Starting /dee2/code/volunteer_pipeline.sh SRR12671357 current disk space = 3053436674048 free memory = 1461686252 SRR12671357 SRAfilesize 5cd683f147381c7f182a67f7b5c780d1 SRR12671357.sra SRR12671357.sra file validated SRR12671357 is paired end SRR12671357 is conventional basespace SRR12671357 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671357_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5645 37.0 37.0 37.0 37.0 37.0 2 36.35325 37.0 37.0 37.0 37.0 37.0 3 36.5065 37.0 37.0 37.0 37.0 37.0 4 36.5665 37.0 37.0 37.0 37.0 37.0 5 36.587 37.0 37.0 37.0 37.0 37.0 6 36.54 37.0 37.0 37.0 37.0 37.0 7 36.524 37.0 37.0 37.0 37.0 37.0 8 36.546 37.0 37.0 37.0 37.0 37.0 9 36.68 37.0 37.0 37.0 37.0 37.0 10-14 36.58560000000001 37.0 37.0 37.0 37.0 37.0 15-19 36.61 37.0 37.0 37.0 37.0 37.0 20-24 36.579899999999995 37.0 37.0 37.0 37.0 37.0 25-29 36.4881 37.0 37.0 37.0 37.0 37.0 30-34 36.4211 37.0 37.0 37.0 37.0 37.0 35-39 36.4474 37.0 37.0 37.0 37.0 37.0 40-44 36.3563 37.0 37.0 37.0 37.0 37.0 45-49 36.2747 37.0 37.0 37.0 37.0 37.0 50-54 36.2769 37.0 37.0 37.0 37.0 37.0 55-59 36.265100000000004 37.0 37.0 37.0 37.0 37.0 60-64 36.205799999999996 37.0 37.0 37.0 37.0 37.0 65-69 36.219800000000006 37.0 37.0 37.0 37.0 37.0 70-74 36.1742 37.0 37.0 37.0 37.0 37.0 75-79 36.1648 37.0 37.0 37.0 37.0 37.0 80-84 36.2023 37.0 37.0 37.0 37.0 37.0 85-89 36.080200000000005 37.0 37.0 37.0 37.0 37.0 90-94 36.086 37.0 37.0 37.0 37.0 37.0 95-99 36.0823 37.0 37.0 37.0 37.0 37.0 100-104 36.0535 37.0 37.0 37.0 37.0 37.0 105-109 36.05 37.0 37.0 37.0 37.0 37.0 110-114 35.9263 37.0 37.0 37.0 37.0 37.0 115-119 35.9302 37.0 37.0 37.0 37.0 37.0 120-124 35.8722 37.0 37.0 37.0 37.0 37.0 125-129 35.8894 37.0 37.0 37.0 37.0 37.0 130-134 35.872299999999996 37.0 37.0 37.0 37.0 37.0 135-139 35.877300000000005 37.0 37.0 37.0 37.0 37.0 140-144 35.769800000000004 37.0 37.0 37.0 37.0 37.0 145-149 35.712300000000006 37.0 37.0 37.0 37.0 37.0 150-151 35.695 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 3.0 20 0.0 21 4.0 22 6.0 23 6.0 24 11.0 25 8.0 26 3.0 27 5.0 28 7.0 29 12.0 30 31.0 31 38.0 32 51.0 33 86.0 34 118.0 35 290.0 36 2867.0 37 454.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 56.55 13.950000000000001 6.65 22.85 2 22.865013774104685 12.972702228900577 36.78938141748059 27.372902579514154 3 18.175 25.25 33.475 23.1 4 20.225 29.5 28.9 21.375 5 21.95 36.65 21.975 19.425 6 19.675 37.65 23.65 19.025 7 14.35 24.25 44.35 17.05 8 16.05 22.625 33.275 28.050000000000004 9 18.675 22.35 31.724999999999998 27.250000000000004 10-14 19.99 28.42 27.700000000000003 23.89 15-19 20.05 28.035 28.115000000000002 23.799999999999997 20-24 20.11 28.189999999999998 27.779999999999998 23.919999999999998 25-29 20.06 28.22 27.705000000000002 24.015 30-34 19.634999999999998 28.77 27.62 23.974999999999998 35-39 20.055 28.494999999999997 28.105000000000004 23.345 40-44 20.285 28.345 27.99 23.380000000000003 45-49 20.265 29.060000000000002 27.12 23.555 50-54 19.919999999999998 28.804999999999996 27.860000000000003 23.415 55-59 19.615 28.799999999999997 27.375 24.21 60-64 20.255000000000003 27.97 28.144999999999996 23.630000000000003 65-69 20.165 28.675 27.43 23.73 70-74 20.575 27.74 27.96 23.724999999999998 75-79 20.275000000000002 29.294999999999998 26.435 23.995 80-84 20.435 28.08 27.589999999999996 23.895 85-89 20.165 28.42 27.415 24.0 90-94 20.595 28.544999999999998 27.255000000000003 23.605 95-99 20.285 28.365000000000002 27.905 23.445 100-104 20.65 28.83 26.790000000000003 23.73 105-109 20.330000000000002 27.68 28.17 23.82 110-114 20.87 27.839999999999996 27.400000000000002 23.89 115-119 21.029999999999998 28.689999999999998 26.490000000000002 23.79 120-124 20.974999999999998 28.249999999999996 27.065 23.71 125-129 20.665 28.22 27.339999999999996 23.775 130-134 21.21 28.175 27.0 23.615 135-139 20.575 28.694999999999997 26.96 23.77 140-144 21.465 27.38 27.355 23.799999999999997 145-149 21.68 28.139999999999997 26.884999999999998 23.294999999999998 150-151 21.837500000000002 28.487499999999997 25.974999999999998 23.7 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 7.0 1 5.5 2 2.0 3 1.0 4 2.0 5 2.0 6 2.0 7 1.0 8 2.5 9 3.0 10 1.5 11 1.0 12 1.0 13 1.5 14 0.5 15 0.5 16 2.5 17 4.0 18 4.0 19 2.5 20 2.5 21 3.0 22 3.5 23 5.0 24 5.0 25 7.0 26 9.5 27 14.0 28 16.5 29 15.5 30 20.5 31 28.0 32 32.5 33 33.0 34 37.5 35 63.0 36 85.5 37 100.0 38 114.5 39 139.5 40 176.0 41 202.0 42 215.0 43 235.0 44 251.0 45 249.5 46 244.0 47 240.0 48 238.0 49 215.0 50 191.0 51 165.5 52 131.5 53 109.0 54 85.0 55 68.5 56 52.5 57 39.5 58 34.0 59 25.5 60 19.5 61 9.5 62 4.5 63 3.5 64 3.0 65 3.5 66 2.5 67 1.5 68 2.0 69 1.5 70 0.5 71 0.0 72 1.0 73 1.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.17500000000000002 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 85.175 #Duplication Level Percentage of deduplicated Percentage of total 1 86.3222776636337 73.52499999999999 2 11.006750807161726 18.75 3 1.9665394775462284 5.025 4 0.49897270325799825 1.7000000000000002 5 0.146756677428823 0.625 6 0.0293513354857646 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0293513354857646 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 9 0.22499999999999998 No Hit GTGGAGGTATGCGAGTGCACTGGCTGTCTCTATAGCAATGCTCAACCGAA 6 0.15 No Hit GATACTTGGAAGGTCGCCATTTTGGCATCCCATTGAAGAACGTATAATGC 5 0.125 No Hit GCCCGATTCAGCATCCGAATCCAGAAGCTAAAAACAAAAACAAAGTAGAA 5 0.125 No Hit GTCGAATCCAATGATACGGATAAAGGAGTTAGGGTAAGCTTTCTTCGCCT 5 0.125 No Hit GGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGA 5 0.125 No Hit GGCCACACCTGCATGCATTGAACTCGTCCACCATTGCTTGCAATGGAAGT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.037500000000000006 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.0625 0.0 0.0 0.0 0.0 48-49 0.075 0.0 0.0 0.0 0.0 50-51 0.075 0.0 0.0 0.0 0.0 52-53 0.0875 0.0 0.0 0.0 0.0 54-55 0.1125 0.0 0.0 0.0 0.0 56-57 0.125 0.0 0.0 0.0 0.0 58-59 0.125 0.0 0.0 0.0 0.0 60-61 0.125 0.0 0.0 0.0 0.0 62-63 0.125 0.0 0.0 0.0 0.0 64-65 0.125 0.0 0.0 0.0 0.0 66-67 0.125 0.0 0.0 0.0 0.0 68-69 0.15 0.0 0.0 0.0 0.0 70-71 0.15 0.0 0.0 0.0 0.0 72-73 0.16249999999999998 0.0 0.0 0.0 0.0 74-75 0.1875 0.0 0.0 0.0 0.0 76-77 0.2 0.0 0.0 0.0 0.0 78-79 0.225 0.0 0.0 0.0 0.0 80-81 0.2375 0.0 0.0 0.0 0.0 82-83 0.32499999999999996 0.0 0.0 0.0 0.0 84-85 0.425 0.0 0.0 0.0 0.0 86-87 0.45 0.0 0.0 0.0 0.0 88-89 0.5375000000000001 0.0 0.0 0.0 0.0 90-91 0.55 0.0 0.0 0.0 0.0 92-93 0.5875 0.0 0.0 0.0 0.0 94-95 0.7 0.0 0.0 0.0 0.0 96-97 0.75 0.0 0.0 0.0 0.0 98-99 0.8375 0.0 0.0 0.0 0.0 100-101 0.9 0.0 0.0 0.0 0.0 102-103 1.05 0.0 0.0 0.0 0.0 104-105 1.125 0.0 0.0 0.0 0.0 106-107 1.2375 0.0 0.0 0.0 0.0 108-109 1.375 0.0 0.0 0.0 0.0 110-111 1.475 0.0 0.0 0.0 0.0 112-113 1.55 0.0 0.0 0.0 0.0 114-115 1.8125 0.0 0.0 0.0 0.0 116-117 2.0625 0.0 0.0 0.0 0.0 118-119 2.1624999999999996 0.0 0.0 0.0 0.0 120-121 2.3499999999999996 0.0 0.0 0.0 0.0 122-123 2.5875 0.0 0.0 0.0 0.0 124-125 2.725 0.0 0.0 0.0 0.0 126-127 2.9375 0.0 0.0 0.0 0.0 128-129 3.1125 0.0 0.0 0.0 0.0 130-131 3.2625 0.0 0.0 0.0 0.0 132-133 3.5 0.0 0.0 0.0 0.0 134-135 3.7 0.0 0.0 0.0 0.0 136-137 4.1875 0.0 0.0 0.0 0.0 138-139 4.6 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12671357 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671357_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.014 37.0 37.0 37.0 37.0 37.0 2 35.7795 37.0 37.0 37.0 37.0 37.0 3 35.992 37.0 37.0 37.0 37.0 37.0 4 35.952 37.0 37.0 37.0 37.0 37.0 5 35.956 37.0 37.0 37.0 37.0 37.0 6 35.961 37.0 37.0 37.0 37.0 37.0 7 35.9725 37.0 37.0 37.0 37.0 37.0 8 35.91 37.0 37.0 37.0 37.0 37.0 9 35.9935 37.0 37.0 37.0 37.0 37.0 10-14 35.923 37.0 37.0 37.0 37.0 37.0 15-19 35.8575 37.0 37.0 37.0 37.0 37.0 20-24 35.7181 37.0 37.0 37.0 37.0 37.0 25-29 35.70100000000001 37.0 37.0 37.0 37.0 37.0 30-34 35.636 37.0 37.0 37.0 37.0 37.0 35-39 35.586299999999994 37.0 37.0 37.0 37.0 37.0 40-44 35.6023 37.0 37.0 37.0 37.0 37.0 45-49 35.524800000000006 37.0 37.0 37.0 37.0 37.0 50-54 35.5084 37.0 37.0 37.0 37.0 37.0 55-59 35.4885 37.0 37.0 37.0 37.0 37.0 60-64 35.454100000000004 37.0 37.0 37.0 37.0 37.0 65-69 35.491699999999994 37.0 37.0 37.0 37.0 37.0 70-74 35.3678 37.0 37.0 37.0 37.0 37.0 75-79 35.3667 37.0 37.0 37.0 37.0 37.0 80-84 35.3036 37.0 37.0 37.0 37.0 37.0 85-89 35.37330000000001 37.0 37.0 37.0 37.0 37.0 90-94 35.3241 37.0 37.0 37.0 37.0 37.0 95-99 35.3181 37.0 37.0 37.0 37.0 37.0 100-104 35.1853 37.0 37.0 37.0 34.6 37.0 105-109 35.158699999999996 37.0 37.0 37.0 32.2 37.0 110-114 35.1572 37.0 37.0 37.0 29.8 37.0 115-119 35.219100000000005 37.0 37.0 37.0 37.0 37.0 120-124 35.1288 37.0 37.0 37.0 27.4 37.0 125-129 35.066700000000004 37.0 37.0 37.0 25.0 37.0 130-134 35.0125 37.0 37.0 37.0 25.0 37.0 135-139 34.950900000000004 37.0 37.0 37.0 27.4 37.0 140-144 34.958800000000004 37.0 37.0 37.0 25.0 37.0 145-149 34.8946 37.0 37.0 37.0 25.0 37.0 150-151 34.70325 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 8.0 13 10.0 14 14.0 15 7.0 16 7.0 17 10.0 18 8.0 19 5.0 20 1.0 21 6.0 22 16.0 23 10.0 24 9.0 25 13.0 26 10.0 27 12.0 28 18.0 29 30.0 30 23.0 31 70.0 32 50.0 33 129.0 34 216.0 35 555.0 36 2543.0 37 219.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 59.35 18.075 7.7 14.875 2 29.25 18.35 31.3 21.099999999999998 3 23.3 22.7 37.1 16.900000000000002 4 25.45 31.574999999999996 24.099999999999998 18.875 5 25.374999999999996 38.550000000000004 19.825 16.25 6 23.275000000000002 37.65 21.2 17.875 7 22.375 22.6 35.725 19.3 8 21.025 23.175 29.925 25.874999999999996 9 24.025 23.125 26.625 26.224999999999998 10-14 25.25 26.674999999999997 27.025 21.05 15-19 24.27 27.355 27.245 21.13 20-24 23.66 27.82 27.725 20.794999999999998 25-29 24.055 27.375 27.779999999999998 20.79 30-34 23.86 27.839999999999996 27.05 21.25 35-39 23.265 28.38 27.255000000000003 21.099999999999998 40-44 23.39 28.599999999999998 26.974999999999998 21.035 45-49 23.765 27.6 27.384999999999998 21.25 50-54 23.59 27.515 28.139999999999997 20.755000000000003 55-59 24.29 26.529999999999998 27.825 21.355 60-64 23.765 27.189999999999998 28.01 21.035 65-69 24.6 27.0 27.13 21.27 70-74 23.945 26.834999999999997 27.375 21.845 75-79 23.23 27.71 27.655 21.404999999999998 80-84 24.02 27.55 26.5 21.93 85-89 24.715 27.565 26.665 21.055 90-94 24.044999999999998 27.37 27.815 20.77 95-99 24.37 28.34 26.884999999999998 20.405 100-104 24.474999999999998 27.689999999999998 26.900000000000002 20.935000000000002 105-109 23.655 27.860000000000003 27.13 21.355 110-114 23.169999999999998 28.255000000000003 27.474999999999998 21.099999999999998 115-119 24.740000000000002 28.28 27.089999999999996 19.89 120-124 25.395 27.145000000000003 27.105 20.355 125-129 24.175 28.025 26.979999999999997 20.82 130-134 25.47 27.68 26.955000000000002 19.895 135-139 24.67 27.24 27.455000000000002 20.635 140-144 25.19 27.22 27.425 20.165 145-149 25.38007601520304 28.300660132026405 26.400280056011205 19.918983796759353 150-151 25.6125 28.4375 26.2875 19.662499999999998 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 1.5 2 2.0 3 1.0 4 0.0 5 1.0 6 1.5 7 0.5 8 0.0 9 0.0 10 0.0 11 1.0 12 1.0 13 1.0 14 1.5 15 1.5 16 1.5 17 0.5 18 0.0 19 0.5 20 2.0 21 2.0 22 3.0 23 3.5 24 1.5 25 3.0 26 4.0 27 4.5 28 5.5 29 9.0 30 16.0 31 20.5 32 22.5 33 41.5 34 52.0 35 57.5 36 74.5 37 99.0 38 110.0 39 117.0 40 162.5 41 201.5 42 226.5 43 232.5 44 244.5 45 262.5 46 258.0 47 245.5 48 235.0 49 211.5 50 191.0 51 164.5 52 117.0 53 114.0 54 108.5 55 78.5 56 64.0 57 47.0 58 28.0 59 25.0 60 21.5 61 11.0 62 9.0 63 6.5 64 4.0 65 3.5 66 1.0 67 2.0 68 2.5 69 1.0 70 1.0 71 0.5 72 1.0 73 3.0 74 2.5 75 2.5 76 2.0 77 0.0 78 0.0 79 0.0 80 0.5 81 1.0 82 0.5 83 0.5 84 0.5 85 1.0 86 2.0 87 2.5 88 2.0 89 1.5 90 1.5 91 1.0 92 0.5 93 1.0 94 2.0 95 2.5 96 1.5 97 0.0 98 1.0 99 3.5 100 9.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.02 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 85.15 #Duplication Level Percentage of deduplicated Percentage of total 1 86.81738109219025 73.925 2 10.569583088667057 18.0 3 1.9671168526130358 5.025 4 0.49911920140927774 1.7000000000000002 5 0.05871990604815032 0.25 6 0.0 0.0 7 0.0 0.0 8 0.05871990604815032 0.4 9 0.0 0.0 >10 0.02935995302407516 0.7000000000000001 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 28 0.7000000000000001 No Hit GGGTAAACCTATTTGCATTTGTCATGATCAGCTCTGTCCTGGTAACTCGA 8 0.2 No Hit AACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAA 8 0.2 No Hit GTTCAATGCATGCAGGTGTGGCCACCAACTGGATTGAAGAAGTTCGAGAC 5 0.125 No Hit GATTTTGATGATCTCTTGGAGTCTGCACTCAAAACATACCAGAACTATTT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.037500000000000006 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.0625 0.0 0.0 0.0 0.0 48-49 0.075 0.0 0.0 0.0 0.0 50-51 0.075 0.0 0.0 0.0 0.0 52-53 0.0875 0.0 0.0 0.0 0.0 54-55 0.1125 0.0 0.0 0.0 0.0 56-57 0.125 0.0 0.0 0.0 0.0 58-59 0.125 0.0 0.0 0.0 0.0 60-61 0.125 0.0 0.0 0.0 0.0 62-63 0.125 0.0 0.0 0.0 0.0 64-65 0.125 0.0 0.0 0.0 0.0 66-67 0.125 0.0 0.0 0.0 0.0 68-69 0.15 0.0 0.0 0.0 0.0 70-71 0.15 0.0 0.0 0.0 0.0 72-73 0.16249999999999998 0.0 0.0 0.0 0.0 74-75 0.1875 0.0 0.0 0.0 0.0 76-77 0.2 0.0 0.0 0.0 0.0 78-79 0.225 0.0 0.0 0.0 0.0 80-81 0.2375 0.0 0.0 0.0 0.0 82-83 0.32499999999999996 0.0 0.0 0.0 0.0 84-85 0.425 0.0 0.0 0.0 0.0 86-87 0.45 0.0 0.0 0.0 0.0 88-89 0.5375000000000001 0.0 0.0 0.0 0.0 90-91 0.55 0.0 0.0 0.0 0.0 92-93 0.5875 0.0 0.0 0.0 0.0 94-95 0.7 0.0 0.0 0.0 0.0 96-97 0.75 0.0 0.0 0.0 0.0 98-99 0.8375 0.0 0.0 0.0 0.0 100-101 0.9 0.0 0.0 0.0 0.0 102-103 1.05 0.0 0.0 0.0 0.0 104-105 1.125 0.0 0.0 0.0 0.0 106-107 1.2375 0.0 0.0 0.0 0.0 108-109 1.375 0.0 0.0 0.0 0.0 110-111 1.475 0.0 0.0 0.0 0.0 112-113 1.55 0.0 0.0 0.0 0.0 114-115 1.7875 0.0 0.0 0.0 0.0 116-117 2.0375 0.0 0.0 0.0 0.0 118-119 2.1375 0.0 0.0 0.0 0.0 120-121 2.325 0.0 0.0 0.0 0.0 122-123 2.5625 0.0 0.0 0.0 0.0 124-125 2.7125 0.0 0.0 0.0 0.0 126-127 2.9375 0.0 0.0 0.0 0.0 128-129 3.1125 0.0 0.0 0.0 0.0 130-131 3.2625 0.0 0.0 0.0 0.0 132-133 3.5 0.0 0.0 0.0 0.0 134-135 3.7 0.0 0.0 0.0 0.0 136-137 4.1875 0.0 0.0 0.0 0.0 138-139 4.625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGTCAAC 10 0.006830828 145.0 1 GCAAGGA 10 0.006830828 145.0 1 CAACCGC 10 0.006830828 145.0 4 GTCAACC 10 0.006830828 145.0 2 TCAACCG 10 0.006830828 145.0 3 >>END_MODULE Read 897651 spots for SRR12671357.sra Written 897651 spots for SRR12671357.sra Read 897651 spots for SRR12671357.sra Written 897651 spots for SRR12671357.sra Read 897651 spots for SRR12671357.sra Written 897651 spots for SRR12671357.sra Read 897651 spots for SRR12671357.sra Written 897651 spots for SRR12671357.sra Read 897651 spots for SRR12671357.sra Written 897651 spots for SRR12671357.sra Read 897651 spots for SRR12671357.sra Written 897651 spots for SRR12671357.sra Read 897651 spots for SRR12671357.sra Written 897651 spots for SRR12671357.sra Read 897651 spots for SRR12671357.sra Written 897651 spots for SRR12671357.sra Read 897651 spots for SRR12671357.sra Written 897651 spots for SRR12671357.sra Read 897651 spots for SRR12671357.sra Written 897651 spots for SRR12671357.sra Read 897651 spots for SRR12671357.sra Written 897651 spots for SRR12671357.sra Read 897651 spots for SRR12671357.sra Written 897651 spots for SRR12671357.sra Read 897660 spots for SRR12671357.sra Written 897660 spots for SRR12671357.sra Read 897651 spots for SRR12671357.sra Written 897651 spots for SRR12671357.sra Read 897651 spots for SRR12671357.sra Written 897651 spots for SRR12671357.sra Read 897651 spots for SRR12671357.sra Written 897651 spots for SRR12671357.sra Read 897651 spots for SRR12671357.sra Written 897651 spots for SRR12671357.sra Read 897651 spots for SRR12671357.sra Written 897651 spots for SRR12671357.sra Read 897651 spots for SRR12671357.sra Written 897651 spots for SRR12671357.sra Read 897651 spots for SRR12671357.sra Written 897651 spots for SRR12671357.sra SRR ids: ['SRR12671357.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_nwlbem1e SRR12671357.sra spots: 17953029 blocks: [[1, 897651], [897652, 1795302], [1795303, 2692953], [2692954, 3590604], [3590605, 4488255], [4488256, 5385906], [5385907, 6283557], [6283558, 7181208], [7181209, 8078859], [8078860, 8976510], [8976511, 9874161], [9874162, 10771812], [10771813, 11669463], [11669464, 12567114], [12567115, 13464765], [13464766, 14362416], [14362417, 15260067], [15260068, 16157718], [16157719, 17055369], [17055370, 17953029]] SRR12671357 file size 6079524 SRR12671357 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671357 SRR12671357_1.fastq SRR12671357_2.fastq Input file: SRR12671357_1.fastq Paired file: SRR12671357_2.fastq trimmed: SRR12671357-trimmed-pair1.fastq, SRR12671357-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 18:49:28 2025 >> started Tue Feb 11 18:49:49 2025 >> done (20.926s) 17953029 read pairs processed; of these: 545 ( 0.00%) short read pairs filtered out after trimming by size control 39744 ( 0.22%) empty read pairs filtered out after trimming by size control 17912740 (99.78%) read pairs available; of these: 1259778 ( 7.03%) trimmed read pairs available after processing 16652962 (92.97%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 52 0.00% 19 75 0.00% 20 66 0.00% 21 97 0.00% 22 123 0.00% 23 130 0.00% 24 165 0.00% 25 192 0.00% 26 225 0.00% 27 151 0.00% 28 194 0.00% 29 173 0.00% 30 187 0.00% 31 146 0.00% 32 143 0.00% 33 145 0.00% 34 137 0.00% 35 137 0.00% 36 136 0.00% 37 153 0.00% 38 146 0.00% 39 147 0.00% 40 91 0.00% 41 156 0.00% 42 143 0.00% 43 129 0.00% 44 151 0.00% 45 162 0.00% 46 161 0.00% 47 172 0.00% 48 147 0.00% 49 167 0.00% 50 190 0.00% 51 177 0.00% 52 222 0.00% 53 231 0.00% 54 233 0.00% 55 240 0.00% 56 303 0.00% 57 287 0.00% 58 379 0.00% 59 416 0.00% 60 425 0.00% 61 550 0.00% 62 619 0.00% 63 657 0.00% 64 681 0.00% 65 714 0.00% 66 782 0.00% 67 888 0.00% 68 962 0.01% 69 1145 0.01% 70 1338 0.01% 71 1373 0.01% 72 1759 0.01% 73 1906 0.01% 74 1901 0.01% 75 1945 0.01% 76 2054 0.01% 77 2369 0.01% 78 2435 0.01% 79 2760 0.02% 80 3128 0.02% 81 3455 0.02% 82 3902 0.02% 83 4043 0.02% 84 4448 0.02% 85 4745 0.03% 86 4735 0.03% 87 4657 0.03% 88 5103 0.03% 89 5668 0.03% 90 6026 0.03% 91 6468 0.04% 92 6765 0.04% 93 7744 0.04% 94 7650 0.04% 95 8026 0.04% 96 8201 0.05% 97 8193 0.05% 98 8564 0.05% 99 8913 0.05% 100 9491 0.05% 101 10214 0.06% 102 10999 0.06% 103 11371 0.06% 104 11914 0.07% 105 11937 0.07% 106 12106 0.07% 107 12105 0.07% 108 12170 0.07% 109 12807 0.07% 110 13104 0.07% 111 13981 0.08% 112 14836 0.08% 113 15350 0.09% 114 16161 0.09% 115 16321 0.09% 116 16700 0.09% 117 17039 0.10% 118 16653 0.09% 119 17538 0.10% 120 17852 0.10% 121 18833 0.11% 122 19325 0.11% 123 20377 0.11% 124 21428 0.12% 125 21759 0.12% 126 22672 0.13% 127 22387 0.12% 128 22101 0.12% 129 22923 0.13% 130 22733 0.13% 131 23812 0.13% 132 24252 0.14% 133 26184 0.15% 134 26923 0.15% 135 27832 0.16% 136 27815 0.16% 137 27925 0.16% 138 28242 0.16% 139 28444 0.16% 140 28620 0.16% 141 29175 0.16% 142 29487 0.16% 143 30990 0.17% 144 33194 0.19% 145 33753 0.19% 146 34278 0.19% 147 33974 0.19% 148 33891 0.19% 149 34512 0.19% 150 36314 0.20% 151 16652962 92.97% 17912740 reads passed initial QC criterion=sequence-density sequence-density=0.81 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=29 prefix-density=0.82 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTTCGAGCGAAGAAGGT criterion=fanout-score sequence-density=0.02 sequence-density-rank=31 fanout-score=25.91 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=7.2 sequence=CAGTTTCATTTGAGACTACAAATGAAGGAAGAAAAACTTGGGACAAATTAAATTACATGCTCAGTAACAGTAGAGATAACAATCATAAAATCCACCCCCCCTGCCGGAACACCACCGACGACACAAACAGAAAGAGATCTTATTTAACCGCTAAACTCTTCCTCTTTGTGTGTCTCGATGACAACATCAGACGTAGGATAAGCAACACAGGTGAGAACCCAGCCTTCCTCTATCTGGTCATCATCAAGGAAGCTAGCATCAGACTGATCCACAGTCCCCTTCACAATCTTGCCAAGACATGAAGAGCATGAGCCAGCCCTGCATGAGTAGGGGAGGTCAATCTCTTCTGCCTCCTCAGCATGGTCAAGGATGTAGATGTCATCGGGGCATGCAAACTCCTTCTCACCATCAGGAGTGATGAGCTTCACCGTGTATGCTGCCATTGCTTTAACACGTCCTCCTCGACTGGCTTTCAAGCCAAGAAGAGACTCCCCCACGTTGGGAAGTGCCC criterion=sequence-density sequence-density=0.84 sequence-density-rank=1 fanout-score=2.59 fanout-score-rank=26 prefix-density=0.92 prefix-fanout=2.4 sequence=ACAAGCCAACATGGTGGCACCATTCAATGGTCTCAAGTCTGCCGCAGCTTTCCCAGTCAGTACCAGAAAGGC criterion=fanout-score sequence-density=0.03 sequence-density-rank=31 fanout-score=138.06 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=17.9 sequence=AGAGAGAGAGACAGAGAGAATGGCCACCACAGCAGCCCTCTCCAGCGCCATGGTCAGCACATCGTTTACTCGCCGGGTGCCAGTGACAAGCCTACGGGCACTTCCCAACGTGGGGGAGTCTCTTCTTGGCTTGAAAGCCAGTCGAGGAGGACGTGTTAAAGCAATGGCAG SRR12671357 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 18:50:34 Started mapping on | Feb 11 18:50:34 Finished on | Feb 11 18:52:42 Mapping speed, Million of reads per hour | 503.80 Number of input reads | 17912740 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 15779873 Uniquely mapped reads % | 88.09% Average mapped length | 296.04 Number of splices: Total | 15420182 Number of splices: Annotated (sjdb) | 15132887 Number of splices: GT/AG | 15103619 Number of splices: GC/AG | 266257 Number of splices: AT/AC | 9186 Number of splices: Non-canonical | 41120 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.90 Insertion rate per base | 0.02% Insertion average length | 2.16 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 414437 % of reads mapped to multiple loci | 2.31% Number of reads mapped to too many loci | 99871 % of reads mapped to too many loci | 0.56% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 8.51% % of reads unmapped: other | 0.52% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1718430 1718430 1718430 N_multimapping 414437 414437 414437 N_noFeature 515318 15532866 607370 N_ambiguous 252237 957 96782 UnstrandedReadsAssigned:15012318 PositiveStrandReadsAssigned:246050 NegativeStrandReadsAssigned:15075721 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671357 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671357-trimmed-pair1.fastq SRR12671357-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,912,740 reads, 15,369,976 reads pseudoaligned [quant] estimated average fragment length: 284.057 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,123 rounds 52401 SRR12671357.ke.tsv 34699 SRR12671357.se.tsv 87100 total ==> SRR12671357.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1734.94 429 15.7938 Potri.005G024800.1.v4.1 1035 751.943 273 23.1896 Potri.004G059700.1.v4.1 961 678.4 6 0.564913 Potri.007G009000.2.v4.1 1416 1132.94 0 0 Potri.003G141000.2.v4.1 2943 2659.94 993.497 23.8567 Potri.016G087400.1.v4.1 270 79.9839 596 475.948 Potri.015G069301.1.v4.1 564 303.199 0 0 Potri.010G195200.1.v4.1 1773 1489.94 37 1.58616 Potri.012G127500.1.v4.1 977 694.185 101 9.29313 ==> SRR12671357.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 385 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 189 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 6 SRR12671357 completed mapping pipeline successfully