Starting /dee2/code/volunteer_pipeline.sh SRR12671354 current disk space = 3053532221440 free memory = 1017826132 SRR12671354 SRAfilesize 23c19829df6bb75fd774ff16afc95306 SRR12671354.sra SRR12671354.sra file validated SRR12671354 is paired end SRR12671354 is conventional basespace SRR12671354 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671354_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.663 37.0 37.0 37.0 37.0 37.0 2 36.3395 37.0 37.0 37.0 37.0 37.0 3 36.6145 37.0 37.0 37.0 37.0 37.0 4 36.6485 37.0 37.0 37.0 37.0 37.0 5 36.6835 37.0 37.0 37.0 37.0 37.0 6 36.622 37.0 37.0 37.0 37.0 37.0 7 36.5575 37.0 37.0 37.0 37.0 37.0 8 36.656 37.0 37.0 37.0 37.0 37.0 9 36.6995 37.0 37.0 37.0 37.0 37.0 10-14 36.6203 37.0 37.0 37.0 37.0 37.0 15-19 36.564 37.0 37.0 37.0 37.0 37.0 20-24 36.5565 37.0 37.0 37.0 37.0 37.0 25-29 36.4913 37.0 37.0 37.0 37.0 37.0 30-34 36.4944 37.0 37.0 37.0 37.0 37.0 35-39 36.4408 37.0 37.0 37.0 37.0 37.0 40-44 36.444 37.0 37.0 37.0 37.0 37.0 45-49 36.4017 37.0 37.0 37.0 37.0 37.0 50-54 36.3707 37.0 37.0 37.0 37.0 37.0 55-59 36.337199999999996 37.0 37.0 37.0 37.0 37.0 60-64 36.3208 37.0 37.0 37.0 37.0 37.0 65-69 36.26370000000001 37.0 37.0 37.0 37.0 37.0 70-74 36.278999999999996 37.0 37.0 37.0 37.0 37.0 75-79 36.2841 37.0 37.0 37.0 37.0 37.0 80-84 36.2202 37.0 37.0 37.0 37.0 37.0 85-89 36.2221 37.0 37.0 37.0 37.0 37.0 90-94 36.21659999999999 37.0 37.0 37.0 37.0 37.0 95-99 36.1843 37.0 37.0 37.0 37.0 37.0 100-104 36.1173 37.0 37.0 37.0 37.0 37.0 105-109 36.1668 37.0 37.0 37.0 37.0 37.0 110-114 36.021100000000004 37.0 37.0 37.0 37.0 37.0 115-119 36.05890000000001 37.0 37.0 37.0 37.0 37.0 120-124 35.9177 37.0 37.0 37.0 37.0 37.0 125-129 35.9701 37.0 37.0 37.0 37.0 37.0 130-134 35.8985 37.0 37.0 37.0 37.0 37.0 135-139 35.8343 37.0 37.0 37.0 37.0 37.0 140-144 35.764599999999994 37.0 37.0 37.0 37.0 37.0 145-149 35.7285 37.0 37.0 37.0 37.0 37.0 150-151 35.66375 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 1.0 18 0.0 19 2.0 20 1.0 21 2.0 22 5.0 23 6.0 24 5.0 25 2.0 26 2.0 27 2.0 28 13.0 29 18.0 30 20.0 31 44.0 32 54.0 33 83.0 34 100.0 35 265.0 36 2911.0 37 464.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.9 12.025 4.625 36.449999999999996 2 20.310932798395186 11.484453360080241 39.69408224674022 28.510531594784354 3 16.475 20.5 29.925 33.1 4 22.5 25.55 24.8 27.150000000000002 5 23.849999999999998 33.5 24.125 18.525 6 17.849999999999998 35.65 23.7 22.8 7 14.399999999999999 27.325 42.775 15.5 8 15.675 24.775 35.15 24.4 9 16.650000000000002 20.7 38.275 24.375 10-14 19.175 30.354999999999997 28.07 22.400000000000002 15-19 19.975 28.1 27.939999999999998 23.985 20-24 19.835 28.42 28.315 23.43 25-29 20.075000000000003 28.505000000000003 27.52 23.9 30-34 19.185 28.365000000000002 28.865000000000002 23.585 35-39 20.29 28.335 27.685 23.69 40-44 20.035 28.985 27.150000000000002 23.830000000000002 45-49 20.225 29.049999999999997 27.485 23.24 50-54 19.42 29.42 27.644999999999996 23.515 55-59 20.36 28.799999999999997 27.13 23.71 60-64 20.145 28.455000000000002 27.255000000000003 24.145 65-69 20.13 28.610000000000003 27.384999999999998 23.875 70-74 20.455000000000002 28.26 27.175 24.11 75-79 20.22 28.98 26.76 24.04 80-84 20.265 28.835 26.87 24.03 85-89 20.785 28.134999999999998 27.295 23.785 90-94 20.285 28.48 26.939999999999998 24.295 95-99 20.595 28.34 27.295 23.77 100-104 19.835 28.77 27.22 24.175 105-109 20.3 28.084999999999997 28.07 23.544999999999998 110-114 20.49 28.275 27.42 23.815 115-119 21.015 28.854999999999997 26.91 23.22 120-124 20.41 28.115000000000002 27.68 23.794999999999998 125-129 20.61 27.98 27.445000000000004 23.965 130-134 21.044999999999998 27.52 27.33 24.104999999999997 135-139 20.76 28.1 27.01 24.13 140-144 20.75 28.410000000000004 27.275 23.565 145-149 21.245 27.715 27.32 23.72 150-151 20.5625 27.525 27.437499999999996 24.474999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 1.5 3 1.5 4 0.5 5 0.0 6 1.0 7 1.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.5 13 1.0 14 0.5 15 0.5 16 0.5 17 1.0 18 2.0 19 2.0 20 2.5 21 2.0 22 3.0 23 4.0 24 4.0 25 4.5 26 6.5 27 11.5 28 14.0 29 16.0 30 22.0 31 29.0 32 37.5 33 47.5 34 53.5 35 64.0 36 94.0 37 118.5 38 128.0 39 142.0 40 162.5 41 185.5 42 206.0 43 246.0 44 279.0 45 277.0 46 253.0 47 236.0 48 235.0 49 207.5 50 174.5 51 139.0 52 113.0 53 106.0 54 81.0 55 71.0 56 62.5 57 44.0 58 30.0 59 20.5 60 21.0 61 11.0 62 4.0 63 6.5 64 4.0 65 1.5 66 2.0 67 1.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.3 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 84.675 #Duplication Level Percentage of deduplicated Percentage of total 1 85.3852967227635 72.3 2 11.632713315618542 19.7 3 2.4800708591674048 6.3 4 0.5019191024505462 1.7000000000000002 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1375 0.0 0.0 0.0 0.0 70-71 0.15 0.0 0.0 0.0 0.0 72-73 0.21250000000000002 0.0 0.0 0.0 0.0 74-75 0.2625 0.0 0.0 0.0 0.0 76-77 0.325 0.0 0.0 0.0 0.0 78-79 0.35 0.0 0.0 0.0 0.0 80-81 0.4125 0.0 0.0 0.0 0.0 82-83 0.5125 0.0 0.0 0.0 0.0 84-85 0.6 0.0 0.0 0.0 0.0 86-87 0.65 0.0 0.0 0.0 0.0 88-89 0.7 0.0 0.0 0.0 0.0 90-91 0.75 0.0 0.0 0.0 0.0 92-93 0.8625 0.0 0.0 0.0 0.0 94-95 0.95 0.0 0.0 0.0 0.0 96-97 1.0375 0.0 0.0 0.0 0.0 98-99 1.125 0.0 0.0 0.0 0.0 100-101 1.2000000000000002 0.0 0.0 0.0 0.0 102-103 1.3375 0.0 0.0 0.0 0.0 104-105 1.4625 0.0 0.0 0.0 0.0 106-107 1.5125000000000002 0.0 0.0 0.0 0.0 108-109 1.6625 0.0 0.0 0.0 0.0 110-111 1.7375 0.0 0.0 0.0 0.0 112-113 1.8625 0.0 0.0 0.0 0.0 114-115 2.125 0.0 0.0 0.0 0.0 116-117 2.3625 0.0 0.0 0.0 0.0 118-119 2.55 0.0 0.0 0.0 0.0 120-121 2.6625 0.0 0.0 0.0 0.0 122-123 2.8499999999999996 0.0 0.0 0.0 0.0 124-125 3.075 0.0 0.0 0.0 0.0 126-127 3.2750000000000004 0.0 0.0 0.0 0.0 128-129 3.5125 0.0 0.0 0.0 0.0 130-131 3.675 0.0 0.0 0.0 0.0 132-133 3.875 0.0 0.0 0.0 0.0 134-135 4.15 0.0 0.0 0.0 0.0 136-137 4.5125 0.0 0.0 0.0 0.0 138-139 4.762499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTCTGGC 10 0.006830828 145.0 6 TAGTAAG 10 0.006830828 145.0 6 >>END_MODULE SRR12671354 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671354_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.267 37.0 37.0 37.0 37.0 37.0 2 36.0645 37.0 37.0 37.0 37.0 37.0 3 36.154 37.0 37.0 37.0 37.0 37.0 4 36.288 37.0 37.0 37.0 37.0 37.0 5 36.3055 37.0 37.0 37.0 37.0 37.0 6 36.267 37.0 37.0 37.0 37.0 37.0 7 36.039 37.0 37.0 37.0 37.0 37.0 8 36.2745 37.0 37.0 37.0 37.0 37.0 9 36.2905 37.0 37.0 37.0 37.0 37.0 10-14 36.21 37.0 37.0 37.0 37.0 37.0 15-19 36.187799999999996 37.0 37.0 37.0 37.0 37.0 20-24 36.0572 37.0 37.0 37.0 37.0 37.0 25-29 36.0184 37.0 37.0 37.0 37.0 37.0 30-34 36.024800000000006 37.0 37.0 37.0 37.0 37.0 35-39 36.01989999999999 37.0 37.0 37.0 37.0 37.0 40-44 35.989700000000006 37.0 37.0 37.0 37.0 37.0 45-49 35.9728 37.0 37.0 37.0 37.0 37.0 50-54 35.933 37.0 37.0 37.0 37.0 37.0 55-59 35.8892 37.0 37.0 37.0 37.0 37.0 60-64 35.8263 37.0 37.0 37.0 37.0 37.0 65-69 35.8787 37.0 37.0 37.0 37.0 37.0 70-74 35.9029 37.0 37.0 37.0 37.0 37.0 75-79 35.8116 37.0 37.0 37.0 37.0 37.0 80-84 35.7899 37.0 37.0 37.0 37.0 37.0 85-89 35.824 37.0 37.0 37.0 37.0 37.0 90-94 35.7236 37.0 37.0 37.0 37.0 37.0 95-99 35.7204 37.0 37.0 37.0 37.0 37.0 100-104 35.68 37.0 37.0 37.0 37.0 37.0 105-109 35.6248 37.0 37.0 37.0 37.0 37.0 110-114 35.5255 37.0 37.0 37.0 37.0 37.0 115-119 35.6072 37.0 37.0 37.0 37.0 37.0 120-124 35.53830000000001 37.0 37.0 37.0 37.0 37.0 125-129 35.5436 37.0 37.0 37.0 37.0 37.0 130-134 35.410399999999996 37.0 37.0 37.0 34.6 37.0 135-139 35.284000000000006 37.0 37.0 37.0 34.6 37.0 140-144 35.4072 37.0 37.0 37.0 37.0 37.0 145-149 35.312 37.0 37.0 37.0 34.6 37.0 150-151 35.166250000000005 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 5.0 14 9.0 15 5.0 16 4.0 17 7.0 18 6.0 19 2.0 20 3.0 21 5.0 22 3.0 23 6.0 24 3.0 25 8.0 26 13.0 27 13.0 28 5.0 29 18.0 30 21.0 31 44.0 32 54.0 33 97.0 34 186.0 35 519.0 36 2704.0 37 260.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.25 23.549999999999997 7.85 22.35 2 30.0 22.975 31.5 15.525 3 20.45 24.8 36.625 18.125 4 24.625 33.800000000000004 23.175 18.4 5 27.675 37.9 20.125 14.299999999999999 6 20.3 41.725 21.45 16.525000000000002 7 21.775 21.5 39.225 17.5 8 21.65 24.55 28.525 25.275 9 23.849999999999998 24.525 28.975 22.650000000000002 10-14 23.68 28.865000000000002 27.055 20.4 15-19 24.12 29.035 26.135 20.71 20-24 23.46 29.154999999999998 27.11 20.275000000000002 25-29 22.91 28.22 27.750000000000004 21.12 30-34 23.18 28.22 28.060000000000002 20.54 35-39 23.515 28.605000000000004 27.200000000000003 20.68 40-44 22.91 28.01 28.215 20.865000000000002 45-49 23.745 28.32 27.500000000000004 20.435 50-54 23.580000000000002 28.38 27.57 20.47 55-59 23.22 27.810000000000002 27.785 21.185000000000002 60-64 22.705000000000002 28.175 27.55 21.57 65-69 23.555 28.815 27.295 20.335 70-74 23.61 28.449999999999996 26.840000000000003 21.099999999999998 75-79 23.150000000000002 28.95 26.525 21.375 80-84 23.380000000000003 28.449999999999996 27.185 20.985 85-89 23.77 27.61 27.560000000000002 21.060000000000002 90-94 24.13 27.615000000000002 27.065 21.19 95-99 24.099999999999998 28.32 27.075 20.505000000000003 100-104 24.02 27.785 27.515 20.68 105-109 23.485 28.7 27.235 20.580000000000002 110-114 24.315 27.834999999999997 27.589999999999996 20.26 115-119 24.375 28.09 27.48 20.055 120-124 25.305 28.139999999999997 26.765 19.79 125-129 24.595 28.000000000000004 27.165 20.24 130-134 24.485 27.66 28.26 19.595000000000002 135-139 24.349999999999998 27.85 27.644999999999996 20.155 140-144 24.545 28.24 27.095000000000002 20.119999999999997 145-149 24.965 27.6 27.26 20.175 150-151 25.05 27.737499999999997 26.724999999999998 20.4875 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.5 10 1.0 11 1.0 12 2.0 13 1.5 14 0.5 15 2.5 16 2.5 17 1.0 18 1.0 19 1.5 20 1.5 21 4.0 22 3.5 23 2.5 24 2.5 25 3.5 26 5.5 27 4.5 28 9.0 29 15.5 30 17.0 31 20.0 32 30.5 33 39.0 34 45.5 35 56.0 36 80.0 37 102.0 38 112.0 39 151.0 40 196.5 41 214.0 42 240.5 43 260.0 44 261.0 45 270.5 46 258.5 47 239.0 48 236.5 49 217.0 50 174.0 51 152.5 52 128.0 53 90.0 54 78.5 55 69.5 56 47.5 57 33.5 58 32.0 59 25.0 60 15.0 61 9.5 62 7.5 63 3.5 64 1.0 65 0.5 66 0.5 67 0.5 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.5 75 1.0 76 0.5 77 0.5 78 1.0 79 0.5 80 1.0 81 1.5 82 1.0 83 0.5 84 0.5 85 1.0 86 0.5 87 0.0 88 0.5 89 1.0 90 0.5 91 0.0 92 0.5 93 0.5 94 0.5 95 0.5 96 0.0 97 0.0 98 0.0 99 0.0 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 84.475 #Duplication Level Percentage of deduplicated Percentage of total 1 85.35069547203314 72.1 2 11.660254513169576 19.7 3 2.3971589227582126 6.075 4 0.5031074282332051 1.7000000000000002 5 0.029594554601953243 0.125 6 0.059189109203906486 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAGAACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 6 0.15 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 6 0.15 No Hit AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.0625 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.125 0.0 0.0 0.0 0.0 68-69 0.16249999999999998 0.0 0.0 0.0 0.0 70-71 0.175 0.0 0.0 0.0 0.0 72-73 0.2375 0.0 0.0 0.0 0.0 74-75 0.2875 0.0 0.0 0.0 0.0 76-77 0.35 0.0 0.0 0.0 0.0 78-79 0.375 0.0 0.0 0.0 0.0 80-81 0.4375 0.0 0.0 0.0 0.0 82-83 0.5375 0.0 0.0 0.0 0.0 84-85 0.625 0.0 0.0 0.0 0.0 86-87 0.675 0.0 0.0 0.0 0.0 88-89 0.725 0.0 0.0 0.0 0.0 90-91 0.775 0.0 0.0 0.0 0.0 92-93 0.8875 0.0 0.0 0.0 0.0 94-95 0.975 0.0 0.0 0.0 0.0 96-97 1.0625 0.0 0.0 0.0 0.0 98-99 1.15 0.0 0.0 0.0 0.0 100-101 1.225 0.0 0.0 0.0 0.0 102-103 1.4 0.0 0.0 0.0 0.0 104-105 1.5375 0.0 0.0 0.0 0.0 106-107 1.5875 0.0 0.0 0.0 0.0 108-109 1.7375 0.0 0.0 0.0 0.0 110-111 1.8250000000000002 0.0 0.0 0.0 0.0 112-113 1.9625 0.0 0.0 0.0 0.0 114-115 2.225 0.0 0.0 0.0 0.0 116-117 2.4625 0.0 0.0 0.0 0.0 118-119 2.65 0.0 0.0 0.0 0.0 120-121 2.7625 0.0 0.0 0.0 0.0 122-123 2.95 0.0 0.0 0.0 0.0 124-125 3.175 0.0 0.0 0.0 0.0 126-127 3.375 0.0 0.0 0.0 0.0 128-129 3.6125 0.0 0.0 0.0 0.0 130-131 3.7875 0.0 0.0 0.0 0.0 132-133 3.975 0.0 0.0 0.0 0.0 134-135 4.25 0.0 0.0 0.0 0.0 136-137 4.6125 0.0 0.0 0.0 0.0 138-139 4.862500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACTGTTA 10 0.006830828 145.0 5 GGGTTCA 10 0.006830828 145.0 3 TCAGGGC 10 0.006830828 145.0 7 CACTGTT 10 0.006830828 145.0 4 GTTCAGG 10 0.006830828 145.0 5 CAGGGCC 10 0.006830828 145.0 8 AGAGAGA 10 0.006830828 145.0 6 TGGGTTC 10 0.006830828 145.0 2 TTCAGGG 10 0.006830828 145.0 6 >>END_MODULE Read 920199 spots for SRR12671354.sra Written 920199 spots for SRR12671354.sra Read 920199 spots for SRR12671354.sra Written 920199 spots for SRR12671354.sra Read 920199 spots for SRR12671354.sra Written 920199 spots for SRR12671354.sra Read 920199 spots for SRR12671354.sra Written 920199 spots for SRR12671354.sra Read 920199 spots for SRR12671354.sra Written 920199 spots for SRR12671354.sra Read 920199 spots for SRR12671354.sra Written 920199 spots for SRR12671354.sra Read 920199 spots for SRR12671354.sra Written 920199 spots for SRR12671354.sra Read 920199 spots for SRR12671354.sra Written 920199 spots for SRR12671354.sra Read 920199 spots for SRR12671354.sra Written 920199 spots for SRR12671354.sra Read 920199 spots for SRR12671354.sra Written 920199 spots for SRR12671354.sra Read 920199 spots for SRR12671354.sra Written 920199 spots for SRR12671354.sra Read 920199 spots for SRR12671354.sra Written 920199 spots for SRR12671354.sra Read 920199 spots for SRR12671354.sra Written 920199 spots for SRR12671354.sra Read 920199 spots for SRR12671354.sra Written 920199 spots for SRR12671354.sra Read 920199 spots for SRR12671354.sra Written 920199 spots for SRR12671354.sra Read 920199 spots for SRR12671354.sra Written 920199 spots for SRR12671354.sra Read 920199 spots for SRR12671354.sra Written 920199 spots for SRR12671354.sra Read 920204 spots for SRR12671354.sra Written 920204 spots for SRR12671354.sra Read 920199 spots for SRR12671354.sra Written 920199 spots for SRR12671354.sra Read 920199 spots for SRR12671354.sra Written 920199 spots for SRR12671354.sra SRR ids: ['SRR12671354.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_pg57f4tz SRR12671354.sra spots: 18403985 blocks: [[1, 920199], [920200, 1840398], [1840399, 2760597], [2760598, 3680796], [3680797, 4600995], [4600996, 5521194], [5521195, 6441393], [6441394, 7361592], [7361593, 8281791], [8281792, 9201990], [9201991, 10122189], [10122190, 11042388], [11042389, 11962587], [11962588, 12882786], [12882787, 13802985], [13802986, 14723184], [14723185, 15643383], [15643384, 16563582], [16563583, 17483781], [17483782, 18403985]] SRR12671354 file size 6232778 SRR12671354 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671354 SRR12671354_1.fastq SRR12671354_2.fastq Input file: SRR12671354_1.fastq Paired file: SRR12671354_2.fastq trimmed: SRR12671354-trimmed-pair1.fastq, SRR12671354-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 18:43:34 2025 >> started Tue Feb 11 18:43:56 2025 >> done (21.394s) 18403985 read pairs processed; of these: 190 ( 0.00%) short read pairs filtered out after trimming by size control 7865 ( 0.04%) empty read pairs filtered out after trimming by size control 18395930 (99.96%) read pairs available; of these: 1207677 ( 6.56%) trimmed read pairs available after processing 17188253 (93.44%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 11 0.00% 19 11 0.00% 20 19 0.00% 21 29 0.00% 22 19 0.00% 23 32 0.00% 24 32 0.00% 25 33 0.00% 26 50 0.00% 27 41 0.00% 28 41 0.00% 29 50 0.00% 30 44 0.00% 31 38 0.00% 32 50 0.00% 33 55 0.00% 34 47 0.00% 35 43 0.00% 36 58 0.00% 37 59 0.00% 38 59 0.00% 39 64 0.00% 40 47 0.00% 41 69 0.00% 42 66 0.00% 43 73 0.00% 44 51 0.00% 45 55 0.00% 46 70 0.00% 47 93 0.00% 48 99 0.00% 49 104 0.00% 50 126 0.00% 51 149 0.00% 52 175 0.00% 53 153 0.00% 54 150 0.00% 55 185 0.00% 56 171 0.00% 57 237 0.00% 58 275 0.00% 59 286 0.00% 60 332 0.00% 61 375 0.00% 62 427 0.00% 63 471 0.00% 64 604 0.00% 65 529 0.00% 66 664 0.00% 67 695 0.00% 68 762 0.00% 69 899 0.00% 70 1082 0.01% 71 1214 0.01% 72 1356 0.01% 73 1555 0.01% 74 1657 0.01% 75 1900 0.01% 76 1978 0.01% 77 2241 0.01% 78 2446 0.01% 79 2590 0.01% 80 2834 0.02% 81 3263 0.02% 82 3564 0.02% 83 3859 0.02% 84 4179 0.02% 85 4457 0.02% 86 4725 0.03% 87 4876 0.03% 88 5272 0.03% 89 5261 0.03% 90 5830 0.03% 91 6316 0.03% 92 6523 0.04% 93 7029 0.04% 94 7669 0.04% 95 7984 0.04% 96 8148 0.04% 97 8604 0.05% 98 8688 0.05% 99 9087 0.05% 100 9744 0.05% 101 9620 0.05% 102 10232 0.06% 103 10896 0.06% 104 11054 0.06% 105 11522 0.06% 106 12005 0.07% 107 12446 0.07% 108 12897 0.07% 109 12989 0.07% 110 13055 0.07% 111 13587 0.07% 112 14049 0.08% 113 14346 0.08% 114 15209 0.08% 115 15592 0.08% 116 16279 0.09% 117 16888 0.09% 118 17056 0.09% 119 17269 0.09% 120 18060 0.10% 121 17943 0.10% 122 18421 0.10% 123 18728 0.10% 124 19834 0.11% 125 20329 0.11% 126 21023 0.11% 127 21498 0.12% 128 22007 0.12% 129 22685 0.12% 130 22770 0.12% 131 23089 0.13% 132 23611 0.13% 133 24504 0.13% 134 24493 0.13% 135 25885 0.14% 136 26130 0.14% 137 26653 0.14% 138 27306 0.15% 139 27864 0.15% 140 28371 0.15% 141 28497 0.15% 142 29366 0.16% 143 29405 0.16% 144 30124 0.16% 145 30737 0.17% 146 31720 0.17% 147 31770 0.17% 148 33968 0.18% 149 33523 0.18% 150 35164 0.19% 151 17188253 93.44% 18395930 reads passed initial QC criterion=sequence-density sequence-density=0.46 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=24 prefix-density=0.46 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=330.95 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=15.2 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGG criterion=sequence-density sequence-density=0.98 sequence-density-rank=1 fanout-score=2.39 fanout-score-rank=25 prefix-density=1.04 prefix-fanout=2.3 sequence=CCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTCTTCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=25.12 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=3.5 sequence=CAGCCTTGATAGAGTAAGAGAAAAGCAGAGCAAGCGACTTAGAGGCAGCATTAACAAAGAAGAGTCATGGCAGCCTCTGCAATCCAACAGTCTGCATTTGCTGGCCAGACCGCCTTGAAGCAACCAAATGATCTTGTTCGGAAGGTTGGTTCCTTCGGTGGTGGTCGTGTTACCATGCGCAGGACTGTGAAAAGTGCTCCCCAAAGCATATGGTATGGCCCAGACCGCCC SRR12671354 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 18:44:43 Started mapping on | Feb 11 18:44:43 Finished on | Feb 11 18:46:51 Mapping speed, Million of reads per hour | 517.39 Number of input reads | 18395930 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 17008678 Uniquely mapped reads % | 92.46% Average mapped length | 296.94 Number of splices: Total | 16475381 Number of splices: Annotated (sjdb) | 16124955 Number of splices: GT/AG | 16139990 Number of splices: GC/AG | 273133 Number of splices: AT/AC | 11834 Number of splices: Non-canonical | 50424 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.93 Insertion rate per base | 0.02% Insertion average length | 2.29 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 435903 % of reads mapped to multiple loci | 2.37% Number of reads mapped to too many loci | 35289 % of reads mapped to too many loci | 0.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.83% % of reads unmapped: other | 0.15% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 951349 951349 951349 N_multimapping 435903 435903 435903 N_noFeature 548604 16655764 669995 N_ambiguous 348670 1411 116417 UnstrandedReadsAssigned:16111404 PositiveStrandReadsAssigned:351503 NegativeStrandReadsAssigned:16222266 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671354 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671354-trimmed-pair1.fastq SRR12671354-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,395,930 reads, 16,184,296 reads pseudoaligned [quant] estimated average fragment length: 282.163 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,089 rounds 52401 SRR12671354.ke.tsv 34699 SRR12671354.se.tsv 87100 total ==> SRR12671354.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1736.84 670 19.6746 Potri.005G024800.1.v4.1 1035 753.837 331 22.3945 Potri.004G059700.1.v4.1 961 680.005 3 0.225009 Potri.007G009000.2.v4.1 1416 1134.84 0 0 Potri.003G141000.2.v4.1 2943 2661.84 828 15.865 Potri.016G087400.1.v4.1 270 76.3755 740 494.161 Potri.015G069301.1.v4.1 564 299.014 0 0 Potri.010G195200.1.v4.1 1773 1491.84 37 1.26494 Potri.012G127500.1.v4.1 977 695.923 33 2.41849 ==> SRR12671354.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 61 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 269 Potri.001G212900.v4.1 27 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR12671354 completed mapping pipeline successfully