Starting /dee2/code/volunteer_pipeline.sh SRR12671356 current disk space = 3053406556160 free memory = 1462009252 SRR12671356 SRAfilesize f990f585cd861b210d0bb8b15a62ff39 SRR12671356.sra SRR12671356.sra file validated SRR12671356 is paired end SRR12671356 is conventional basespace SRR12671356 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671356_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.451 37.0 37.0 37.0 37.0 37.0 2 36.355 37.0 37.0 37.0 37.0 37.0 3 36.558 37.0 37.0 37.0 37.0 37.0 4 36.6065 37.0 37.0 37.0 37.0 37.0 5 36.601 37.0 37.0 37.0 37.0 37.0 6 36.549 37.0 37.0 37.0 37.0 37.0 7 36.4695 37.0 37.0 37.0 37.0 37.0 8 36.5765 37.0 37.0 37.0 37.0 37.0 9 36.6175 37.0 37.0 37.0 37.0 37.0 10-14 36.5998 37.0 37.0 37.0 37.0 37.0 15-19 36.60209999999999 37.0 37.0 37.0 37.0 37.0 20-24 36.551100000000005 37.0 37.0 37.0 37.0 37.0 25-29 36.5372 37.0 37.0 37.0 37.0 37.0 30-34 36.493399999999994 37.0 37.0 37.0 37.0 37.0 35-39 36.4548 37.0 37.0 37.0 37.0 37.0 40-44 36.4217 37.0 37.0 37.0 37.0 37.0 45-49 36.41 37.0 37.0 37.0 37.0 37.0 50-54 36.4215 37.0 37.0 37.0 37.0 37.0 55-59 36.3213 37.0 37.0 37.0 37.0 37.0 60-64 36.360699999999994 37.0 37.0 37.0 37.0 37.0 65-69 36.3378 37.0 37.0 37.0 37.0 37.0 70-74 36.309799999999996 37.0 37.0 37.0 37.0 37.0 75-79 36.3081 37.0 37.0 37.0 37.0 37.0 80-84 36.2718 37.0 37.0 37.0 37.0 37.0 85-89 36.2051 37.0 37.0 37.0 37.0 37.0 90-94 36.1969 37.0 37.0 37.0 37.0 37.0 95-99 36.1986 37.0 37.0 37.0 37.0 37.0 100-104 36.166999999999994 37.0 37.0 37.0 37.0 37.0 105-109 36.165200000000006 37.0 37.0 37.0 37.0 37.0 110-114 36.0947 37.0 37.0 37.0 37.0 37.0 115-119 36.074799999999996 37.0 37.0 37.0 37.0 37.0 120-124 35.999300000000005 37.0 37.0 37.0 37.0 37.0 125-129 35.9766 37.0 37.0 37.0 37.0 37.0 130-134 35.90990000000001 37.0 37.0 37.0 37.0 37.0 135-139 35.8089 37.0 37.0 37.0 37.0 37.0 140-144 35.72529999999999 37.0 37.0 37.0 37.0 37.0 145-149 35.6232 37.0 37.0 37.0 37.0 37.0 150-151 35.449749999999995 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 0.0 21 3.0 22 3.0 23 4.0 24 2.0 25 4.0 26 5.0 27 6.0 28 8.0 29 13.0 30 24.0 31 32.0 32 50.0 33 79.0 34 135.0 35 308.0 36 2881.0 37 442.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.375 12.950000000000001 3.875 50.8 2 13.734335839598996 12.581453634085213 47.26817042606516 26.416040100250626 3 15.0 17.125 30.9 36.975 4 21.775 25.474999999999998 24.349999999999998 28.4 5 21.7 34.55 26.724999999999998 17.025000000000002 6 16.925 33.475 27.3 22.3 7 12.174999999999999 24.474999999999998 46.35 17.0 8 14.075 24.4 37.0 24.525 9 16.525000000000002 20.424999999999997 39.0 24.05 10-14 18.9 29.294999999999998 28.88 22.925 15-19 19.27 28.065 28.43 24.235 20-24 19.325 28.57 28.999999999999996 23.105 25-29 18.57 28.785 28.54 24.104999999999997 30-34 19.275000000000002 28.205000000000002 28.139999999999997 24.38 35-39 19.62 28.71 28.310000000000002 23.36 40-44 19.040000000000003 28.95 28.415000000000003 23.595 45-49 19.445 28.194999999999997 28.37 23.990000000000002 50-54 19.98 28.194999999999997 28.315 23.51 55-59 19.8 28.449999999999996 28.37 23.380000000000003 60-64 19.939999999999998 29.01 27.474999999999998 23.575 65-69 20.02 28.15 28.83 23.0 70-74 20.365 28.465 27.43 23.74 75-79 19.91 28.38 28.475 23.235 80-84 19.8 28.494999999999997 28.515 23.189999999999998 85-89 19.400000000000002 29.07 27.93 23.599999999999998 90-94 20.025000000000002 28.17 28.165000000000003 23.64 95-99 20.375 28.98 28.235 22.41 100-104 20.830000000000002 28.744999999999997 27.36 23.064999999999998 105-109 20.515 29.270000000000003 26.779999999999998 23.435 110-114 20.41 29.599999999999998 27.13 22.86 115-119 20.57 28.675 27.52 23.235 120-124 20.185 28.64 26.634999999999998 24.54 125-129 21.135 28.405 26.729999999999997 23.73 130-134 20.165 28.63 27.310000000000002 23.895 135-139 20.724999999999998 28.84 26.790000000000003 23.645 140-144 21.41 27.755000000000003 27.015 23.82 145-149 21.27 28.38 27.200000000000003 23.150000000000002 150-151 21.8875 27.0125 27.0125 24.087500000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 1.0 3 1.5 4 1.0 5 1.0 6 0.5 7 0.0 8 0.5 9 0.5 10 0.5 11 0.5 12 0.0 13 0.0 14 1.0 15 1.0 16 0.0 17 0.0 18 0.5 19 2.0 20 2.0 21 1.5 22 2.0 23 2.0 24 2.5 25 3.5 26 6.0 27 8.0 28 11.0 29 22.5 30 28.0 31 27.0 32 37.5 33 48.0 34 61.5 35 74.0 36 95.5 37 135.0 38 150.0 39 160.5 40 205.5 41 235.5 42 254.5 43 282.0 44 286.0 45 264.5 46 236.5 47 225.5 48 211.5 49 188.0 50 164.0 51 130.0 52 91.0 53 78.5 54 73.0 55 51.5 56 35.0 57 27.5 58 21.5 59 14.5 60 10.5 61 8.5 62 6.0 63 2.5 64 1.5 65 1.5 66 1.0 67 0.5 68 0.5 69 0.0 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.25 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 85.8 #Duplication Level Percentage of deduplicated Percentage of total 1 86.39277389277389 74.125 2 11.247086247086246 19.3 3 2.0104895104895104 5.175 4 0.20396270396270394 0.7000000000000001 5 0.05827505827505827 0.25 6 0.08741258741258741 0.44999999999999996 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AATAATAACAGTATACGTGTACACATCTGGTTTCAGACCCCTACTTTCCA 6 0.15 No Hit AACCTTAGTTTTGAGCATGAATTTCATCTTCTGCTTCTCAAGCATGCGTT 6 0.15 No Hit CATGACTTCGATTAGAGTCTCCAAATTCTCTAAAGGAATCAAACCTTGAT 6 0.15 No Hit CCAATTACAAAAATCCAATCTTTTTACTCCCCCAGTTCTTATATGTGCCT 5 0.125 No Hit CGTTGACAAACTCTCTGTAGGCAGCAACAGGCCAAGAAAAACCTCTAAAG 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0125 0.0 0.0 0.0 0.0 54-55 0.037500000000000006 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.0625 0.0 0.0 0.0 0.0 64-65 0.0875 0.0 0.0 0.0 0.0 66-67 0.125 0.0 0.0 0.0 0.0 68-69 0.1875 0.0 0.0 0.0 0.0 70-71 0.2 0.0 0.0 0.0 0.0 72-73 0.21250000000000002 0.0 0.0 0.0 0.0 74-75 0.25 0.0 0.0 0.0 0.0 76-77 0.275 0.0 0.0 0.0 0.0 78-79 0.3375 0.0 0.0 0.0 0.0 80-81 0.45 0.0 0.0 0.0 0.0 82-83 0.6125 0.0 0.0 0.0 0.0 84-85 0.7875 0.0 0.0 0.0 0.0 86-87 1.025 0.0 0.0 0.0 0.0 88-89 1.2625000000000002 0.0 0.0 0.0 0.0 90-91 1.5375 0.0 0.0 0.0 0.0 92-93 1.7625 0.0 0.0 0.0 0.0 94-95 2.0375 0.0 0.0 0.0 0.0 96-97 2.5625 0.0 0.0 0.0 0.0 98-99 3.0250000000000004 0.0 0.0 0.0 0.0 100-101 3.7125 0.0 0.0 0.0 0.0 102-103 4.1375 0.0 0.0 0.0 0.0 104-105 4.875 0.0 0.0 0.0 0.0 106-107 5.6625 0.0 0.0 0.0 0.0 108-109 6.4625 0.0 0.0 0.0 0.0 110-111 7.0 0.0 0.0 0.0 0.0 112-113 7.862500000000001 0.0 0.0 0.0 0.0 114-115 8.5 0.0 0.0 0.0 0.0 116-117 9.025 0.0 0.0 0.0 0.0 118-119 9.600000000000001 0.0 0.0 0.0 0.0 120-121 10.350000000000001 0.0 0.0 0.0 0.0 122-123 10.7375 0.0 0.0 0.0 0.0 124-125 11.3625 0.0 0.0 0.0 0.0 126-127 12.2875 0.0 0.0 0.0 0.0 128-129 13.0625 0.0 0.0 0.0 0.0 130-131 13.8 0.0 0.0 0.0 0.0 132-133 14.55 0.0 0.0 0.0 0.0 134-135 15.3375 0.0 0.0 0.0 0.0 136-137 16.2 0.0 0.0 0.0 0.0 138-139 16.8875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGGGGGG 35 0.0035366106 20.714287 140-144 >>END_MODULE SRR12671356 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671356_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2315 37.0 37.0 37.0 37.0 37.0 2 36.0105 37.0 37.0 37.0 37.0 37.0 3 36.2725 37.0 37.0 37.0 37.0 37.0 4 36.123 37.0 37.0 37.0 37.0 37.0 5 36.292 37.0 37.0 37.0 37.0 37.0 6 36.226 37.0 37.0 37.0 37.0 37.0 7 36.262 37.0 37.0 37.0 37.0 37.0 8 36.239 37.0 37.0 37.0 37.0 37.0 9 36.347 37.0 37.0 37.0 37.0 37.0 10-14 36.259699999999995 37.0 37.0 37.0 37.0 37.0 15-19 36.242599999999996 37.0 37.0 37.0 37.0 37.0 20-24 36.2287 37.0 37.0 37.0 37.0 37.0 25-29 36.1965 37.0 37.0 37.0 37.0 37.0 30-34 36.137299999999996 37.0 37.0 37.0 37.0 37.0 35-39 36.1509 37.0 37.0 37.0 37.0 37.0 40-44 36.0225 37.0 37.0 37.0 37.0 37.0 45-49 36.0886 37.0 37.0 37.0 37.0 37.0 50-54 36.0111 37.0 37.0 37.0 37.0 37.0 55-59 36.050200000000004 37.0 37.0 37.0 37.0 37.0 60-64 36.031099999999995 37.0 37.0 37.0 37.0 37.0 65-69 35.9933 37.0 37.0 37.0 37.0 37.0 70-74 35.9286 37.0 37.0 37.0 37.0 37.0 75-79 35.89960000000001 37.0 37.0 37.0 37.0 37.0 80-84 35.858999999999995 37.0 37.0 37.0 37.0 37.0 85-89 35.887 37.0 37.0 37.0 37.0 37.0 90-94 35.8377 37.0 37.0 37.0 37.0 37.0 95-99 35.7933 37.0 37.0 37.0 37.0 37.0 100-104 35.6709 37.0 37.0 37.0 37.0 37.0 105-109 35.67100000000001 37.0 37.0 37.0 37.0 37.0 110-114 35.5781 37.0 37.0 37.0 37.0 37.0 115-119 35.6781 37.0 37.0 37.0 37.0 37.0 120-124 35.6111 37.0 37.0 37.0 37.0 37.0 125-129 35.430600000000005 37.0 37.0 37.0 37.0 37.0 130-134 35.3442 37.0 37.0 37.0 32.2 37.0 135-139 35.1993 37.0 37.0 37.0 32.2 37.0 140-144 35.11890000000001 37.0 37.0 37.0 29.8 37.0 145-149 34.881400000000006 37.0 37.0 37.0 25.0 37.0 150-151 34.445499999999996 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 1.0 15 1.0 16 0.0 17 0.0 18 1.0 19 2.0 20 1.0 21 6.0 22 3.0 23 3.0 24 6.0 25 7.0 26 12.0 27 14.0 28 20.0 29 25.0 30 33.0 31 50.0 32 70.0 33 121.0 34 238.0 35 573.0 36 2554.0 37 258.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.375 26.55 7.6 33.475 2 22.6 24.4 40.625 12.375 3 16.475 25.874999999999996 36.65 21.0 4 21.625 34.65 24.175 19.55 5 24.15 39.074999999999996 22.425 14.35 6 17.825 42.35 23.3 16.525000000000002 7 18.725 20.925 41.349999999999994 19.0 8 17.625 23.7 33.025 25.650000000000002 9 19.775000000000002 24.0 32.95 23.275000000000002 10-14 22.1 29.78 27.284999999999997 20.835 15-19 21.84 27.755000000000003 28.88 21.525 20-24 22.525000000000002 28.754999999999995 28.044999999999998 20.674999999999997 25-29 22.02 28.810000000000002 28.505000000000003 20.665 30-34 22.285 27.955000000000002 28.765 20.995 35-39 22.54 28.335 28.470000000000002 20.655 40-44 22.384999999999998 28.175 28.904999999999998 20.535 45-49 22.195 28.01 28.865000000000002 20.93 50-54 22.58 28.92 27.83 20.669999999999998 55-59 22.645 28.71 28.59 20.055 60-64 22.465 27.689999999999998 28.24 21.605 65-69 22.685 28.735 27.560000000000002 21.02 70-74 22.375 28.425 28.29 20.91 75-79 22.705000000000002 28.804999999999996 27.495000000000005 20.995 80-84 23.11 28.875 27.075 20.94 85-89 23.02 28.225 28.044999999999998 20.71 90-94 23.785 28.15 27.815 20.25 95-99 23.845 28.59 27.38 20.185 100-104 24.45 27.96 27.435 20.155 105-109 24.224999999999998 28.555000000000003 27.224999999999998 19.994999999999997 110-114 24.565 28.29 27.305 19.84 115-119 25.05 27.884999999999998 27.279999999999998 19.785 120-124 25.380000000000003 27.834999999999997 27.165 19.62 125-129 26.075 27.71 27.495000000000005 18.72 130-134 26.1 27.644999999999996 27.18 19.075 135-139 27.355 27.375 26.590000000000003 18.68 140-144 27.700000000000003 28.03 25.905 18.365000000000002 145-149 28.999999999999996 26.974999999999998 26.495 17.53 150-151 29.525000000000002 27.2625 25.887500000000003 17.325 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.5 12 0.5 13 0.5 14 0.5 15 0.0 16 0.0 17 0.5 18 1.0 19 2.5 20 2.5 21 1.5 22 2.0 23 4.0 24 6.5 25 5.0 26 7.5 27 11.5 28 10.5 29 13.0 30 21.0 31 29.0 32 41.5 33 48.5 34 63.5 35 92.0 36 116.0 37 134.0 38 147.0 39 187.0 40 207.5 41 220.0 42 256.5 43 272.5 44 285.0 45 275.0 46 245.0 47 227.5 48 204.0 49 177.0 50 150.5 51 120.0 52 89.0 53 68.0 54 56.0 55 44.5 56 38.5 57 33.5 58 22.5 59 12.5 60 12.0 61 10.0 62 8.0 63 5.5 64 1.5 65 0.5 66 0.0 67 0.0 68 0.5 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 86.275 #Duplication Level Percentage of deduplicated Percentage of total 1 86.90234714575486 74.97500000000001 2 10.866415531729935 18.75 3 1.883512025499855 4.875 4 0.17386264850767894 0.6 5 0.11590843233845263 0.5 6 0.057954216169226316 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTACTGGTGCTTTGGCTTTGAAAAAGATTCCAAAGAAACTTGTGGTCATT 6 0.15 No Hit GGCAAAAGATGCCCACAAAGTTTATTTATTGGCAAAGGAGAAGAGCAAGT 6 0.15 No Hit GGAAGATATTGTCAAGCTTGTTGATACCTTCCCTGGTCAATCTATCGATT 5 0.125 No Hit AAACTGATGTGGGTGGTACTGAATCTGTGCATTCTGGTGACATAATTGTT 5 0.125 No Hit AAAAGAATCCACCAAATTTTATATAGCACTTTGTTCTCTCTAAGGGTCTA 5 0.125 No Hit GCTGGATGGATTGGATGGGTTGGTAGGAGTTACTTGATTGCTATAAGTGA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0125 0.0 0.0 0.0 0.0 54-55 0.037500000000000006 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.0625 0.0 0.0 0.0 0.0 64-65 0.0875 0.0 0.0 0.0 0.0 66-67 0.125 0.0 0.0 0.0 0.0 68-69 0.1875 0.0 0.0 0.0 0.0 70-71 0.2 0.0 0.0 0.0 0.0 72-73 0.21250000000000002 0.0 0.0 0.0 0.0 74-75 0.25 0.0 0.0 0.0 0.0 76-77 0.275 0.0 0.0 0.0 0.0 78-79 0.3375 0.0 0.0 0.0 0.0 80-81 0.45 0.0 0.0 0.0 0.0 82-83 0.6125 0.0 0.0 0.0 0.0 84-85 0.7875 0.0 0.0 0.0 0.0 86-87 1.025 0.0 0.0 0.0 0.0 88-89 1.275 0.0 0.0 0.0 0.0 90-91 1.5625 0.0 0.0 0.0 0.0 92-93 1.7875 0.0 0.0 0.0 0.0 94-95 2.05 0.0 0.0 0.0 0.0 96-97 2.5625 0.0 0.0 0.0 0.0 98-99 3.0250000000000004 0.0 0.0 0.0 0.0 100-101 3.725 0.0 0.0 0.0 0.0 102-103 4.1375 0.0 0.0 0.0 0.0 104-105 4.875 0.0 0.0 0.0 0.0 106-107 5.6625 0.0 0.0 0.0 0.0 108-109 6.5 0.0 0.0 0.0 0.0 110-111 7.05 0.0 0.0 0.0 0.0 112-113 7.9125 0.0 0.0 0.0 0.0 114-115 8.537500000000001 0.0 0.0 0.0 0.0 116-117 9.0625 0.0 0.0 0.0 0.0 118-119 9.649999999999999 0.0 0.0 0.0 0.0 120-121 10.4125 0.0 0.0 0.0 0.0 122-123 10.825 0.0 0.0 0.0 0.0 124-125 11.4375 0.0 0.0 0.0 0.0 126-127 12.3125 0.0 0.0 0.0 0.0 128-129 13.0875 0.0 0.0 0.0 0.0 130-131 13.850000000000001 0.0 0.0 0.0 0.0 132-133 14.65 0.0 0.0 0.0 0.0 134-135 15.4375 0.0 0.0 0.0 0.0 136-137 16.3 0.0 0.0 0.0 0.0 138-139 16.9875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TAAATGT 10 0.006830828 145.0 3 CAAAGTC 10 0.006830828 145.0 3 TCTCATT 10 0.006830828 145.0 4 >>END_MODULE Read 672416 spots for SRR12671356.sra Written 672416 spots for SRR12671356.sra Read 672416 spots for SRR12671356.sra Written 672416 spots for SRR12671356.sra Read 672416 spots for SRR12671356.sra Written 672416 spots for SRR12671356.sra Read 672416 spots for SRR12671356.sra Written 672416 spots for SRR12671356.sra Read 672416 spots for SRR12671356.sra Written 672416 spots for SRR12671356.sra Read 672416 spots for SRR12671356.sra Written 672416 spots for SRR12671356.sra Read 672416 spots for SRR12671356.sra Written 672416 spots for SRR12671356.sra Read 672416 spots for SRR12671356.sra Written 672416 spots for SRR12671356.sra Read 672416 spots for SRR12671356.sra Written 672416 spots for SRR12671356.sra Read 672416 spots for SRR12671356.sra Written 672416 spots for SRR12671356.sra Read 672416 spots for SRR12671356.sra Written 672416 spots for SRR12671356.sra Read 672416 spots for SRR12671356.sra Written 672416 spots for SRR12671356.sra Read 672416 spots for SRR12671356.sra Written 672416 spots for SRR12671356.sra Read 672416 spots for SRR12671356.sra Written 672416 spots for SRR12671356.sra Read 672416 spots for SRR12671356.sra Written 672416 spots for SRR12671356.sra Read 672416 spots for SRR12671356.sra Written 672416 spots for SRR12671356.sra Read 672416 spots for SRR12671356.sra Written 672416 spots for SRR12671356.sra Read 672432 spots for SRR12671356.sra Written 672432 spots for SRR12671356.sra Read 672416 spots for SRR12671356.sra Written 672416 spots for SRR12671356.sra Read 672416 spots for SRR12671356.sra Written 672416 spots for SRR12671356.sra SRR ids: ['SRR12671356.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_8ca8zh7e SRR12671356.sra spots: 13448336 blocks: [[1, 672416], [672417, 1344832], [1344833, 2017248], [2017249, 2689664], [2689665, 3362080], [3362081, 4034496], [4034497, 4706912], [4706913, 5379328], [5379329, 6051744], [6051745, 6724160], [6724161, 7396576], [7396577, 8068992], [8068993, 8741408], [8741409, 9413824], [9413825, 10086240], [10086241, 10758656], [10758657, 11431072], [11431073, 12103488], [12103489, 12775904], [12775905, 13448336]] SRR12671356 file size 4548632 SRR12671356 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671356 SRR12671356_1.fastq SRR12671356_2.fastq Input file: SRR12671356_1.fastq Paired file: SRR12671356_2.fastq trimmed: SRR12671356-trimmed-pair1.fastq, SRR12671356-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 18:53:22 2025 >> started Tue Feb 11 18:53:44 2025 >> done (22.200s) 13448336 read pairs processed; of these: 62 ( 0.00%) short read pairs filtered out after trimming by size control 1400 ( 0.01%) empty read pairs filtered out after trimming by size control 13446874 (99.99%) read pairs available; of these: 2663595 (19.81%) trimmed read pairs available after processing 10783279 (80.19%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 9 0.00% 20 5 0.00% 21 2 0.00% 22 4 0.00% 23 6 0.00% 24 8 0.00% 25 7 0.00% 26 5 0.00% 27 17 0.00% 28 20 0.00% 29 18 0.00% 30 15 0.00% 31 14 0.00% 32 23 0.00% 33 35 0.00% 34 32 0.00% 35 28 0.00% 36 38 0.00% 37 54 0.00% 38 49 0.00% 39 77 0.00% 40 59 0.00% 41 62 0.00% 42 79 0.00% 43 88 0.00% 44 106 0.00% 45 121 0.00% 46 100 0.00% 47 127 0.00% 48 172 0.00% 49 197 0.00% 50 244 0.00% 51 287 0.00% 52 325 0.00% 53 316 0.00% 54 333 0.00% 55 415 0.00% 56 478 0.00% 57 503 0.00% 58 703 0.01% 59 765 0.01% 60 853 0.01% 61 1085 0.01% 62 1187 0.01% 63 1404 0.01% 64 1480 0.01% 65 1713 0.01% 66 1802 0.01% 67 2156 0.02% 68 2411 0.02% 69 2739 0.02% 70 3209 0.02% 71 3619 0.03% 72 4061 0.03% 73 4856 0.04% 74 5275 0.04% 75 5839 0.04% 76 6490 0.05% 77 6865 0.05% 78 7712 0.06% 79 8407 0.06% 80 9270 0.07% 81 10338 0.08% 82 11493 0.09% 83 12228 0.09% 84 13534 0.10% 85 14809 0.11% 86 15451 0.11% 87 16358 0.12% 88 17435 0.13% 89 18404 0.14% 90 19176 0.14% 91 20142 0.15% 92 21419 0.16% 93 22799 0.17% 94 23881 0.18% 95 25432 0.19% 96 26571 0.20% 97 27322 0.20% 98 27996 0.21% 99 28874 0.21% 100 29823 0.22% 101 30447 0.23% 102 31876 0.24% 103 32269 0.24% 104 33549 0.25% 105 34324 0.26% 106 35381 0.26% 107 36354 0.27% 108 36760 0.27% 109 37018 0.28% 110 37746 0.28% 111 38387 0.29% 112 39153 0.29% 113 39389 0.29% 114 39659 0.29% 115 41144 0.31% 116 41559 0.31% 117 42128 0.31% 118 42947 0.32% 119 42840 0.32% 120 44053 0.33% 121 44144 0.33% 122 44630 0.33% 123 44470 0.33% 124 44936 0.33% 125 44964 0.33% 126 46141 0.34% 127 46091 0.34% 128 45996 0.34% 129 46906 0.35% 130 46948 0.35% 131 46933 0.35% 132 47192 0.35% 133 46998 0.35% 134 46916 0.35% 135 47632 0.35% 136 47395 0.35% 137 47356 0.35% 138 47560 0.35% 139 48543 0.36% 140 48202 0.36% 141 48592 0.36% 142 48039 0.36% 143 48180 0.36% 144 48295 0.36% 145 48588 0.36% 146 48102 0.36% 147 48561 0.36% 148 49028 0.36% 149 48249 0.36% 150 49157 0.37% 151 10783279 80.19% 13446874 reads passed initial QC criterion=sequence-density sequence-density=0.32 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=25 prefix-density=0.32 prefix-fanout=2.0 sequence=TTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGG criterion=fanout-score sequence-density=0.04 sequence-density-rank=25 fanout-score=16.71 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=2.5 sequence=ACACCCACAAGCCTAGAAAAGGAATTAGAATTTGTAAGTGCAGCTTCCATCATCACTCCTTGCAGTTGGATCAAAGTTTGCTGCATTTGGATCAGTACAGCCTTCAGCGACAGGCACCTTTACTTGCTGTGCCGCTTGGCC criterion=sequence-density sequence-density=0.42 sequence-density-rank=1 fanout-score=1.95 fanout-score-rank=34 prefix-density=0.41 prefix-fanout=2.0 sequence=CCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAA criterion=fanout-score sequence-density=0.07 sequence-density-rank=30 fanout-score=28.26 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=8.6 sequence=AAGGCCAAGATCCAGGACAAGGAGGG SRR12671356 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 19:15:12 Started mapping on | Feb 11 19:15:12 Finished on | Feb 11 19:17:31 Mapping speed, Million of reads per hour | 348.26 Number of input reads | 13446874 Average input read length | 289 UNIQUE READS: Uniquely mapped reads number | 12618385 Uniquely mapped reads % | 93.84% Average mapped length | 287.88 Number of splices: Total | 11792634 Number of splices: Annotated (sjdb) | 11514794 Number of splices: GT/AG | 11554946 Number of splices: GC/AG | 188296 Number of splices: AT/AC | 7282 Number of splices: Non-canonical | 42110 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 2.97 Insertion rate per base | 0.03% Insertion average length | 2.16 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 364866 % of reads mapped to multiple loci | 2.71% Number of reads mapped to too many loci | 33234 % of reads mapped to too many loci | 0.25% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.07% % of reads unmapped: other | 0.13% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 463623 463623 463623 N_multimapping 364866 364866 364866 N_noFeature 549717 12441489 628553 N_ambiguous 185006 841 86542 UnstrandedReadsAssigned:11883662 PositiveStrandReadsAssigned:176055 NegativeStrandReadsAssigned:11903290 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671356 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671356-trimmed-pair1.fastq SRR12671356-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,446,874 reads, 11,951,714 reads pseudoaligned [quant] estimated average fragment length: 248.852 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,217 rounds 52401 SRR12671356.ke.tsv 34699 SRR12671356.se.tsv 87100 total ==> SRR12671356.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1770.15 570 29.9611 Potri.005G024800.1.v4.1 1035 787.148 260 30.7334 Potri.004G059700.1.v4.1 961 713.539 3 0.391198 Potri.007G009000.2.v4.1 1416 1168.15 0 0 Potri.003G141000.2.v4.1 2943 2695.15 691.444 23.8708 Potri.016G087400.1.v4.1 270 104.343 770 686.628 Potri.015G069301.1.v4.1 564 337.895 0 0 Potri.010G195200.1.v4.1 1773 1525.15 95 5.79568 Potri.012G127500.1.v4.1 977 729.395 167 21.3033 ==> SRR12671356.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 487 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 173 Potri.001G212900.v4.1 4 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 39 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 8 SRR12671356 completed mapping pipeline successfully