Starting /dee2/code/volunteer_pipeline.sh SRR12671358 current disk space = 3053423370240 free memory = 1440096212 SRR12671358 SRAfilesize bfd95fc987bc3f81f1ebfb70ccd23c50 SRR12671358.sra SRR12671358.sra file validated SRR12671358 is paired end SRR12671358 is conventional basespace SRR12671358 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671358_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.578 37.0 37.0 37.0 37.0 37.0 2 36.34225 37.0 37.0 37.0 37.0 37.0 3 36.6395 37.0 37.0 37.0 37.0 37.0 4 36.619 37.0 37.0 37.0 37.0 37.0 5 36.5655 37.0 37.0 37.0 37.0 37.0 6 36.5705 37.0 37.0 37.0 37.0 37.0 7 36.5035 37.0 37.0 37.0 37.0 37.0 8 36.58 37.0 37.0 37.0 37.0 37.0 9 36.5865 37.0 37.0 37.0 37.0 37.0 10-14 36.621300000000005 37.0 37.0 37.0 37.0 37.0 15-19 36.617 37.0 37.0 37.0 37.0 37.0 20-24 36.5958 37.0 37.0 37.0 37.0 37.0 25-29 36.6188 37.0 37.0 37.0 37.0 37.0 30-34 36.538199999999996 37.0 37.0 37.0 37.0 37.0 35-39 36.497 37.0 37.0 37.0 37.0 37.0 40-44 36.497400000000006 37.0 37.0 37.0 37.0 37.0 45-49 36.4476 37.0 37.0 37.0 37.0 37.0 50-54 36.4184 37.0 37.0 37.0 37.0 37.0 55-59 36.4353 37.0 37.0 37.0 37.0 37.0 60-64 36.380399999999995 37.0 37.0 37.0 37.0 37.0 65-69 36.416700000000006 37.0 37.0 37.0 37.0 37.0 70-74 36.366099999999996 37.0 37.0 37.0 37.0 37.0 75-79 36.37179999999999 37.0 37.0 37.0 37.0 37.0 80-84 36.3211 37.0 37.0 37.0 37.0 37.0 85-89 36.253400000000006 37.0 37.0 37.0 37.0 37.0 90-94 36.2433 37.0 37.0 37.0 37.0 37.0 95-99 36.2354 37.0 37.0 37.0 37.0 37.0 100-104 36.248400000000004 37.0 37.0 37.0 37.0 37.0 105-109 36.2348 37.0 37.0 37.0 37.0 37.0 110-114 36.1561 37.0 37.0 37.0 37.0 37.0 115-119 36.155100000000004 37.0 37.0 37.0 37.0 37.0 120-124 36.157000000000004 37.0 37.0 37.0 37.0 37.0 125-129 36.1584 37.0 37.0 37.0 37.0 37.0 130-134 36.064499999999995 37.0 37.0 37.0 37.0 37.0 135-139 36.0699 37.0 37.0 37.0 37.0 37.0 140-144 36.031800000000004 37.0 37.0 37.0 37.0 37.0 145-149 35.982099999999996 37.0 37.0 37.0 37.0 37.0 150-151 35.892250000000004 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 2.0 21 1.0 22 1.0 23 6.0 24 4.0 25 2.0 26 3.0 27 5.0 28 6.0 29 13.0 30 22.0 31 26.0 32 43.0 33 59.0 34 100.0 35 243.0 36 2977.0 37 486.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 50.525 10.549999999999999 5.2 33.725 2 20.70263488080301 11.819322459222082 38.59473023839398 28.883312421580932 3 19.6 17.45 28.749999999999996 34.2 4 23.75 26.275 23.150000000000002 26.825 5 22.875 33.15 24.45 19.525000000000002 6 19.05 33.85 25.6 21.5 7 14.224999999999998 25.95 43.125 16.7 8 16.525000000000002 24.099999999999998 34.55 24.825 9 18.5 23.075000000000003 34.65 23.775 10-14 19.3 29.5 28.76 22.439999999999998 15-19 19.785 27.47 28.83 23.915 20-24 19.875 27.665 28.37 24.09 25-29 20.419999999999998 27.889999999999997 28.335 23.355 30-34 19.885 29.160000000000004 27.705000000000002 23.25 35-39 19.99 28.405 28.105000000000004 23.5 40-44 20.06 28.52 27.62 23.799999999999997 45-49 20.125 29.044999999999998 27.99 22.84 50-54 20.365 27.85 28.585 23.200000000000003 55-59 20.150000000000002 28.92 27.825 23.105 60-64 20.82 27.815 27.92 23.445 65-69 20.86 28.050000000000004 27.55 23.54 70-74 19.975 29.205 26.715 24.104999999999997 75-79 19.74 28.335 28.199999999999996 23.724999999999998 80-84 20.375 28.389999999999997 27.24 23.995 85-89 20.885 28.345 27.189999999999998 23.580000000000002 90-94 21.08 28.48 27.134999999999998 23.305 95-99 20.1 28.865000000000002 27.525 23.51 100-104 20.26 28.884999999999998 27.525 23.330000000000002 105-109 20.885 28.535 27.284999999999997 23.294999999999998 110-114 20.565 28.415000000000003 27.810000000000002 23.21 115-119 21.25 28.044999999999998 27.224999999999998 23.48 120-124 21.279999999999998 27.85 27.215 23.655 125-129 20.945 29.104999999999997 26.545 23.405 130-134 21.665 28.144999999999996 27.005000000000003 23.185 135-139 20.849999999999998 27.775 27.584999999999997 23.79 140-144 20.695 27.625 27.725 23.955000000000002 145-149 21.25 28.325 26.46 23.965 150-151 20.65 27.987499999999997 26.9125 24.45 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 1.5 4 1.5 5 0.5 6 0.0 7 1.5 8 1.5 9 0.0 10 0.0 11 0.5 12 0.5 13 1.0 14 1.5 15 1.0 16 2.0 17 2.0 18 0.5 19 1.0 20 1.0 21 2.0 22 3.5 23 2.0 24 2.5 25 4.0 26 8.0 27 13.5 28 12.0 29 15.5 30 23.5 31 33.0 32 41.5 33 43.0 34 54.0 35 72.0 36 81.0 37 95.0 38 124.0 39 156.0 40 176.0 41 205.0 42 239.5 43 249.5 44 268.0 45 260.5 46 253.0 47 257.0 48 232.0 49 198.5 50 149.5 51 121.5 52 106.5 53 99.0 54 89.5 55 64.0 56 56.0 57 50.0 58 32.5 59 21.5 60 18.0 61 14.0 62 12.5 63 7.0 64 1.0 65 2.5 66 2.5 67 3.0 68 2.5 69 0.5 70 1.5 71 1.0 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.375 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 82.375 #Duplication Level Percentage of deduplicated Percentage of total 1 83.52048558421852 68.8 2 12.746585735963581 21.0 3 2.7921092564491654 6.9 4 0.7587253414264037 2.5 5 0.12139605462822459 0.5 6 0.06069802731411229 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCTAATTTGTACTTACTTTTCATCACAATAACATCAAATCCACAAACTTC 6 0.15 No Hit GCTTTCTCCATCAGATGCATCTGCGAGCCTTGCAATTGCATCAACAAGTG 6 0.15 No Hit CATCATTACGGTCCTTGTCCCGTTGGCTTGACCTATCATGAGAGCGTCTG 5 0.125 No Hit CTGGACCAATATAATATAGTCCTAGCTCTTCAAACAAGCATGCGCCAGAT 5 0.125 No Hit GTAGGAAATGGCAGGCTCAGGCTTGGAAGACAAGATGGATGACCTCGACA 5 0.125 No Hit GTGGTAATGTTAAAAATTATAATTGAAAAAATAATGCACGGACCTAAATA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.0625 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.16249999999999998 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.3 0.0 0.0 0.0 0.0 92-93 0.35 0.0 0.0 0.0 0.0 94-95 0.4875 0.0 0.0 0.0 0.0 96-97 0.525 0.0 0.0 0.0 0.0 98-99 0.6125 0.0 0.0 0.0 0.0 100-101 0.625 0.0 0.0 0.0 0.0 102-103 0.7125 0.0 0.0 0.0 0.0 104-105 0.95 0.0 0.0 0.0 0.0 106-107 1.1375 0.0 0.0 0.0 0.0 108-109 1.4125 0.0 0.0 0.0 0.0 110-111 1.5625 0.0 0.0 0.0 0.0 112-113 1.8625 0.0 0.0 0.0 0.0 114-115 1.9625 0.0 0.0 0.0 0.0 116-117 2.2125 0.0 0.0 0.0 0.0 118-119 2.3625 0.0 0.0 0.0 0.0 120-121 2.5625 0.0 0.0 0.0 0.0 122-123 2.7875 0.0 0.0 0.0 0.0 124-125 3.1125 0.0 0.0 0.0 0.0 126-127 3.525 0.0 0.0 0.0 0.0 128-129 3.7875 0.0 0.0 0.0 0.0 130-131 3.9875 0.0 0.0 0.0 0.0 132-133 4.2125 0.0 0.0 0.0 0.0 134-135 4.5375 0.0 0.0 0.0 0.0 136-137 4.8875 0.0 0.0 0.0 0.0 138-139 5.2875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACAGAAA 10 0.006830828 145.0 6 TGTTAAA 10 0.006830828 145.0 8 >>END_MODULE SRR12671358 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671358_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.189 37.0 37.0 37.0 37.0 37.0 2 36.009 37.0 37.0 37.0 37.0 37.0 3 36.1585 37.0 37.0 37.0 37.0 37.0 4 36.1535 37.0 37.0 37.0 37.0 37.0 5 36.3245 37.0 37.0 37.0 37.0 37.0 6 36.2025 37.0 37.0 37.0 37.0 37.0 7 36.162 37.0 37.0 37.0 37.0 37.0 8 36.1435 37.0 37.0 37.0 37.0 37.0 9 36.182 37.0 37.0 37.0 37.0 37.0 10-14 36.2621 37.0 37.0 37.0 37.0 37.0 15-19 36.21130000000001 37.0 37.0 37.0 37.0 37.0 20-24 36.157 37.0 37.0 37.0 37.0 37.0 25-29 36.157000000000004 37.0 37.0 37.0 37.0 37.0 30-34 36.107600000000005 37.0 37.0 37.0 37.0 37.0 35-39 36.151 37.0 37.0 37.0 37.0 37.0 40-44 36.06269999999999 37.0 37.0 37.0 37.0 37.0 45-49 36.036300000000004 37.0 37.0 37.0 37.0 37.0 50-54 36.0484 37.0 37.0 37.0 37.0 37.0 55-59 35.9927 37.0 37.0 37.0 37.0 37.0 60-64 35.994299999999996 37.0 37.0 37.0 37.0 37.0 65-69 36.002599999999994 37.0 37.0 37.0 37.0 37.0 70-74 35.9368 37.0 37.0 37.0 37.0 37.0 75-79 35.911199999999994 37.0 37.0 37.0 37.0 37.0 80-84 35.88290000000001 37.0 37.0 37.0 37.0 37.0 85-89 35.9555 37.0 37.0 37.0 37.0 37.0 90-94 35.918099999999995 37.0 37.0 37.0 37.0 37.0 95-99 35.8077 37.0 37.0 37.0 37.0 37.0 100-104 35.8143 37.0 37.0 37.0 37.0 37.0 105-109 35.737199999999994 37.0 37.0 37.0 37.0 37.0 110-114 35.700900000000004 37.0 37.0 37.0 37.0 37.0 115-119 35.8059 37.0 37.0 37.0 37.0 37.0 120-124 35.7756 37.0 37.0 37.0 37.0 37.0 125-129 35.733 37.0 37.0 37.0 37.0 37.0 130-134 35.6191 37.0 37.0 37.0 37.0 37.0 135-139 35.5362 37.0 37.0 37.0 37.0 37.0 140-144 35.5404 37.0 37.0 37.0 37.0 37.0 145-149 35.4579 37.0 37.0 37.0 37.0 37.0 150-151 35.17825 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 5.0 15 1.0 16 3.0 17 1.0 18 1.0 19 1.0 20 1.0 21 2.0 22 2.0 23 10.0 24 11.0 25 2.0 26 9.0 27 9.0 28 16.0 29 15.0 30 25.0 31 47.0 32 49.0 33 106.0 34 194.0 35 525.0 36 2686.0 37 278.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.95 23.175 8.425 22.45 2 25.05 26.224999999999998 32.324999999999996 16.400000000000002 3 21.6 26.825 34.1 17.474999999999998 4 24.349999999999998 32.75 23.75 19.15 5 24.425 38.05 20.575 16.950000000000003 6 20.175 39.900000000000006 21.65 18.275 7 20.724999999999998 20.474999999999998 38.824999999999996 19.975 8 18.125 25.374999999999996 31.3 25.2 9 22.85 23.425 30.775000000000002 22.95 10-14 24.04 28.439999999999998 26.735 20.785 15-19 22.994999999999997 27.825 28.51 20.669999999999998 20-24 23.48 28.084999999999997 27.365000000000002 21.07 25-29 23.494999999999997 28.365000000000002 27.655 20.485 30-34 22.7 28.23 27.54 21.529999999999998 35-39 22.235 27.77 28.335 21.66 40-44 22.73 28.044999999999998 27.97 21.255 45-49 22.775000000000002 27.794999999999998 28.144999999999996 21.285 50-54 23.455000000000002 27.725 27.544999999999998 21.275 55-59 23.044999999999998 27.36 28.53 21.065 60-64 23.115 27.284999999999997 27.68 21.92 65-69 23.78 26.755000000000003 28.33 21.135 70-74 22.975 28.52 27.634999999999998 20.87 75-79 23.724999999999998 28.175 26.919999999999998 21.18 80-84 22.650000000000002 27.900000000000002 27.700000000000003 21.75 85-89 23.44 28.63 27.025 20.905 90-94 23.825 27.845 27.205000000000002 21.125 95-99 23.785 27.91 26.965 21.34 100-104 23.745 28.144999999999996 27.555000000000003 20.555 105-109 23.655 27.950000000000003 27.74 20.655 110-114 23.885 28.21 27.565 20.34 115-119 24.325 28.555000000000003 26.784999999999997 20.335 120-124 24.705 27.450000000000003 26.575 21.27 125-129 23.905 27.99 27.029999999999998 21.075 130-134 24.41 27.935 27.445000000000004 20.21 135-139 25.21 27.865000000000002 26.66 20.265 140-144 25.014999999999997 27.415 27.395000000000003 20.175 145-149 25.729999999999997 27.815 26.39 20.064999999999998 150-151 24.875 28.6875 26.7125 19.725 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.5 11 1.0 12 0.5 13 0.5 14 0.5 15 0.5 16 1.5 17 1.0 18 0.5 19 0.5 20 0.0 21 0.0 22 1.0 23 1.5 24 3.0 25 5.0 26 5.5 27 6.0 28 8.5 29 11.0 30 15.0 31 19.5 32 30.5 33 36.5 34 44.5 35 65.0 36 84.0 37 117.0 38 138.5 39 150.0 40 191.0 41 234.5 42 247.0 43 253.0 44 257.5 45 268.0 46 281.5 47 244.5 48 203.0 49 186.5 50 166.0 51 137.5 52 112.0 53 92.0 54 77.5 55 65.0 56 44.0 57 36.5 58 31.5 59 24.5 60 21.0 61 15.5 62 16.5 63 12.0 64 5.0 65 3.5 66 0.5 67 2.0 68 2.0 69 1.5 70 2.0 71 3.5 72 3.0 73 0.5 74 0.5 75 1.0 76 1.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.5 94 0.5 95 0.5 96 0.5 97 0.0 98 0.5 99 1.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 82.675 #Duplication Level Percentage of deduplicated Percentage of total 1 84.12458421530089 69.55 2 12.095554883580284 20.0 3 2.8726942848503176 7.124999999999999 4 0.6652555185969156 2.1999999999999997 5 0.15119443604475355 0.625 6 0.06047777441790142 0.3 7 0.0 0.0 8 0.03023888720895071 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 8 0.2 No Hit CTGCATTATTATTCTCTCTTCTAAAAGCGAACCCTAGTCCTAGCGGTTTC 6 0.15 No Hit CTTCTAACACAGAATGGTATTGCAAGGAAACTTTCTGACAACATCGAATT 6 0.15 No Hit GATAAGTGGGAGCTTCGGCGAAGGTGAAATACCACTACTTTTAACGTTAT 5 0.125 No Hit GTTCACTACTGTGCTGCTGGTTCAAAACCTTGGAGATATACTGGCAAGGA 5 0.125 No Hit AAACAAATTCGGGATTCTCAAGTCACAAATATGCATGGTCGGGGACAGAT 5 0.125 No Hit GAACATGATGCCTTTGGAGCTGGCCATAGTTCTACTAGTATTTCAGCTGC 5 0.125 No Hit GAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.0625 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.16249999999999998 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.3 0.0 0.0 0.0 0.0 92-93 0.35 0.0 0.0 0.0 0.0 94-95 0.4875 0.0 0.0 0.0 0.0 96-97 0.525 0.0 0.0 0.0 0.0 98-99 0.6125 0.0 0.0 0.0 0.0 100-101 0.625 0.0 0.0 0.0 0.0 102-103 0.7125 0.0 0.0 0.0 0.0 104-105 0.95 0.0 0.0 0.0 0.0 106-107 1.1375 0.0 0.0 0.0 0.0 108-109 1.4125 0.0 0.0 0.0 0.0 110-111 1.5625 0.0 0.0 0.0 0.0 112-113 1.8625 0.0 0.0 0.0 0.0 114-115 1.9625 0.0 0.0 0.0 0.0 116-117 2.2375 0.0 0.0 0.0 0.0 118-119 2.3875 0.0 0.0 0.0 0.0 120-121 2.5875 0.0 0.0 0.0 0.0 122-123 2.8125 0.0 0.0 0.0 0.0 124-125 3.175 0.0 0.0 0.0 0.0 126-127 3.5875 0.0 0.0 0.0 0.0 128-129 3.8875 0.0 0.0 0.0 0.0 130-131 4.0875 0.0 0.0 0.0 0.0 132-133 4.3125 0.0 0.0 0.0 0.0 134-135 4.6625 0.0 0.0 0.0 0.0 136-137 5.0375 0.0 0.0 0.0 0.0 138-139 5.4375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 766455 spots for SRR12671358.sra Written 766455 spots for SRR12671358.sra Read 766455 spots for SRR12671358.sra Written 766455 spots for SRR12671358.sra Read 766455 spots for SRR12671358.sra Written 766455 spots for SRR12671358.sra Read 766455 spots for SRR12671358.sra Written 766455 spots for SRR12671358.sra Read 766455 spots for SRR12671358.sra Written 766455 spots for SRR12671358.sra Read 766455 spots for SRR12671358.sra Written 766455 spots for SRR12671358.sra Read 766455 spots for SRR12671358.sra Written 766455 spots for SRR12671358.sra Read 766455 spots for SRR12671358.sra Written 766455 spots for SRR12671358.sra Read 766455 spots for SRR12671358.sra Written 766455 spots for SRR12671358.sra Read 766455 spots for SRR12671358.sra Written 766455 spots for SRR12671358.sra Read 766455 spots for SRR12671358.sra Written 766455 spots for SRR12671358.sra Read 766455 spots for SRR12671358.sra Written 766455 spots for SRR12671358.sra Read 766473 spots for SRR12671358.sra Written 766473 spots for SRR12671358.sra Read 766455 spots for SRR12671358.sra Written 766455 spots for SRR12671358.sra Read 766455 spots for SRR12671358.sra Written 766455 spots for SRR12671358.sra Read 766455 spots for SRR12671358.sra Written 766455 spots for SRR12671358.sra Read 766455 spots for SRR12671358.sra Written 766455 spots for SRR12671358.sra Read 766455 spots for SRR12671358.sra Written 766455 spots for SRR12671358.sra Read 766455 spots for SRR12671358.sra Written 766455 spots for SRR12671358.sra Read 766455 spots for SRR12671358.sra Written 766455 spots for SRR12671358.sra SRR ids: ['SRR12671358.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_gua7bllk SRR12671358.sra spots: 15329118 blocks: [[1, 766455], [766456, 1532910], [1532911, 2299365], [2299366, 3065820], [3065821, 3832275], [3832276, 4598730], [4598731, 5365185], [5365186, 6131640], [6131641, 6898095], [6898096, 7664550], [7664551, 8431005], [8431006, 9197460], [9197461, 9963915], [9963916, 10730370], [10730371, 11496825], [11496826, 12263280], [12263281, 13029735], [13029736, 13796190], [13796191, 14562645], [14562646, 15329118]] SRR12671358 file size 5187804 SRR12671358 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671358 SRR12671358_1.fastq SRR12671358_2.fastq Input file: SRR12671358_1.fastq Paired file: SRR12671358_2.fastq trimmed: SRR12671358-trimmed-pair1.fastq, SRR12671358-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 18:20:49 2025 >> started Tue Feb 11 18:21:06 2025 >> done (17.066s) 15329118 read pairs processed; of these: 74 ( 0.00%) short read pairs filtered out after trimming by size control 2793 ( 0.02%) empty read pairs filtered out after trimming by size control 15326251 (99.98%) read pairs available; of these: 1024389 ( 6.68%) trimmed read pairs available after processing 14301862 (93.32%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 9 0.00% 20 15 0.00% 21 8 0.00% 22 8 0.00% 23 20 0.00% 24 30 0.00% 25 17 0.00% 26 27 0.00% 27 16 0.00% 28 20 0.00% 29 23 0.00% 30 26 0.00% 31 26 0.00% 32 24 0.00% 33 28 0.00% 34 30 0.00% 35 26 0.00% 36 23 0.00% 37 18 0.00% 38 42 0.00% 39 28 0.00% 40 34 0.00% 41 38 0.00% 42 41 0.00% 43 49 0.00% 44 25 0.00% 45 38 0.00% 46 49 0.00% 47 48 0.00% 48 56 0.00% 49 79 0.00% 50 66 0.00% 51 75 0.00% 52 90 0.00% 53 99 0.00% 54 111 0.00% 55 144 0.00% 56 117 0.00% 57 165 0.00% 58 182 0.00% 59 201 0.00% 60 216 0.00% 61 259 0.00% 62 328 0.00% 63 358 0.00% 64 390 0.00% 65 380 0.00% 66 452 0.00% 67 472 0.00% 68 574 0.00% 69 624 0.00% 70 738 0.00% 71 896 0.01% 72 948 0.01% 73 1133 0.01% 74 1228 0.01% 75 1349 0.01% 76 1513 0.01% 77 1563 0.01% 78 1751 0.01% 79 2023 0.01% 80 2118 0.01% 81 2349 0.02% 82 2666 0.02% 83 2757 0.02% 84 3185 0.02% 85 3469 0.02% 86 3815 0.02% 87 3957 0.03% 88 4274 0.03% 89 4380 0.03% 90 4736 0.03% 91 4930 0.03% 92 5334 0.03% 93 5735 0.04% 94 6089 0.04% 95 6439 0.04% 96 6696 0.04% 97 6976 0.05% 98 7263 0.05% 99 7536 0.05% 100 7852 0.05% 101 8150 0.05% 102 8850 0.06% 103 8881 0.06% 104 9416 0.06% 105 9711 0.06% 106 9880 0.06% 107 10326 0.07% 108 10752 0.07% 109 11486 0.07% 110 11239 0.07% 111 11844 0.08% 112 12296 0.08% 113 12466 0.08% 114 12892 0.08% 115 13317 0.09% 116 13696 0.09% 117 14367 0.09% 118 14495 0.09% 119 15147 0.10% 120 15512 0.10% 121 15696 0.10% 122 16129 0.11% 123 16733 0.11% 124 17074 0.11% 125 17307 0.11% 126 18147 0.12% 127 18218 0.12% 128 19092 0.12% 129 19303 0.13% 130 20065 0.13% 131 20124 0.13% 132 20538 0.13% 133 20821 0.14% 134 21316 0.14% 135 21761 0.14% 136 22255 0.15% 137 22554 0.15% 138 23460 0.15% 139 23989 0.16% 140 24172 0.16% 141 24672 0.16% 142 25302 0.17% 143 25736 0.17% 144 26188 0.17% 145 26573 0.17% 146 27092 0.18% 147 27546 0.18% 148 28302 0.18% 149 28326 0.18% 150 29247 0.19% 151 14301862 93.32% 15326251 reads passed initial QC criterion=sequence-density sequence-density=0.48 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=17 prefix-density=0.49 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=513.70 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=16.2 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGTTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTG criterion=sequence-density sequence-density=0.73 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=26 prefix-density=0.73 prefix-fanout=2.0 sequence=AACCGCACCCCGGCACA criterion=fanout-score sequence-density=0.19 sequence-density-rank=16 fanout-score=18.41 fanout-score-rank=1 prefix-density=0.39 prefix-fanout=8.8 sequence=AGAAAGATGGCCTCGGCATCATTTCTCAAGTCATCACCAGTTCTAGACAAGTCTGAGTTTGTTAAGGGTCAGACCCTCCGCTTGCCTTCTGCCTCCATTGTCCGGTGCCGCTCCACCGCCCCTTCTGCTCTTACCGTTCGTGCTGGTTCCTATGCTGAGGAGCTTGTCAAAACCGCGAAAACAATTGCATCTCCTGGCCGAGGTATTTTGGCCATGGATGAGTCTAACGCTACCTGTGGAAAACGTCTCGCCTCAATCGGGCTAGAGAACACCGAGGCTAACCGCCAGGCATACCGTACCCTTCTTGTGACAGTCCCTGGCCTTGGTGATTACGTCTCTGGTGCCATCCTTTTTGAGGAGACTCTCTACCAATCCAC SRR12671358 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 18:22:01 Started mapping on | Feb 11 18:22:02 Finished on | Feb 11 18:23:52 Mapping speed, Million of reads per hour | 501.59 Number of input reads | 15326251 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 13932548 Uniquely mapped reads % | 90.91% Average mapped length | 296.78 Number of splices: Total | 13650792 Number of splices: Annotated (sjdb) | 13385882 Number of splices: GT/AG | 13379267 Number of splices: GC/AG | 222751 Number of splices: AT/AC | 7870 Number of splices: Non-canonical | 40904 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 2.85 Insertion rate per base | 0.03% Insertion average length | 2.25 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 383140 % of reads mapped to multiple loci | 2.50% Number of reads mapped to too many loci | 200387 % of reads mapped to too many loci | 1.31% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.01% % of reads unmapped: other | 0.28% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1010563 1010563 1010563 N_multimapping 383140 383140 383140 N_noFeature 565490 13681356 647844 N_ambiguous 262247 1030 92801 UnstrandedReadsAssigned:13104811 PositiveStrandReadsAssigned:250162 NegativeStrandReadsAssigned:13191903 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671358 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671358-trimmed-pair1.fastq SRR12671358-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,326,251 reads, 13,310,263 reads pseudoaligned [quant] estimated average fragment length: 293.229 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 989 rounds 52401 SRR12671358.ke.tsv 34699 SRR12671358.se.tsv 87100 total ==> SRR12671358.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1725.77 727 28.7047 Potri.005G024800.1.v4.1 1035 742.771 272 24.9526 Potri.004G059700.1.v4.1 961 669.099 0 0 Potri.007G009000.2.v4.1 1416 1123.77 0 0 Potri.003G141000.2.v4.1 2943 2650.77 720 18.5081 Potri.016G087400.1.v4.1 270 78.4765 631 547.889 Potri.015G069301.1.v4.1 564 295.849 0 0 Potri.010G195200.1.v4.1 1773 1480.77 57 2.62295 Potri.012G127500.1.v4.1 977 684.908 129 12.8339 ==> SRR12671358.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 163 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 139 Potri.001G212900.v4.1 121 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 24 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR12671358 completed mapping pipeline successfully