Starting /dee2/code/volunteer_pipeline.sh SRR12671353 current disk space = 3053405310976 free memory = 1470825364 SRR12671353 SRAfilesize dd618641d214280022217a47366a02f2 SRR12671353.sra SRR12671353.sra file validated SRR12671353 is paired end SRR12671353 is conventional basespace SRR12671353 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671353_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.619 37.0 37.0 37.0 37.0 37.0 2 36.336 37.0 37.0 37.0 37.0 37.0 3 36.561 37.0 37.0 37.0 37.0 37.0 4 36.6615 37.0 37.0 37.0 37.0 37.0 5 36.668 37.0 37.0 37.0 37.0 37.0 6 36.6085 37.0 37.0 37.0 37.0 37.0 7 36.5515 37.0 37.0 37.0 37.0 37.0 8 36.6845 37.0 37.0 37.0 37.0 37.0 9 36.66 37.0 37.0 37.0 37.0 37.0 10-14 36.6796 37.0 37.0 37.0 37.0 37.0 15-19 36.6322 37.0 37.0 37.0 37.0 37.0 20-24 36.611 37.0 37.0 37.0 37.0 37.0 25-29 36.6065 37.0 37.0 37.0 37.0 37.0 30-34 36.606700000000004 37.0 37.0 37.0 37.0 37.0 35-39 36.5504 37.0 37.0 37.0 37.0 37.0 40-44 36.537 37.0 37.0 37.0 37.0 37.0 45-49 36.5176 37.0 37.0 37.0 37.0 37.0 50-54 36.4392 37.0 37.0 37.0 37.0 37.0 55-59 36.4576 37.0 37.0 37.0 37.0 37.0 60-64 36.4598 37.0 37.0 37.0 37.0 37.0 65-69 36.4149 37.0 37.0 37.0 37.0 37.0 70-74 36.477700000000006 37.0 37.0 37.0 37.0 37.0 75-79 36.41029999999999 37.0 37.0 37.0 37.0 37.0 80-84 36.368700000000004 37.0 37.0 37.0 37.0 37.0 85-89 36.3098 37.0 37.0 37.0 37.0 37.0 90-94 36.2644 37.0 37.0 37.0 37.0 37.0 95-99 36.2861 37.0 37.0 37.0 37.0 37.0 100-104 36.2555 37.0 37.0 37.0 37.0 37.0 105-109 36.278 37.0 37.0 37.0 37.0 37.0 110-114 36.2293 37.0 37.0 37.0 37.0 37.0 115-119 36.2162 37.0 37.0 37.0 37.0 37.0 120-124 36.1729 37.0 37.0 37.0 37.0 37.0 125-129 36.1948 37.0 37.0 37.0 37.0 37.0 130-134 36.1532 37.0 37.0 37.0 37.0 37.0 135-139 36.165499999999994 37.0 37.0 37.0 37.0 37.0 140-144 36.08919999999999 37.0 37.0 37.0 37.0 37.0 145-149 36.03920000000001 37.0 37.0 37.0 37.0 37.0 150-151 35.883250000000004 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 3.0 24 1.0 25 4.0 26 3.0 27 2.0 28 6.0 29 20.0 30 5.0 31 38.0 32 34.0 33 52.0 34 94.0 35 259.0 36 3013.0 37 465.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 50.475 11.35 4.7 33.475 2 20.100502512562816 13.115577889447236 36.70854271356784 30.075376884422113 3 18.2 17.025000000000002 29.7 35.075 4 22.875 24.15 24.625 28.349999999999998 5 23.325000000000003 30.75 25.15 20.775 6 19.125 34.699999999999996 24.625 21.55 7 15.1 24.525 45.074999999999996 15.299999999999999 8 16.0 25.0 34.699999999999996 24.3 9 18.075 21.125 34.9 25.900000000000002 10-14 19.259999999999998 30.659999999999997 27.310000000000002 22.770000000000003 15-19 19.835 27.92 27.744999999999997 24.5 20-24 19.759999999999998 28.29 28.315 23.635 25-29 20.119999999999997 28.749999999999996 27.500000000000004 23.630000000000003 30-34 20.169999999999998 28.13 27.68 24.02 35-39 20.03 28.610000000000003 27.76 23.599999999999998 40-44 19.895 28.37 27.98 23.755000000000003 45-49 20.580000000000002 28.505000000000003 27.334999999999997 23.580000000000002 50-54 20.195 27.705000000000002 28.000000000000004 24.099999999999998 55-59 20.169999999999998 28.084999999999997 27.735 24.01 60-64 20.0 27.985 27.965 24.05 65-69 20.669999999999998 28.804999999999996 27.345000000000002 23.18 70-74 19.650000000000002 28.715000000000003 27.775 23.86 75-79 20.3 28.22 27.665 23.815 80-84 20.395 28.854999999999997 27.255000000000003 23.494999999999997 85-89 20.05 28.655 27.589999999999996 23.705000000000002 90-94 19.965 28.955 27.395000000000003 23.685000000000002 95-99 20.305 28.38 27.93 23.385 100-104 20.155 28.860000000000003 28.215 22.770000000000003 105-109 20.52 28.815 27.200000000000003 23.465 110-114 20.544999999999998 28.215 27.43 23.810000000000002 115-119 20.724999999999998 28.389999999999997 27.87 23.015 120-124 20.77 28.294999999999998 27.450000000000003 23.485 125-129 20.419999999999998 28.48 27.42 23.68 130-134 20.565 27.694999999999997 27.83 23.91 135-139 20.65 28.655 26.86 23.835 140-144 20.84 28.610000000000003 26.540000000000003 24.01 145-149 21.04 28.505000000000003 26.795 23.66 150-151 20.9125 27.85 27.6 23.6375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 1.0 4 1.5 5 1.0 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.5 15 1.0 16 0.0 17 0.0 18 0.0 19 1.0 20 1.5 21 0.5 22 1.5 23 3.0 24 2.0 25 2.5 26 5.5 27 5.5 28 7.5 29 14.0 30 16.0 31 17.5 32 33.0 33 42.0 34 53.5 35 73.0 36 81.0 37 98.5 38 133.5 39 168.5 40 177.0 41 208.5 42 227.5 43 230.5 44 287.0 45 293.5 46 286.0 47 260.0 48 209.5 49 207.0 50 178.0 51 131.5 52 109.0 53 100.0 54 86.5 55 65.5 56 49.5 57 39.0 58 23.5 59 15.5 60 14.0 61 9.5 62 9.5 63 5.5 64 1.0 65 2.5 66 2.5 67 1.0 68 0.5 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 84.82499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 85.52903035661656 72.55 2 11.671087533156498 19.8 3 2.3872679045092835 6.075 4 0.20630710285882697 0.7000000000000001 5 0.20630710285882697 0.8750000000000001 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTTCAATCATAAGTGTTCCAGGAACTGGCCATGACATTGTAGGTGCATGA 5 0.125 No Hit CAGGTTTCGAAGCGACAGGGATTTTTAGAGCGAGATTTCCTACAGTTATG 5 0.125 No Hit CCCAGGTAGAAGATGTATCAGGGCACTAACAAGTTTGTCAACAGAACTAA 5 0.125 No Hit CTAAACTAATCACTCTGGTACCTTAAAGTGATCGATTTGGATGTTTTCCA 5 0.125 No Hit GGAAGAACTGCTGCCTGATCGATGGAGTTTCTCAAAGAGAGTAGGTTTCT 5 0.125 No Hit CCAGAGGCCACAGACATGGCCAATACATAACAATGAAGAAGACACAAAGA 5 0.125 No Hit GGCCAATACATAACAATGAAGAAGACACAAAGATAAAGACACTCACGGAC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.21250000000000002 0.0 0.0 0.0 0.0 94-95 0.25 0.0 0.0 0.0 0.0 96-97 0.275 0.0 0.0 0.0 0.0 98-99 0.325 0.0 0.0 0.0 0.0 100-101 0.375 0.0 0.0 0.0 0.0 102-103 0.475 0.0 0.0 0.0 0.0 104-105 0.6375 0.0 0.0 0.0 0.0 106-107 0.825 0.0 0.0 0.0 0.0 108-109 0.875 0.0 0.0 0.0 0.0 110-111 0.95 0.0 0.0 0.0 0.0 112-113 1.1749999999999998 0.0 0.0 0.0 0.0 114-115 1.2625 0.0 0.0 0.0 0.0 116-117 1.375 0.0 0.0 0.0 0.0 118-119 1.6125 0.0 0.0 0.0 0.0 120-121 1.7625 0.0 0.0 0.0 0.0 122-123 1.9375 0.0 0.0 0.0 0.0 124-125 2.1125 0.0 0.0 0.0 0.0 126-127 2.2625 0.0 0.0 0.0 0.0 128-129 2.5375 0.0 0.0 0.0 0.0 130-131 2.825 0.0 0.0 0.0 0.0 132-133 3.1375 0.0 0.0 0.0 0.0 134-135 3.35 0.0 0.0 0.0 0.0 136-137 3.5999999999999996 0.0 0.0 0.0 0.0 138-139 3.7875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12671353 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671353_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.438 37.0 37.0 37.0 37.0 37.0 2 36.0685 37.0 37.0 37.0 37.0 37.0 3 36.2955 37.0 37.0 37.0 37.0 37.0 4 36.373 37.0 37.0 37.0 37.0 37.0 5 36.3295 37.0 37.0 37.0 37.0 37.0 6 36.316 37.0 37.0 37.0 37.0 37.0 7 36.216 37.0 37.0 37.0 37.0 37.0 8 36.341 37.0 37.0 37.0 37.0 37.0 9 36.3945 37.0 37.0 37.0 37.0 37.0 10-14 36.3721 37.0 37.0 37.0 37.0 37.0 15-19 36.339800000000004 37.0 37.0 37.0 37.0 37.0 20-24 36.2898 37.0 37.0 37.0 37.0 37.0 25-29 36.2832 37.0 37.0 37.0 37.0 37.0 30-34 36.24829999999999 37.0 37.0 37.0 37.0 37.0 35-39 36.16609999999999 37.0 37.0 37.0 37.0 37.0 40-44 36.204499999999996 37.0 37.0 37.0 37.0 37.0 45-49 36.1596 37.0 37.0 37.0 37.0 37.0 50-54 36.1809 37.0 37.0 37.0 37.0 37.0 55-59 36.138799999999996 37.0 37.0 37.0 37.0 37.0 60-64 36.11110000000001 37.0 37.0 37.0 37.0 37.0 65-69 36.0981 37.0 37.0 37.0 37.0 37.0 70-74 36.0938 37.0 37.0 37.0 37.0 37.0 75-79 36.0465 37.0 37.0 37.0 37.0 37.0 80-84 36.0453 37.0 37.0 37.0 37.0 37.0 85-89 36.1185 37.0 37.0 37.0 37.0 37.0 90-94 36.0474 37.0 37.0 37.0 37.0 37.0 95-99 35.9796 37.0 37.0 37.0 37.0 37.0 100-104 35.9645 37.0 37.0 37.0 37.0 37.0 105-109 35.89040000000001 37.0 37.0 37.0 37.0 37.0 110-114 35.8782 37.0 37.0 37.0 37.0 37.0 115-119 35.906499999999994 37.0 37.0 37.0 37.0 37.0 120-124 35.9043 37.0 37.0 37.0 37.0 37.0 125-129 35.9029 37.0 37.0 37.0 37.0 37.0 130-134 35.789 37.0 37.0 37.0 37.0 37.0 135-139 35.7098 37.0 37.0 37.0 37.0 37.0 140-144 35.77290000000001 37.0 37.0 37.0 37.0 37.0 145-149 35.7164 37.0 37.0 37.0 37.0 37.0 150-151 35.51925 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 1.0 14 1.0 15 2.0 16 0.0 17 1.0 18 0.0 19 2.0 20 2.0 21 5.0 22 4.0 23 7.0 24 11.0 25 8.0 26 7.0 27 6.0 28 9.0 29 15.0 30 18.0 31 23.0 32 43.0 33 63.0 34 163.0 35 441.0 36 2880.0 37 287.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.725 23.775 7.7 21.8 2 25.85 25.424999999999997 32.75 15.975 3 21.125 28.15 34.1 16.625 4 24.525 34.35 22.400000000000002 18.725 5 24.7 39.074999999999996 19.5 16.725 6 18.425 40.0 22.275 19.3 7 18.875 21.875 38.775 20.474999999999998 8 18.8 26.0 29.95 25.25 9 21.85 24.675 29.9 23.575 10-14 22.79 29.695 26.68 20.835 15-19 22.384999999999998 28.015 28.03 21.57 20-24 22.675 29.304999999999996 27.425 20.595 25-29 22.515 28.360000000000003 27.91 21.215 30-34 22.915 27.62 28.555000000000003 20.91 35-39 23.105 28.54 27.77 20.585 40-44 22.625 29.104999999999997 27.46 20.810000000000002 45-49 22.745 28.435 27.775 21.044999999999998 50-54 22.825 28.21 27.339999999999996 21.625 55-59 23.035 28.325 27.474999999999998 21.165 60-64 23.005 28.689999999999998 27.525 20.78 65-69 22.63 28.525 28.015 20.830000000000002 70-74 23.07 28.565 27.810000000000002 20.555 75-79 22.75 28.035 28.015 21.2 80-84 23.25 28.585 27.155 21.01 85-89 23.115 28.925 26.82 21.14 90-94 23.43 29.07 26.700000000000003 20.8 95-99 23.119999999999997 28.560000000000002 27.250000000000004 21.07 100-104 23.330000000000002 27.794999999999998 27.765 21.11 105-109 22.915 28.675 27.744999999999997 20.665 110-114 23.185 29.054999999999996 26.615 21.145 115-119 23.91 27.99 27.52 20.580000000000002 120-124 23.43 28.535 27.21 20.825 125-129 24.09 28.54 27.35 20.02 130-134 24.37 28.285 26.96 20.385 135-139 24.21 28.055000000000003 27.650000000000002 20.085 140-144 24.14 28.449999999999996 27.48 19.93 145-149 24.275 28.075 27.36 20.29 150-151 25.637500000000003 27.0625 27.3375 19.9625 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 1.0 5 1.0 6 1.0 7 0.5 8 0.5 9 0.5 10 0.0 11 0.0 12 0.5 13 1.0 14 1.0 15 0.5 16 1.5 17 2.0 18 2.5 19 3.0 20 1.0 21 0.0 22 1.5 23 3.5 24 3.0 25 3.0 26 3.5 27 7.0 28 10.5 29 13.0 30 20.5 31 21.5 32 32.0 33 53.5 34 63.5 35 75.5 36 87.0 37 111.0 38 128.5 39 141.5 40 183.5 41 227.0 42 254.0 43 270.5 44 286.5 45 275.5 46 246.5 47 243.0 48 224.0 49 191.5 50 171.0 51 137.0 52 102.5 53 76.0 54 68.5 55 65.5 56 44.0 57 33.5 58 28.5 59 17.5 60 14.5 61 14.0 62 12.5 63 6.0 64 1.5 65 1.0 66 0.0 67 0.0 68 0.0 69 0.5 70 2.0 71 1.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.5 99 0.5 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 84.95 #Duplication Level Percentage of deduplicated Percentage of total 1 85.87404355503237 72.95 2 11.212477928193055 19.05 3 2.5014714537963507 6.375 4 0.23543260741612712 0.8 5 0.11771630370806356 0.5 6 0.02942907592701589 0.15 7 0.02942907592701589 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACC 7 0.17500000000000002 No Hit AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 6 0.15 No Hit GTTTGTTCCTCTTCGGTGGATATACTATCGGTTCAAGAAATCGCATTATT 5 0.125 No Hit TCTCGATACCATTTTTCTTTTTCCCATCCCAATATGTTGATATTAAGCCA 5 0.125 No Hit GTGGTGCTGTTGAGACCAAGGATCGCGGGTTGTTTGATTTCCTGGGGAAG 5 0.125 No Hit GGGAGAGGGAGAGAGAGAGAGAGAGTCACTCCAATTGATAGATAGATAGC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.2625 0.0 0.0 0.0 0.0 94-95 0.3 0.0 0.0 0.0 0.0 96-97 0.32499999999999996 0.0 0.0 0.0 0.0 98-99 0.375 0.0 0.0 0.0 0.0 100-101 0.425 0.0 0.0 0.0 0.0 102-103 0.525 0.0 0.0 0.0 0.0 104-105 0.6875 0.0 0.0 0.0 0.0 106-107 0.875 0.0 0.0 0.0 0.0 108-109 0.925 0.0 0.0 0.0 0.0 110-111 1.0 0.0 0.0 0.0 0.0 112-113 1.225 0.0 0.0 0.0 0.0 114-115 1.3125 0.0 0.0 0.0 0.0 116-117 1.425 0.0 0.0 0.0 0.0 118-119 1.6625 0.0 0.0 0.0 0.0 120-121 1.8125 0.0 0.0 0.0 0.0 122-123 2.0 0.0 0.0 0.0 0.0 124-125 2.1875 0.0 0.0 0.0 0.0 126-127 2.3375 0.0 0.0 0.0 0.0 128-129 2.6125 0.0 0.0 0.0 0.0 130-131 2.9000000000000004 0.0 0.0 0.0 0.0 132-133 3.2375 0.0 0.0 0.0 0.0 134-135 3.45 0.0 0.0 0.0 0.0 136-137 3.7249999999999996 0.0 0.0 0.0 0.0 138-139 3.9375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACTTGCT 10 0.006830828 145.0 5 TACAATC 10 0.006830828 145.0 2 AAGAAGT 10 0.006830828 145.0 6 TTTTTTT 30 0.0014437955 24.166668 90-94 AAAAAAA 40 0.0076550315 18.125 125-129 >>END_MODULE Read 1303472 spots for SRR12671353.sra Written 1303472 spots for SRR12671353.sra Read 1303472 spots for SRR12671353.sra Written 1303472 spots for SRR12671353.sra Read 1303472 spots for SRR12671353.sra Written 1303472 spots for SRR12671353.sra Read 1303472 spots for SRR12671353.sra Written 1303472 spots for SRR12671353.sra Read 1303472 spots for SRR12671353.sra Written 1303472 spots for SRR12671353.sra Read 1303472 spots for SRR12671353.sra Written 1303472 spots for SRR12671353.sra Read 1303472 spots for SRR12671353.sra Written 1303472 spots for SRR12671353.sra Read 1303472 spots for SRR12671353.sra Written 1303472 spots for SRR12671353.sra Read 1303472 spots for SRR12671353.sra Written 1303472 spots for SRR12671353.sra Read 1303472 spots for SRR12671353.sra Written 1303472 spots for SRR12671353.sra Read 1303472 spots for SRR12671353.sra Written 1303472 spots for SRR12671353.sra Read 1303472 spots for SRR12671353.sra Written 1303472 spots for SRR12671353.sra Read 1303472 spots for SRR12671353.sra Written 1303472 spots for SRR12671353.sra Read 1303472 spots for SRR12671353.sra Written 1303472 spots for SRR12671353.sra Read 1303472 spots for SRR12671353.sra Written 1303472 spots for SRR12671353.sra Read 1303472 spots for SRR12671353.sra Written 1303472 spots for SRR12671353.sra Read 1303472 spots for SRR12671353.sra Written 1303472 spots for SRR12671353.sra Read 1303484 spots for SRR12671353.sra Written 1303484 spots for SRR12671353.sra Read 1303472 spots for SRR12671353.sra Written 1303472 spots for SRR12671353.sra Read 1303472 spots for SRR12671353.sra Written 1303472 spots for SRR12671353.sra SRR ids: ['SRR12671353.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_xedbingb SRR12671353.sra spots: 26069452 blocks: [[1, 1303472], [1303473, 2606944], [2606945, 3910416], [3910417, 5213888], [5213889, 6517360], [6517361, 7820832], [7820833, 9124304], [9124305, 10427776], [10427777, 11731248], [11731249, 13034720], [13034721, 14338192], [14338193, 15641664], [15641665, 16945136], [16945137, 18248608], [18248609, 19552080], [19552081, 20855552], [20855553, 22159024], [22159025, 23462496], [23462497, 24765968], [24765969, 26069452]] SRR12671353 file size 8837839 SRR12671353 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671353 SRR12671353_1.fastq SRR12671353_2.fastq Input file: SRR12671353_1.fastq Paired file: SRR12671353_2.fastq trimmed: SRR12671353-trimmed-pair1.fastq, SRR12671353-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 18:33:11 2025 >> started Tue Feb 11 18:33:40 2025 >> done (29.407s) 26069452 read pairs processed; of these: 207 ( 0.00%) short read pairs filtered out after trimming by size control 5929 ( 0.02%) empty read pairs filtered out after trimming by size control 26063316 (99.98%) read pairs available; of these: 1449725 ( 5.56%) trimmed read pairs available after processing 24613591 (94.44%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 14 0.00% 19 14 0.00% 20 18 0.00% 21 26 0.00% 22 17 0.00% 23 20 0.00% 24 18 0.00% 25 26 0.00% 26 38 0.00% 27 45 0.00% 28 35 0.00% 29 30 0.00% 30 31 0.00% 31 40 0.00% 32 35 0.00% 33 37 0.00% 34 43 0.00% 35 30 0.00% 36 47 0.00% 37 43 0.00% 38 41 0.00% 39 46 0.00% 40 56 0.00% 41 60 0.00% 42 75 0.00% 43 64 0.00% 44 49 0.00% 45 71 0.00% 46 66 0.00% 47 74 0.00% 48 61 0.00% 49 60 0.00% 50 88 0.00% 51 106 0.00% 52 120 0.00% 53 132 0.00% 54 135 0.00% 55 150 0.00% 56 147 0.00% 57 171 0.00% 58 199 0.00% 59 208 0.00% 60 282 0.00% 61 291 0.00% 62 306 0.00% 63 394 0.00% 64 389 0.00% 65 425 0.00% 66 477 0.00% 67 522 0.00% 68 584 0.00% 69 682 0.00% 70 773 0.00% 71 811 0.00% 72 939 0.00% 73 1174 0.00% 74 1199 0.00% 75 1349 0.01% 76 1494 0.01% 77 1673 0.01% 78 1756 0.01% 79 1987 0.01% 80 2232 0.01% 81 2613 0.01% 82 2818 0.01% 83 3078 0.01% 84 3494 0.01% 85 3868 0.01% 86 3980 0.02% 87 4530 0.02% 88 4664 0.02% 89 4857 0.02% 90 5309 0.02% 91 5690 0.02% 92 5977 0.02% 93 6704 0.03% 94 7424 0.03% 95 7772 0.03% 96 8477 0.03% 97 8740 0.03% 98 8978 0.03% 99 9547 0.04% 100 10075 0.04% 101 10301 0.04% 102 11145 0.04% 103 11240 0.04% 104 12178 0.05% 105 12850 0.05% 106 13623 0.05% 107 13667 0.05% 108 14544 0.06% 109 14907 0.06% 110 14980 0.06% 111 15912 0.06% 112 16563 0.06% 113 16723 0.06% 114 17474 0.07% 115 18105 0.07% 116 19024 0.07% 117 19918 0.08% 118 20096 0.08% 119 21129 0.08% 120 21664 0.08% 121 21975 0.08% 122 22717 0.09% 123 23124 0.09% 124 24263 0.09% 125 24111 0.09% 126 26088 0.10% 127 26722 0.10% 128 27117 0.10% 129 28369 0.11% 130 29269 0.11% 131 29072 0.11% 132 30017 0.12% 133 30667 0.12% 134 30368 0.12% 135 32395 0.12% 136 33039 0.13% 137 33829 0.13% 138 34999 0.13% 139 36581 0.14% 140 36537 0.14% 141 37513 0.14% 142 37725 0.14% 143 38458 0.15% 144 39571 0.15% 145 40032 0.15% 146 41641 0.16% 147 42871 0.16% 148 43995 0.17% 149 43527 0.17% 150 45970 0.18% 151 24613591 94.44% 26063316 reads passed initial QC criterion=sequence-density sequence-density=0.51 sequence-density-rank=1 fanout-score=1.96 fanout-score-rank=31 prefix-density=0.51 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=68.87 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=6.7 sequence=AAACAGAATATTTACTTTTAGCGCAAGTTTCAATTCATGAGCTCGTTACATCACAAGTTAACATTACAAGCCAATAGTCCCAGCACAGAAAAAACTCTTTTGTTGCTCACTTTCCGGGAACGAAGTTTGTGGCATATGCCCAGGCGTTGTTGTTTACTGGGTCAGAAAGGTGGTCAGCCAGGTTCTCCAGTGGTCCCTTTCCGGTCACAATGGCCTGGACAAAGAATCCGAACATTGAGAACATAGCCAA criterion=sequence-density sequence-density=0.73 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=33 prefix-density=0.74 prefix-fanout=2.0 sequence=AACCGCACCCCGGCACAGGCCAACATGGTTGCACCATTCAACGGCCTCAAGTCTACCTCAGCTTTCCCGGTCACCAGAAAGGC criterion=fanout-score sequence-density=0.14 sequence-density-rank=18 fanout-score=33.00 fanout-score-rank=1 prefix-density=0.39 prefix-fanout=12.0 sequence=AAAGAAAAGAAAA SRR12671353 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 18:34:29 Started mapping on | Feb 11 18:34:29 Finished on | Feb 11 18:37:31 Mapping speed, Million of reads per hour | 515.54 Number of input reads | 26063316 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 24193296 Uniquely mapped reads % | 92.83% Average mapped length | 297.81 Number of splices: Total | 24433138 Number of splices: Annotated (sjdb) | 23948439 Number of splices: GT/AG | 23961698 Number of splices: GC/AG | 388608 Number of splices: AT/AC | 14295 Number of splices: Non-canonical | 68537 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.87 Insertion rate per base | 0.02% Insertion average length | 2.25 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 562210 % of reads mapped to multiple loci | 2.16% Number of reads mapped to too many loci | 96429 % of reads mapped to too many loci | 0.37% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.52% % of reads unmapped: other | 0.13% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1307810 1307810 1307810 N_multimapping 562210 562210 562210 N_noFeature 881996 23817836 1012574 N_ambiguous 396255 1576 150590 UnstrandedReadsAssigned:22915045 PositiveStrandReadsAssigned:373884 NegativeStrandReadsAssigned:23030132 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671353 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671353-trimmed-pair1.fastq SRR12671353-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 26,063,316 reads, 22,863,533 reads pseudoaligned [quant] estimated average fragment length: 285.768 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,063 rounds 52401 SRR12671353.ke.tsv 34699 SRR12671353.se.tsv 87100 total ==> SRR12671353.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1733.23 819 18.4074 Potri.005G024800.1.v4.1 1035 750.232 214 11.1118 Potri.004G059700.1.v4.1 961 676.392 5 0.287963 Potri.007G009000.2.v4.1 1416 1131.23 0 0 Potri.003G141000.2.v4.1 2943 2658.23 1262.97 18.5082 Potri.016G087400.1.v4.1 270 73.7971 1083 571.681 Potri.015G069301.1.v4.1 564 295.561 0 0 Potri.010G195200.1.v4.1 1773 1488.23 100 2.61754 Potri.012G127500.1.v4.1 977 692.327 116 6.52696 ==> SRR12671353.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 221 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 281 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 19 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 16 SRR12671353 completed mapping pipeline successfully