20 1.0 21 2.0 22 2.0 23 6.0 24 3.0 25 10.0 26 9.0 27 8.0 28 17.0 29 21.0 30 26.0 31 38.0 32 68.0 33 132.0 34 228.0 35 528.0 36 2574.0 37 320.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.825 18.275 13.4 34.5 2 24.825 27.275 33.800000000000004 14.099999999999998 3 20.849999999999998 27.075 29.9 22.175 4 24.525 34.949999999999996 22.75 17.775 5 24.55 36.3 23.025000000000002 16.125 6 18.425 39.25 23.825 18.5 7 19.925 20.424999999999997 41.099999999999994 18.55 8 21.099999999999998 24.099999999999998 29.4 25.4 9 20.1 25.1 29.599999999999998 25.2 10-14 22.515 29.645 26.479999999999997 21.36 15-19 22.335 28.12 28.26 21.285 20-24 22.39 28.315 27.99 21.305 25-29 22.78 27.994999999999997 28.485 20.74 30-34 22.295 28.084999999999997 28.535 21.085 35-39 22.62 28.575 27.810000000000002 20.995 40-44 22.74 28.395 27.985 20.880000000000003 45-49 22.355 28.015 28.815 20.815 50-54 22.73 28.89 27.700000000000003 20.68 55-59 22.689999999999998 27.97 28.310000000000002 21.029999999999998 60-64 22.675 28.435 27.735 21.154999999999998 65-69 22.625 27.555000000000003 28.575 21.245 70-74 23.195 28.52 27.12 21.165 75-79 23.175 27.055 28.77 21.0 80-84 23.79 27.515 27.284999999999997 21.41 85-89 23.95 28.23 27.41 20.41 90-94 24.165 27.515 27.83 20.49 95-99 24.21 28.244999999999997 27.21 20.335 100-104 24.555 28.044999999999998 26.38 21.02 105-109 24.560000000000002 28.035 27.38 20.025000000000002 110-114 25.88 27.894999999999996 26.979999999999997 19.245 115-119 25.71 27.88 26.295 20.115 120-124 26.215 27.894999999999996 26.63 19.259999999999998 125-129 26.02 27.334999999999997 26.75 19.895 130-134 26.85 27.71 26.669999999999998 18.77 135-139 27.224999999999998 27.66 25.900000000000002 19.215 140-144 28.68 28.03 24.83 18.459999999999997 145-149 28.765 26.82 26.119999999999997 18.295 150-151 29.575000000000003 26.3625 26.674999999999997 17.3875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 1.0 8 1.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.5 15 0.5 16 0.0 17 0.0 18 0.5 19 2.0 20 1.5 21 1.5 22 2.5 23 4.0 24 4.5 25 8.0 26 8.5 27 4.0 28 7.0 29 12.0 30 20.0 31 29.5 32 31.5 33 42.5 34 56.0 35 67.5 36 89.0 37 115.0 38 144.5 39 170.5 40 206.5 41 228.5 42 234.5 43 251.0 44 253.0 45 264.0 46 267.5 47 244.5 48 217.5 49 189.5 50 176.5 51 139.0 52 105.5 53 95.0 54 71.5 55 53.5 56 44.0 57 29.5 58 16.0 59 16.5 60 15.5 61 13.0 62 13.5 63 7.5 64 3.5 65 4.5 66 2.0 67 0.0 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.5 78 1.0 79 0.5 80 0.0 81 0.0 82 0.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 1.5 89 1.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 84.65 #Duplication Level Percentage of deduplicated Percentage of total 1 85.58771411695216 72.45 2 11.51801535735381 19.5 3 2.215002953337271 5.625 4 0.531600708800945 1.7999999999999998 5 0.14766686355581807 0.625 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TTTGATTTCTCTGCTGTTGAGAAGATTTCGGTTGATGCTGTGAAACATAA 5 0.125 No Hit GGGGATGTTACTCAATTGGTTATTCAGTATCTGGATAAGTTGGGGAACGT 5 0.125 No Hit ATTTGGTTGACAAGGTTTTGGACAAAACTGGCATGAAGGGTACCGGTAAG 5 0.125 No Hit CACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTC 5 0.125 No Hit CATGAAGGAGGTTAGCCTTACTGGCAGAGTTGAACTTAAAGTGGCTCCAG 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.125 0.0 0.0 0.0 0.0 68-69 0.15 0.0 0.0 0.0 0.0 70-71 0.2 0.0 0.0 0.0 0.0 72-73 0.2625 0.0 0.0 0.0 0.0 74-75 0.3 0.0 0.0 0.0 0.0 76-77 0.4 0.0 0.0 0.0 0.0 78-79 0.55 0.0 0.0 0.0 0.0 80-81 0.825 0.0 0.0 0.0 0.0 82-83 0.9875 0.0 0.0 0.0 0.0 84-85 1.2625000000000002 0.0 0.0 0.0 0.0 86-87 1.7125 0.0 0.0 0.0 0.0 88-89 2.075 0.0 0.0 0.0 0.0 90-91 2.5 0.0 0.0 0.0 0.0 92-93 2.8 0.0 0.0 0.0 0.0 94-95 3.0625 0.0 0.0 0.0 0.0 96-97 3.5125 0.0 0.0 0.0 0.0 98-99 3.9625 0.0 0.0 0.0 0.0 100-101 4.4625 0.0 0.0 0.0 0.0 102-103 5.15 0.0 0.0 0.0 0.0 104-105 5.550000000000001 0.0 0.0 0.0 0.0 106-107 6.3125 0.0 0.0 0.0 0.0 108-109 6.85 0.0 0.0 0.0 0.0 110-111 7.362500000000001 0.0 0.0 0.0 0.0 112-113 7.95 0.0 0.0 0.0 0.0 114-115 8.5375 0.0 0.0 0.0 0.0 116-117 9.3875 0.0 0.0 0.0 0.0 118-119 10.087499999999999 0.0 0.0 0.0 0.0 120-121 11.0125 0.0 0.0 0.0 0.0 122-123 11.774999999999999 0.0 0.0 0.0 0.0 124-125 12.5625 0.0 0.0 0.0 0.0 126-127 13.1125 0.0 0.0 0.0 0.0 128-129 13.587499999999999 0.0 0.0 0.0 0.0 130-131 14.462499999999999 0.0 0.0 0.0 0.0 132-133 15.675 0.0 0.0 0.0 0.0 134-135 16.375 0.0 0.0 0.0 0.0 136-137 17.2125 0.0 0.0 0.0 0.0 138-139 17.737499999999997 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content fail #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGGGGGG 90 3.6379788E-12 32.22222 145 >>END_MODULE Read 759818 spots for SRR12671352.sra Written 759818 spots for SRR12671352.sra Read 759818 spots for SRR12671352.sra Written 759818 spots for SRR12671352.sra Read 759818 spots for SRR12671352.sra Written 759818 spots for SRR12671352.sra Read 759818 spots for SRR12671352.sra Written 759818 spots for SRR12671352.sra Read 759818 spots for SRR12671352.sra Written 759818 spots for SRR12671352.sra Read 759818 spots for SRR12671352.sra Written 759818 spots for SRR12671352.sra Read 759818 spots for SRR12671352.sra Written 759818 spots for SRR12671352.sra Read 759818 spots for SRR12671352.sra Written 759818 spots for SRR12671352.sra Read 759818 spots for SRR12671352.sra Written 759818 spots for SRR12671352.sra Read 759818 spots for SRR12671352.sra Written 759818 spots for SRR12671352.sra Read 759818 spots for SRR12671352.sra Written 759818 spots for SRR12671352.sra Read 759818 spots for SRR12671352.sra Written 759818 spots for SRR12671352.sra Read 759818 spots for SRR12671352.sra Written 759818 spots for SRR12671352.sra Read 759818 spots for SRR12671352.sra Written 759818 spots for SRR12671352.sra Read 759818 spots for SRR12671352.sra Written 759818 spots for SRR12671352.sra Read 759818 spots for SRR12671352.sra Written 759818 spots for SRR12671352.sra Read 759818 spots for SRR12671352.sra Written 759818 spots for SRR12671352.sra Read 759818 spots for SRR12671352.sra Written 759818 spots for SRR12671352.sra Read 759818 spots for SRR12671352.sra Written 759818 spots for SRR12671352.sra Read 759835 spots for SRR12671352.sra Written 759835 spots for SRR12671352.sra SRR ids: ['SRR12671352.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_mmmrl859 SRR12671352.sra spots: 15196377 blocks: [[1, 759818], [759819, 1519636], [1519637, 2279454], [2279455, 3039272], [3039273, 3799090], [3799091, 4558908], [4558909, 5318726], [5318727, 6078544], [6078545, 6838362], [6838363, 7598180], [7598181, 8357998], [8357999, 9117816], [9117817, 9877634], [9877635, 10637452], [10637453, 11397270], [11397271, 12157088], [12157089, 12916906], [12916907, 13676724], [13676725, 14436542], [14436543, 15196377]] SRR12671352 file size 5142693 SRR12671352 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671352 SRR12671352_1.fastq SRR12671352_2.fastq Input file: SRR12671352_1.fastq Paired file: SRR12671352_2.fastq trimmed: SRR12671352-trimmed-pair1.fastq, SRR12671352-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 18:53:05 2025 >> started Tue Feb 11 18:53:26 2025 >> done (20.852s) 15196377 read pairs processed; of these: 40 ( 0.00%) short read pairs filtered out after trimming by size control 5914 ( 0.04%) empty read pairs filtered out after trimming by size control 15190423 (99.96%) read pairs available; of these: 3217510 (21.18%) trimmed read pairs available after processing 11972913 (78.82%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 3 0.00% 20 2 0.00% 21 3 0.00% 22 1 0.00% 23 6 0.00% 24 8 0.00% 25 5 0.00% 26 10 0.00% 27 10 0.00% 28 11 0.00% 29 10 0.00% 30 11 0.00% 31 13 0.00% 32 11 0.00% 33 6 0.00% 34 21 0.00% 35 18 0.00% 36 33 0.00% 37 31 0.00% 38 19 0.00% 39 33 0.00% 40 47 0.00% 41 45 0.00% 42 58 0.00% 43 60 0.00% 44 68 0.00% 45 75 0.00% 46 109 0.00% 47 110 0.00% 48 153 0.00% 49 214 0.00% 50 195 0.00% 51 233 0.00% 52 298 0.00% 53 334 0.00% 54 372 0.00% 55 412 0.00% 56 471 0.00% 57 632 0.00% 58 696 0.00% 59 819 0.01% 60 992 0.01% 61 1179 0.01% 62 1381 0.01% 63 1497 0.01% 64 1694 0.01% 65 1919 0.01% 66 2126 0.01% 67 2378 0.02% 68 2798 0.02% 69 3221 0.02% 70 3736 0.02% 71 4202 0.03% 72 4839 0.03% 73 5570 0.04% 74 6108 0.04% 75 6658 0.04% 76 7641 0.05% 77 8224 0.05% 78 9194 0.06% 79 10160 0.07% 80 11091 0.07% 81 12252 0.08% 82 13650 0.09% 83 14645 0.10% 84 16280 0.11% 85 17439 0.11% 86 18956 0.12% 87 19702 0.13% 88 21185 0.14% 89 22182 0.15% 90 23257 0.15% 91 25053 0.16% 92 25846 0.17% 93 27492 0.18% 94 29429 0.19% 95 30992 0.20% 96 31822 0.21% 97 33339 0.22% 98 34010 0.22% 99 34864 0.23% 100 36267 0.24% 101 37207 0.24% 102 38165 0.25% 103 39321 0.26% 104 40302 0.27% 105 41037 0.27% 106 42776 0.28% 107 43809 0.29% 108 44657 0.29% 109 45835 0.30% 110 45501 0.30% 111 46546 0.31% 112 46729 0.31% 113 47600 0.31% 114 48221 0.32% 115 49605 0.33% 116 50276 0.33% 117 51088 0.34% 118 52233 0.34% 119 52187 0.34% 120 52871 0.35% 121 53151 0.35% 122 53589 0.35% 123 54157 0.36% 124 54813 0.36% 125 54633 0.36% 126 55606 0.37% 127 55540 0.37% 128 55907 0.37% 129 56565 0.37% 130 56811 0.37% 131 57106 0.38% 132 56425 0.37% 133 57378 0.38% 134 56894 0.37% 135 57097 0.38% 136 57443 0.38% 137 57245 0.38% 138 58113 0.38% 139 58995 0.39% 140 58755 0.39% 141 58049 0.38% 142 58686 0.39% 143 58043 0.38% 144 58551 0.39% 145 58248 0.38% 146 58468 0.38% 147 58464 0.38% 148 59141 0.39% 149 57975 0.38% 150 58756 0.39% 151 11972913 78.82% 15190423 reads passed initial QC criterion=sequence-density sequence-density=0.34 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=28 prefix-density=0.34 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.02 sequence-density-rank=31 fanout-score=221.74 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=15.4 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGC criterion=sequence-density sequence-density=0.63 sequence-density-rank=1 fanout-score=2.59 fanout-score-rank=16 prefix-density=0.75 prefix-fanout=2.2 sequence=GCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTCTTCA criterion=fanout-score sequence-density=0.09 sequence-density-rank=30 fanout-score=25.80 fanout-score-rank=1 prefix-density=0.28 prefix-fanout=8.8 sequence=AAGGCCAAGATCCAGGACAAGGA SRR12671352 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 19:15:07 Started mapping on | Feb 11 19:15:07 Finished on | Feb 11 19:16:54 Mapping speed, Million of reads per hour | 511.08 Number of input reads | 15190423 Average input read length | 288 UNIQUE READS: Uniquely mapped reads number | 14099639 Uniquely mapped reads % | 92.82% Average mapped length | 287.38 Number of splices: Total | 13304399 Number of splices: Annotated (sjdb) | 13017223 Number of splices: GT/AG | 13038764 Number of splices: GC/AG | 215468 Number of splices: AT/AC | 8461 Number of splices: Non-canonical | 41706 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.90 Insertion rate per base | 0.03% Insertion average length | 2.22 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 393192 % of reads mapped to multiple loci | 2.59% Number of reads mapped to too many loci | 142595 % of reads mapped to too many loci | 0.94% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.45% % of reads unmapped: other | 0.20% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 697592 697592 697592 N_multimapping 393192 393192 393192 N_noFeature 591340 13877494 691903 N_ambiguous 218835 948 96613 UnstrandedReadsAssigned:13289464 PositiveStrandReadsAssigned:221197 NegativeStrandReadsAssigned:13311123 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR12671352 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671352-trimmed-pair1.fastq SRR12671352-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,190,423 reads, 13,393,239 reads pseudoaligned [quant] estimated average fragment length: 236.172 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,021 rounds 52401 SRR12671352.ke.tsv 34699 SRR12671352.se.tsv 87100 total ==> SRR12671352.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1782.83 893 39.2423 Potri.005G024800.1.v4.1 1035 799.828 384 37.6138 Potri.004G059700.1.v4.1 961 726.037 1 0.107908 Potri.007G009000.2.v4.1 1416 1180.83 0 0 Potri.003G141000.2.v4.1 2943 2707.83 927.497 26.8351 Potri.016G087400.1.v4.1 270 105.714 963 713.686 Potri.015G069301.1.v4.1 564 345.112 0 0 Potri.010G195200.1.v4.1 1773 1537.83 429 21.8555 Potri.012G127500.1.v4.1 977 741.934 71 7.49731 ==> SRR12671352.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 70 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 197 Potri.001G212900.v4.1 5 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 4 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 5 SRR12671352 completed mapping pipeline successfully