Starting /dee2/code/volunteer_pipeline.sh SRR12671355 current disk space = 3052735991808 free memory = 1445532672 SRR12671355 SRAfilesize 5de315d8004b26ee6390d9a445c6a3cb SRR12671355.sra SRR12671355.sra file validated SRR12671355 is paired end SRR12671355 is conventional basespace SRR12671355 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671355_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5825 37.0 37.0 37.0 37.0 37.0 2 36.2225 37.0 37.0 37.0 37.0 37.0 3 36.4565 37.0 37.0 37.0 37.0 37.0 4 36.5485 37.0 37.0 37.0 37.0 37.0 5 36.5865 37.0 37.0 37.0 37.0 37.0 6 36.6315 37.0 37.0 37.0 37.0 37.0 7 36.4945 37.0 37.0 37.0 37.0 37.0 8 36.6095 37.0 37.0 37.0 37.0 37.0 9 36.576 37.0 37.0 37.0 37.0 37.0 10-14 36.621 37.0 37.0 37.0 37.0 37.0 15-19 36.6016 37.0 37.0 37.0 37.0 37.0 20-24 36.5356 37.0 37.0 37.0 37.0 37.0 25-29 36.5142 37.0 37.0 37.0 37.0 37.0 30-34 36.498599999999996 37.0 37.0 37.0 37.0 37.0 35-39 36.4028 37.0 37.0 37.0 37.0 37.0 40-44 36.3954 37.0 37.0 37.0 37.0 37.0 45-49 36.242599999999996 37.0 37.0 37.0 37.0 37.0 50-54 36.2692 37.0 37.0 37.0 37.0 37.0 55-59 36.1839 37.0 37.0 37.0 37.0 37.0 60-64 36.172799999999995 37.0 37.0 37.0 37.0 37.0 65-69 36.119 37.0 37.0 37.0 37.0 37.0 70-74 36.0816 37.0 37.0 37.0 37.0 37.0 75-79 36.133500000000005 37.0 37.0 37.0 37.0 37.0 80-84 36.1006 37.0 37.0 37.0 37.0 37.0 85-89 36.0743 37.0 37.0 37.0 37.0 37.0 90-94 36.092999999999996 37.0 37.0 37.0 37.0 37.0 95-99 36.0382 37.0 37.0 37.0 37.0 37.0 100-104 36.053 37.0 37.0 37.0 37.0 37.0 105-109 36.0472 37.0 37.0 37.0 37.0 37.0 110-114 35.9177 37.0 37.0 37.0 37.0 37.0 115-119 35.923500000000004 37.0 37.0 37.0 37.0 37.0 120-124 35.8472 37.0 37.0 37.0 37.0 37.0 125-129 35.8553 37.0 37.0 37.0 37.0 37.0 130-134 35.7829 37.0 37.0 37.0 37.0 37.0 135-139 35.7183 37.0 37.0 37.0 37.0 37.0 140-144 35.581399999999995 37.0 37.0 37.0 37.0 37.0 145-149 35.3977 37.0 37.0 37.0 37.0 37.0 150-151 35.336 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 3.0 20 1.0 21 7.0 22 2.0 23 7.0 24 7.0 25 8.0 26 8.0 27 11.0 28 15.0 29 7.0 30 22.0 31 36.0 32 49.0 33 84.0 34 154.0 35 319.0 36 2863.0 37 396.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 59.599999999999994 13.525 5.65 21.224999999999998 2 20.84796788760662 12.393376818866031 35.17310587054692 31.58554942298043 3 17.1 22.625 33.0 27.275 4 23.625 28.199999999999996 25.900000000000002 22.275 5 22.925 35.375 23.5 18.2 6 19.400000000000002 34.849999999999994 24.975 20.775 7 13.850000000000001 24.0 44.45 17.7 8 15.2 23.549999999999997 35.199999999999996 26.05 9 17.974999999999998 21.275 34.675 26.075 10-14 20.4 28.63 27.61 23.36 15-19 20.74 27.195000000000004 28.560000000000002 23.505000000000003 20-24 20.3 28.01 28.235 23.455000000000002 25-29 19.72 28.115000000000002 28.21 23.955000000000002 30-34 19.634999999999998 28.249999999999996 28.315 23.799999999999997 35-39 18.985 28.185 28.225 24.605 40-44 19.5 29.220000000000002 27.705000000000002 23.575 45-49 20.919999999999998 29.054999999999996 26.88 23.145 50-54 20.27 28.76 28.084999999999997 22.884999999999998 55-59 20.84 28.535 27.505000000000003 23.119999999999997 60-64 20.8 29.455 26.845000000000002 22.900000000000002 65-69 20.605 28.675 27.700000000000003 23.02 70-74 20.825 28.38 27.405 23.39 75-79 20.495 28.425 27.655 23.425 80-84 20.549999999999997 28.305000000000003 27.85 23.294999999999998 85-89 20.915 28.555000000000003 27.034999999999997 23.494999999999997 90-94 21.19 28.42 26.834999999999997 23.555 95-99 21.57 28.815 26.8 22.814999999999998 100-104 20.93 28.775000000000002 27.05 23.244999999999997 105-109 20.880000000000003 29.189999999999998 27.055 22.875 110-114 21.175 29.615000000000002 26.240000000000002 22.97 115-119 21.0 29.354999999999997 25.979999999999997 23.665 120-124 21.59 29.770000000000003 25.405 23.235 125-129 21.490000000000002 28.22 26.334999999999997 23.955000000000002 130-134 21.965 27.99 25.85 24.195 135-139 21.34 28.345 26.605 23.71 140-144 21.43 28.189999999999998 25.655 24.725 145-149 21.195 27.400000000000002 26.534999999999997 24.87 150-151 21.675 28.375 26.400000000000002 23.549999999999997 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 6.0 1 4.0 2 2.5 3 1.5 4 1.5 5 2.0 6 1.0 7 1.0 8 2.0 9 2.0 10 2.0 11 2.0 12 1.0 13 0.5 14 1.0 15 3.0 16 3.0 17 1.0 18 2.5 19 3.5 20 1.0 21 2.5 22 3.5 23 3.0 24 2.5 25 4.0 26 10.0 27 15.5 28 19.0 29 21.0 30 26.5 31 26.5 32 32.5 33 40.5 34 52.0 35 63.5 36 69.5 37 88.0 38 98.5 39 126.5 40 162.5 41 196.5 42 222.5 43 257.0 44 288.0 45 272.0 46 266.0 47 258.0 48 236.5 49 201.5 50 168.5 51 152.0 52 117.5 53 87.5 54 76.0 55 62.0 56 55.0 57 44.5 58 28.0 59 26.0 60 21.5 61 14.0 62 7.5 63 4.5 64 7.0 65 7.5 66 5.0 67 2.5 68 2.0 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.5 76 0.5 77 0.5 78 0.5 79 0.0 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.5 98 0.5 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.35000000000000003 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 84.775 #Duplication Level Percentage of deduplicated Percentage of total 1 85.96284281922738 72.875 2 11.501032143910352 19.5 3 1.9168386906517252 4.875 4 0.32438808611029196 1.0999999999999999 5 0.11795930404010617 0.5 6 0.058979652020053085 0.3 7 0.029489826010026542 0.17500000000000002 8 0.058979652020053085 0.4 9 0.0 0.0 >10 0.029489826010026542 0.27499999999999997 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACAATGCCTCATCTCGTAT 11 0.27499999999999997 TruSeq Adapter, Index 25 (97% over 37bp) TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 8 0.2 No Hit GGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGA 8 0.2 No Hit GTCCGACTCCGGTCACGAGACCTTGCACAAAGTAACCCAAGATGGCCAAC 7 0.17500000000000002 No Hit GCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGC 6 0.15 No Hit ATGTGACTAATATCAGCAGTGACCCCGGGAGCATTCACAACATCATAGAG 6 0.15 No Hit GTTGGTCACCCCTTCCACAAGCTGATATTCTTCAGAGAAAATAGCATCCC 5 0.125 No Hit GCAACGGATAGGGGTCGACATCAGAGCTACATATTCGCAGCGGCTTGGTT 5 0.125 No Hit GCTGATTATTTTTTGTATTTTGACTTCGTACCGCATGAGCAACATTTGGC 5 0.125 No Hit TTCAGGAAGATCCTCTGTACACAAGCAAGTTTGATGAAAAGTAGAGGGGC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.037500000000000006 0.0 0.0 0.0 0.0 18-19 0.05 0.0 0.0 0.0 0.0 20-21 0.05 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.0625 0.0 0.0 0.0 0.0 34-35 0.075 0.0 0.0 0.0 0.0 36-37 0.075 0.0 0.0 0.0 0.0 38-39 0.0875 0.0 0.0 0.0 0.0 40-41 0.1 0.0 0.0 0.0 0.0 42-43 0.1 0.0 0.0 0.0 0.0 44-45 0.1 0.0 0.0 0.0 0.0 46-47 0.1 0.0 0.0 0.0 0.0 48-49 0.1 0.0 0.0 0.0 0.0 50-51 0.1 0.0 0.0 0.0 0.0 52-53 0.125 0.0 0.0 0.0 0.0 54-55 0.15 0.0 0.0 0.0 0.0 56-57 0.16249999999999998 0.0 0.0 0.0 0.0 58-59 0.175 0.0 0.0 0.0 0.0 60-61 0.2 0.0 0.0 0.0 0.0 62-63 0.2 0.0 0.0 0.0 0.0 64-65 0.21250000000000002 0.0 0.0 0.0 0.0 66-67 0.225 0.0 0.0 0.0 0.0 68-69 0.225 0.0 0.0 0.0 0.0 70-71 0.2625 0.0 0.0 0.0 0.0 72-73 0.325 0.0 0.0 0.0 0.0 74-75 0.3625 0.0 0.0 0.0 0.0 76-77 0.4375 0.0 0.0 0.0 0.0 78-79 0.775 0.0 0.0 0.0 0.0 80-81 0.875 0.0 0.0 0.0 0.0 82-83 1.1125 0.0 0.0 0.0 0.0 84-85 1.4125 0.0 0.0 0.0 0.0 86-87 1.7625000000000002 0.0 0.0 0.0 0.0 88-89 2.1375 0.0 0.0 0.0 0.0 90-91 2.4625000000000004 0.0 0.0 0.0 0.0 92-93 2.8375000000000004 0.0 0.0 0.0 0.0 94-95 3.25 0.0 0.0 0.0 0.0 96-97 3.675 0.0 0.0 0.0 0.0 98-99 4.0375 0.0 0.0 0.0 0.0 100-101 4.637499999999999 0.0 0.0 0.0 0.0 102-103 5.199999999999999 0.0 0.0 0.0 0.0 104-105 5.675000000000001 0.0 0.0 0.0 0.0 106-107 6.0625 0.0 0.0 0.0 0.0 108-109 6.4125 0.0 0.0 0.0 0.0 110-111 7.1875 0.0 0.0 0.0 0.0 112-113 7.65 0.0 0.0 0.0 0.0 114-115 8.2125 0.0 0.0 0.0 0.0 116-117 8.7125 0.0 0.0 0.0 0.0 118-119 9.0625 0.0 0.0 0.0 0.0 120-121 9.725 0.0 0.0 0.0 0.0 122-123 10.3 0.0 0.0 0.0 0.0 124-125 10.85 0.0 0.0 0.0 0.0 126-127 11.6375 0.0 0.0 0.0 0.0 128-129 12.525 0.0 0.0 0.0 0.0 130-131 13.125 0.0 0.0 0.0 0.0 132-133 13.7375 0.0 0.0 0.0 0.0 134-135 14.3375 0.0 0.0 0.0 0.0 136-137 14.975000000000001 0.0 0.0 0.0 0.0 138-139 15.475 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGAAGCT 10 0.006830828 145.0 7 TAAGAAG 10 0.006830828 145.0 5 GCCAGCT 10 0.006830828 145.0 1 ATAGAAG 10 0.006830828 145.0 145 AAGAAGC 10 0.006830828 145.0 6 GCACACG 55 1.1668232E-4 18.454546 135-139 CGTCTGA 55 1.1668232E-4 18.454546 140-144 GATCGGA 55 0.0025160722 15.818182 125-129 GAAGAGC 55 0.0025160722 15.818182 130-134 >>END_MODULE SRR12671355 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671355_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.249 37.0 37.0 37.0 37.0 37.0 2 36.0105 37.0 37.0 37.0 37.0 37.0 3 36.2365 37.0 37.0 37.0 37.0 37.0 4 36.296 37.0 37.0 37.0 37.0 37.0 5 36.307 37.0 37.0 37.0 37.0 37.0 6 36.168 37.0 37.0 37.0 37.0 37.0 7 36.085 37.0 37.0 37.0 37.0 37.0 8 36.289 37.0 37.0 37.0 37.0 37.0 9 36.257 37.0 37.0 37.0 37.0 37.0 10-14 36.1864 37.0 37.0 37.0 37.0 37.0 15-19 36.21489999999999 37.0 37.0 37.0 37.0 37.0 20-24 36.0542 37.0 37.0 37.0 37.0 37.0 25-29 36.0375 37.0 37.0 37.0 37.0 37.0 30-34 35.9802 37.0 37.0 37.0 37.0 37.0 35-39 35.9927 37.0 37.0 37.0 37.0 37.0 40-44 35.964600000000004 37.0 37.0 37.0 37.0 37.0 45-49 35.9405 37.0 37.0 37.0 37.0 37.0 50-54 35.9017 37.0 37.0 37.0 37.0 37.0 55-59 35.8899 37.0 37.0 37.0 37.0 37.0 60-64 35.89390000000001 37.0 37.0 37.0 37.0 37.0 65-69 35.873599999999996 37.0 37.0 37.0 37.0 37.0 70-74 35.80250000000001 37.0 37.0 37.0 37.0 37.0 75-79 35.7685 37.0 37.0 37.0 37.0 37.0 80-84 35.773799999999994 37.0 37.0 37.0 37.0 37.0 85-89 35.8135 37.0 37.0 37.0 37.0 37.0 90-94 35.768699999999995 37.0 37.0 37.0 37.0 37.0 95-99 35.7162 37.0 37.0 37.0 37.0 37.0 100-104 35.671499999999995 37.0 37.0 37.0 37.0 37.0 105-109 35.6168 37.0 37.0 37.0 37.0 37.0 110-114 35.6 37.0 37.0 37.0 37.0 37.0 115-119 35.6577 37.0 37.0 37.0 37.0 37.0 120-124 35.4602 37.0 37.0 37.0 37.0 37.0 125-129 35.2925 37.0 37.0 37.0 34.6 37.0 130-134 35.0529 37.0 37.0 37.0 27.4 37.0 135-139 34.9731 37.0 37.0 37.0 25.0 37.0 140-144 34.9011 37.0 37.0 37.0 25.0 37.0 145-149 34.589299999999994 37.0 37.0 37.0 25.0 37.0 150-151 34.30275 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 5.0 14 9.0 15 3.0 16 5.0 17 0.0 18 2.0 19 5.0 20 6.0 21 4.0 22 6.0 23 5.0 24 7.0 25 6.0 26 9.0 27 19.0 28 17.0 29 17.0 30 32.0 31 46.0 32 73.0 33 115.0 34 230.0 35 523.0 36 2548.0 37 306.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 60.550000000000004 19.475 5.625 14.35 2 29.225 17.825 31.424999999999997 21.525 3 23.7 22.400000000000002 36.15 17.75 4 26.474999999999998 32.324999999999996 23.799999999999997 17.4 5 24.875 38.074999999999996 20.25 16.8 6 23.225 37.225 21.625 17.925 7 21.9 21.8 36.199999999999996 20.1 8 19.45 25.575 29.275000000000002 25.7 9 22.925 23.225 28.225 25.624999999999996 10-14 23.919999999999998 27.99 26.815 21.275 15-19 23.549999999999997 27.875 27.884999999999998 20.69 20-24 23.189999999999998 27.884999999999998 28.17 20.755000000000003 25-29 23.169999999999998 27.96 28.21 20.66 30-34 23.3 27.169999999999998 28.15 21.38 35-39 22.89 27.860000000000003 28.475 20.775 40-44 22.67 27.845 27.825 21.66 45-49 23.465 28.084999999999997 27.900000000000002 20.549999999999997 50-54 22.945 28.07 27.939999999999998 21.044999999999998 55-59 23.419999999999998 27.675 27.99 20.915 60-64 23.48 27.3 28.33 20.89 65-69 23.785 27.63 27.37 21.215 70-74 23.64 28.09 27.46 20.810000000000002 75-79 23.305 28.1 27.389999999999997 21.205 80-84 23.880000000000003 27.224999999999998 27.810000000000002 21.085 85-89 23.974999999999998 27.625 27.375 21.025 90-94 24.4 27.22 27.485 20.895 95-99 23.945 27.63 27.705000000000002 20.72 100-104 24.535 28.439999999999998 26.345000000000002 20.68 105-109 25.355 27.22 26.85 20.575 110-114 24.97 28.1 27.245 19.685 115-119 26.240000000000002 27.944999999999997 26.224999999999998 19.59 120-124 25.779999999999998 27.810000000000002 26.255 20.155 125-129 26.39 27.894999999999996 26.41 19.305 130-134 27.38 27.565 25.745 19.31 135-139 27.084999999999997 27.51 26.055 19.35 140-144 28.15 26.415 26.384999999999998 19.05 145-149 29.685 26.279999999999998 25.905 18.13 150-151 29.9875 26.9625 24.9 18.15 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.5 4 0.5 5 1.0 6 1.0 7 0.5 8 1.5 9 1.5 10 0.5 11 1.0 12 1.0 13 0.5 14 0.5 15 0.0 16 0.0 17 1.0 18 1.5 19 1.0 20 0.5 21 1.0 22 1.5 23 3.5 24 3.5 25 6.0 26 11.5 27 11.5 28 10.5 29 12.0 30 17.0 31 22.0 32 24.5 33 33.5 34 48.5 35 60.5 36 71.5 37 102.5 38 132.0 39 148.5 40 169.5 41 198.5 42 216.0 43 258.5 44 272.5 45 261.5 46 275.0 47 249.0 48 228.5 49 198.0 50 160.0 51 146.5 52 124.5 53 94.5 54 84.0 55 82.0 56 60.0 57 36.0 58 32.0 59 26.5 60 19.0 61 14.5 62 8.0 63 5.0 64 3.5 65 3.0 66 1.5 67 0.0 68 1.0 69 1.5 70 1.5 71 1.5 72 0.5 73 1.0 74 1.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.5 82 0.5 83 0.5 84 0.5 85 0.0 86 0.5 87 1.5 88 1.0 89 0.0 90 1.0 91 1.5 92 0.5 93 1.0 94 1.5 95 0.5 96 0.5 97 1.0 98 2.0 99 2.5 100 5.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 85.3 #Duplication Level Percentage of deduplicated Percentage of total 1 86.34232121922626 73.65 2 11.107854630715124 18.95 3 1.992966002344666 5.1 4 0.3516998827667058 1.2 5 0.14654161781946073 0.625 6 0.029308323563892142 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.029308323563892142 0.325 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 13 0.325 No Hit GGATTGGGCAACCTCTTGCAATGCTAATGAAGATGAATCCTTTGGTCTCA 6 0.15 No Hit GCTAGCTAGAAGTGACTCTACCCTTTGCATTACTTTTTCAATCAATCACT 5 0.125 No Hit GTTAAAACACGACTTTGGCATGGAGAAGGAGTTCTATTTCTACTACGATC 5 0.125 No Hit AGAACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 5 0.125 No Hit AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 5 0.125 No Hit TTCAAACCTTTTCATGGAATCTGGAAAGCCTTTTACTTTATGTCAGCTGC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.037500000000000006 0.0 0.0 0.0 0.0 18-19 0.05 0.0 0.0 0.0 0.0 20-21 0.05 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.0625 0.0 0.0 0.0 0.0 34-35 0.075 0.0 0.0 0.0 0.0 36-37 0.075 0.0 0.0 0.0 0.0 38-39 0.0875 0.0 0.0 0.0 0.0 40-41 0.1 0.0 0.0 0.0 0.0 42-43 0.1 0.0 0.0 0.0 0.0 44-45 0.1 0.0 0.0 0.0 0.0 46-47 0.1 0.0 0.0 0.0 0.0 48-49 0.1 0.0 0.0 0.0 0.0 50-51 0.1 0.0 0.0 0.0 0.0 52-53 0.125 0.0 0.0 0.0 0.0 54-55 0.15 0.0 0.0 0.0 0.0 56-57 0.16249999999999998 0.0 0.0 0.0 0.0 58-59 0.175 0.0 0.0 0.0 0.0 60-61 0.2 0.0 0.0 0.0 0.0 62-63 0.2 0.0 0.0 0.0 0.0 64-65 0.2 0.0 0.0 0.0 0.0 66-67 0.2 0.0 0.0 0.0 0.0 68-69 0.2 0.0 0.0 0.0 0.0 70-71 0.2375 0.0 0.0 0.0 0.0 72-73 0.275 0.0 0.0 0.0 0.0 74-75 0.3125 0.0 0.0 0.0 0.0 76-77 0.38749999999999996 0.0 0.0 0.0 0.0 78-79 0.725 0.0 0.0 0.0 0.0 80-81 0.825 0.0 0.0 0.0 0.0 82-83 1.0625 0.0 0.0 0.0 0.0 84-85 1.3624999999999998 0.0 0.0 0.0 0.0 86-87 1.7125 0.0 0.0 0.0 0.0 88-89 2.0875 0.0 0.0 0.0 0.0 90-91 2.4124999999999996 0.0 0.0 0.0 0.0 92-93 2.7874999999999996 0.0 0.0 0.0 0.0 94-95 3.2 0.0 0.0 0.0 0.0 96-97 3.625 0.0 0.0 0.0 0.0 98-99 3.9875 0.0 0.0 0.0 0.0 100-101 4.5875 0.0 0.0 0.0 0.0 102-103 5.15 0.0 0.0 0.0 0.0 104-105 5.625 0.0 0.0 0.0 0.0 106-107 6.012499999999999 0.0 0.0 0.0 0.0 108-109 6.3625 0.0 0.0 0.0 0.0 110-111 7.1125 0.0 0.0 0.0 0.0 112-113 7.5875 0.0 0.0 0.0 0.0 114-115 8.175 0.0 0.0 0.0 0.0 116-117 8.725 0.0 0.0 0.0 0.0 118-119 9.0625 0.0 0.0 0.0 0.0 120-121 9.7375 0.0 0.0 0.0 0.0 122-123 10.3125 0.0 0.0 0.0 0.0 124-125 10.9 0.0 0.0 0.0 0.0 126-127 11.7375 0.0 0.0 0.0 0.0 128-129 12.65 0.0 0.0 0.0 0.0 130-131 13.25 0.0 0.0 0.0 0.0 132-133 13.875 0.0 0.0 0.0 0.0 134-135 14.45 0.0 0.0 0.0 0.0 136-137 15.125 0.0 0.0 0.0 0.0 138-139 15.625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TACTAAT 10 0.006830828 145.0 6 GTGTAGG 45 6.5511256E-4 19.333332 140-144 GCGTCGT 45 6.5511256E-4 19.333332 135-139 GATCGGA 60 0.004491891 14.500001 125-129 GAAGAGC 60 0.004491891 14.500001 130-134 >>END_MODULE Read 905413 spots for SRR12671355.sra Written 905413 spots for SRR12671355.sra Read 905413 spots for SRR12671355.sra Written 905413 spots for SRR12671355.sra Read 905413 spots for SRR12671355.sra Written 905413 spots for SRR12671355.sra Read 905413 spots for SRR12671355.sra Written 905413 spots for SRR12671355.sra Read 905413 spots for SRR12671355.sra Written 905413 spots for SRR12671355.sra Read 905413 spots for SRR12671355.sra Written 905413 spots for SRR12671355.sra Read 905413 spots for SRR12671355.sra Written 905413 spots for SRR12671355.sra Read 905413 spots for SRR12671355.sra Written 905413 spots for SRR12671355.sra Read 905413 spots for SRR12671355.sra Written 905413 spots for SRR12671355.sra Read 905413 spots for SRR12671355.sra Written 905413 spots for SRR12671355.sra Read 905413 spots for SRR12671355.sra Written 905413 spots for SRR12671355.sra Read 905418 spots for SRR12671355.sra Written 905418 spots for SRR12671355.sra Read 905413 spots for SRR12671355.sra Written 905413 spots for SRR12671355.sra Read 905413 spots for SRR12671355.sra Written 905413 spots for SRR12671355.sra Read 905413 spots for SRR12671355.sra Written 905413 spots for SRR12671355.sra Read 905413 spots for SRR12671355.sra Written 905413 spots for SRR12671355.sra Read 905413 spots for SRR12671355.sra Written 905413 spots for SRR12671355.sra Read 905413 spots for SRR12671355.sra Written 905413 spots for SRR12671355.sra Read 905413 spots for SRR12671355.sra Written 905413 spots for SRR12671355.sra Read 905413 spots for SRR12671355.sra Written 905413 spots for SRR12671355.sra SRR ids: ['SRR12671355.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_m68iaktj SRR12671355.sra spots: 18108265 blocks: [[1, 905413], [905414, 1810826], [1810827, 2716239], [2716240, 3621652], [3621653, 4527065], [4527066, 5432478], [5432479, 6337891], [6337892, 7243304], [7243305, 8148717], [8148718, 9054130], [9054131, 9959543], [9959544, 10864956], [10864957, 11770369], [11770370, 12675782], [12675783, 13581195], [13581196, 14486608], [14486609, 15392021], [15392022, 16297434], [16297435, 17202847], [17202848, 18108265]] SRR12671355 file size 6132280 SRR12671355 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671355 SRR12671355_1.fastq SRR12671355_2.fastq Input file: SRR12671355_1.fastq Paired file: SRR12671355_2.fastq trimmed: SRR12671355-trimmed-pair1.fastq, SRR12671355-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 17:56:47 2025 >> started Tue Feb 11 17:57:07 2025 >> done (20.362s) 18108265 read pairs processed; of these: 810 ( 0.00%) short read pairs filtered out after trimming by size control 41247 ( 0.23%) empty read pairs filtered out after trimming by size control 18066208 (99.77%) read pairs available; of these: 3350897 (18.55%) trimmed read pairs available after processing 14715311 (81.45%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 81 0.00% 19 83 0.00% 20 111 0.00% 21 86 0.00% 22 100 0.00% 23 148 0.00% 24 131 0.00% 25 140 0.00% 26 185 0.00% 27 153 0.00% 28 205 0.00% 29 154 0.00% 30 169 0.00% 31 165 0.00% 32 141 0.00% 33 171 0.00% 34 167 0.00% 35 176 0.00% 36 185 0.00% 37 169 0.00% 38 196 0.00% 39 220 0.00% 40 203 0.00% 41 225 0.00% 42 211 0.00% 43 246 0.00% 44 264 0.00% 45 280 0.00% 46 312 0.00% 47 339 0.00% 48 394 0.00% 49 466 0.00% 50 521 0.00% 51 593 0.00% 52 657 0.00% 53 767 0.00% 54 787 0.00% 55 839 0.00% 56 936 0.01% 57 1049 0.01% 58 1235 0.01% 59 1416 0.01% 60 1741 0.01% 61 1987 0.01% 62 2334 0.01% 63 2520 0.01% 64 2543 0.01% 65 2789 0.02% 66 3098 0.02% 67 3570 0.02% 68 4058 0.02% 69 4734 0.03% 70 5595 0.03% 71 6334 0.04% 72 7323 0.04% 73 8221 0.05% 74 8295 0.05% 75 8933 0.05% 76 9211 0.05% 77 10471 0.06% 78 11087 0.06% 79 12463 0.07% 80 13494 0.07% 81 15409 0.09% 82 17471 0.10% 83 18382 0.10% 84 19692 0.11% 85 19973 0.11% 86 20164 0.11% 87 20974 0.12% 88 22034 0.12% 89 23524 0.13% 90 25285 0.14% 91 27283 0.15% 92 29061 0.16% 93 31700 0.18% 94 32090 0.18% 95 33043 0.18% 96 32593 0.18% 97 32236 0.18% 98 33076 0.18% 99 34424 0.19% 100 36402 0.20% 101 37959 0.21% 102 41046 0.23% 103 41929 0.23% 104 42975 0.24% 105 42942 0.24% 106 42623 0.24% 107 42266 0.23% 108 42262 0.23% 109 42327 0.23% 110 43208 0.24% 111 46097 0.26% 112 47514 0.26% 113 48706 0.27% 114 50715 0.28% 115 50440 0.28% 116 51092 0.28% 117 50662 0.28% 118 48689 0.27% 119 49685 0.28% 120 49828 0.28% 121 51688 0.29% 122 53304 0.30% 123 55772 0.31% 124 58231 0.32% 125 57904 0.32% 126 58718 0.33% 127 57086 0.32% 128 55407 0.31% 129 55800 0.31% 130 54852 0.30% 131 55220 0.31% 132 56822 0.31% 133 59178 0.33% 134 60604 0.34% 135 62281 0.34% 136 61272 0.34% 137 60488 0.33% 138 59905 0.33% 139 59609 0.33% 140 57515 0.32% 141 58664 0.32% 142 57612 0.32% 143 60949 0.34% 144 63108 0.35% 145 63608 0.35% 146 64101 0.35% 147 62890 0.35% 148 62290 0.34% 149 60411 0.33% 150 61950 0.34% 151 14715311 81.45% 18066208 reads passed initial QC criterion=sequence-density sequence-density=0.54 sequence-density-rank=1 fanout-score=1.96 fanout-score-rank=37 prefix-density=0.54 prefix-fanout=1.9 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.02 sequence-density-rank=38 fanout-score=216.60 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=16.0 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAG criterion=sequence-density sequence-density=0.97 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=24 prefix-density=0.97 prefix-fanout=2.0 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTCTTCA criterion=fanout-score sequence-density=0.35 sequence-density-rank=7 fanout-score=7.42 fanout-score-rank=1 prefix-density=1.01 prefix-fanout=2.5 sequence=ATGGCTTCCTCTGTGATTTCATCGGCGGCCGTTGCCACAGTTAACCGCACCCC SRR12671355 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 17:57:50 Started mapping on | Feb 11 17:57:50 Finished on | Feb 11 17:59:58 Mapping speed, Million of reads per hour | 508.11 Number of input reads | 18066208 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 16042904 Uniquely mapped reads % | 88.80% Average mapped length | 287.52 Number of splices: Total | 14797967 Number of splices: Annotated (sjdb) | 14460643 Number of splices: GT/AG | 14490848 Number of splices: GC/AG | 242952 Number of splices: AT/AC | 9728 Number of splices: Non-canonical | 54439 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.90 Insertion rate per base | 0.02% Insertion average length | 2.25 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 416990 % of reads mapped to multiple loci | 2.31% Number of reads mapped to too many loci | 90694 % of reads mapped to too many loci | 0.50% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 8.06% % of reads unmapped: other | 0.33% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1606314 1606314 1606314 N_multimapping 416990 416990 416990 N_noFeature 652642 15752417 769413 N_ambiguous 278855 1112 104494 UnstrandedReadsAssigned:15111407 PositiveStrandReadsAssigned:289375 NegativeStrandReadsAssigned:15168997 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671355 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671355-trimmed-pair1.fastq SRR12671355-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,066,208 reads, 15,275,857 reads pseudoaligned [quant] estimated average fragment length: 241.331 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,078 rounds 52401 SRR12671355.ke.tsv 34699 SRR12671355.se.tsv 87100 total ==> SRR12671355.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1777.67 619 22.4497 Potri.005G024800.1.v4.1 1035 794.669 312 25.3127 Potri.004G059700.1.v4.1 961 721.075 4 0.357643 Potri.007G009000.2.v4.1 1416 1175.67 0 0 Potri.003G141000.2.v4.1 2943 2702.67 1104 26.3358 Potri.016G087400.1.v4.1 270 103.365 745 464.681 Potri.015G069301.1.v4.1 564 342.479 0 0 Potri.010G195200.1.v4.1 1773 1532.67 46 1.935 Potri.012G127500.1.v4.1 977 736.882 66 5.77453 ==> SRR12671355.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 175 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 198 Potri.001G212900.v4.1 4 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 7 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR12671355 completed mapping pipeline successfully