Starting /dee2/code/volunteer_pipeline.sh SRR12671359 current disk space = 3053353570304 free memory = 1506248856 SRR12671359 SRAfilesize ae2a11b7da311973bce0f6d717cd00de SRR12671359.sra SRR12671359.sra file validated SRR12671359 is paired end SRR12671359 is conventional basespace SRR12671359 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671359_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.6055 37.0 37.0 37.0 37.0 37.0 2 36.4045 37.0 37.0 37.0 37.0 37.0 3 36.5435 37.0 37.0 37.0 37.0 37.0 4 36.6 37.0 37.0 37.0 37.0 37.0 5 36.64 37.0 37.0 37.0 37.0 37.0 6 36.672 37.0 37.0 37.0 37.0 37.0 7 36.55 37.0 37.0 37.0 37.0 37.0 8 36.608 37.0 37.0 37.0 37.0 37.0 9 36.603 37.0 37.0 37.0 37.0 37.0 10-14 36.6237 37.0 37.0 37.0 37.0 37.0 15-19 36.6212 37.0 37.0 37.0 37.0 37.0 20-24 36.580600000000004 37.0 37.0 37.0 37.0 37.0 25-29 36.5367 37.0 37.0 37.0 37.0 37.0 30-34 36.525400000000005 37.0 37.0 37.0 37.0 37.0 35-39 36.5092 37.0 37.0 37.0 37.0 37.0 40-44 36.4427 37.0 37.0 37.0 37.0 37.0 45-49 36.4341 37.0 37.0 37.0 37.0 37.0 50-54 36.4176 37.0 37.0 37.0 37.0 37.0 55-59 36.318799999999996 37.0 37.0 37.0 37.0 37.0 60-64 36.3153 37.0 37.0 37.0 37.0 37.0 65-69 36.3224 37.0 37.0 37.0 37.0 37.0 70-74 36.332899999999995 37.0 37.0 37.0 37.0 37.0 75-79 36.2731 37.0 37.0 37.0 37.0 37.0 80-84 36.2025 37.0 37.0 37.0 37.0 37.0 85-89 36.2149 37.0 37.0 37.0 37.0 37.0 90-94 36.1937 37.0 37.0 37.0 37.0 37.0 95-99 36.1437 37.0 37.0 37.0 37.0 37.0 100-104 36.1314 37.0 37.0 37.0 37.0 37.0 105-109 36.15 37.0 37.0 37.0 37.0 37.0 110-114 36.08970000000001 37.0 37.0 37.0 37.0 37.0 115-119 36.0631 37.0 37.0 37.0 37.0 37.0 120-124 36.0228 37.0 37.0 37.0 37.0 37.0 125-129 36.0487 37.0 37.0 37.0 37.0 37.0 130-134 36.016000000000005 37.0 37.0 37.0 37.0 37.0 135-139 36.002700000000004 37.0 37.0 37.0 37.0 37.0 140-144 35.887 37.0 37.0 37.0 37.0 37.0 145-149 35.932399999999994 37.0 37.0 37.0 37.0 37.0 150-151 35.9055 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 1.0 22 5.0 23 5.0 24 4.0 25 4.0 26 4.0 27 5.0 28 11.0 29 19.0 30 23.0 31 31.0 32 45.0 33 60.0 34 107.0 35 269.0 36 2964.0 37 442.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.0 10.125 7.124999999999999 39.75 2 19.53360080240722 12.086258776328988 39.26780341023069 29.1123370110331 3 18.375 16.0 28.849999999999998 36.775000000000006 4 22.675 24.25 24.275 28.799999999999997 5 23.775 32.925 24.45 18.85 6 18.6 34.0 25.224999999999998 22.175 7 15.1 26.6 43.05 15.25 8 15.35 25.95 35.025 23.674999999999997 9 17.025000000000002 22.400000000000002 37.025000000000006 23.549999999999997 10-14 19.615 29.244999999999997 28.735 22.405 15-19 20.025000000000002 27.584999999999997 28.355000000000004 24.035 20-24 19.555 28.68 28.335 23.43 25-29 19.98 27.495000000000005 28.970000000000002 23.555 30-34 19.52 28.645 27.47 24.365000000000002 35-39 19.155 28.535 28.465 23.845 40-44 19.865 29.39 27.08 23.665 45-49 20.044999999999998 27.905 27.900000000000002 24.15 50-54 20.21 27.994999999999997 28.185 23.61 55-59 20.26 28.515 27.810000000000002 23.415 60-64 19.965 28.095 27.73 24.21 65-69 20.46 28.24 28.225 23.075000000000003 70-74 19.77 28.07 28.975 23.185 75-79 20.31 28.485 27.52 23.685000000000002 80-84 20.1 28.22 28.16 23.52 85-89 20.369999999999997 28.505000000000003 27.765 23.36 90-94 20.06 28.155 27.93 23.855 95-99 20.064999999999998 28.035 28.095 23.805 100-104 20.25 29.065 27.644999999999996 23.04 105-109 20.405 28.83 27.529999999999998 23.235 110-114 19.755 28.28 27.839999999999996 24.125 115-119 20.48 28.22 28.4 22.900000000000002 120-124 20.485 28.185 26.985 24.345 125-129 19.994999999999997 28.389999999999997 27.915 23.7 130-134 21.005 28.165000000000003 27.49 23.34 135-139 20.369999999999997 27.894999999999996 27.975 23.76 140-144 20.935000000000002 28.084999999999997 28.18 22.8 145-149 20.685000000000002 28.605000000000004 27.015 23.695 150-151 20.225 28.537499999999998 27.6 23.6375 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 0.5 2 0.5 3 0.5 4 0.5 5 1.0 6 0.5 7 1.0 8 2.0 9 1.5 10 2.5 11 2.0 12 0.0 13 0.5 14 1.5 15 1.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.5 21 1.0 22 1.5 23 3.5 24 4.0 25 7.0 26 13.0 27 15.0 28 15.5 29 17.5 30 18.0 31 22.5 32 32.5 33 43.0 34 60.0 35 75.5 36 80.0 37 100.0 38 126.5 39 149.0 40 182.5 41 209.0 42 226.5 43 266.0 44 259.5 45 233.5 46 247.0 47 258.5 48 248.5 49 207.5 50 187.0 51 156.0 52 107.0 53 93.5 54 82.0 55 58.5 56 42.0 57 31.5 58 24.0 59 20.0 60 20.0 61 17.0 62 10.0 63 3.5 64 2.0 65 1.5 66 1.5 67 1.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.3 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 82.95 #Duplication Level Percentage of deduplicated Percentage of total 1 83.33333333333334 69.125 2 13.652802893309223 22.650000000000002 3 2.4412296564195297 6.075 4 0.42194092827004215 1.4000000000000001 5 0.06027727546714888 0.25 6 0.03013863773357444 0.15 7 0.06027727546714888 0.35000000000000003 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGA 7 0.17500000000000002 No Hit GTCGTAAGCCCTCCCCTCAAGTAACTCCATTCCTTTCCACGATACCAAGG 7 0.17500000000000002 No Hit TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 6 0.15 No Hit CATCAACTTGTGACACTTTGTAAATGATACATCAAAGTAGGCTACTAATG 5 0.125 No Hit CAAAAATATCAAGCGACGCAGCATTCAATTCACGATTCCATTTTGTACTT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.037500000000000006 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.16249999999999998 0.0 0.0 0.0 0.0 88-89 0.2375 0.0 0.0 0.0 0.0 90-91 0.2875 0.0 0.0 0.0 0.0 92-93 0.35 0.0 0.0 0.0 0.0 94-95 0.375 0.0 0.0 0.0 0.0 96-97 0.42500000000000004 0.0 0.0 0.0 0.0 98-99 0.4875 0.0 0.0 0.0 0.0 100-101 0.55 0.0 0.0 0.0 0.0 102-103 0.6125 0.0 0.0 0.0 0.0 104-105 0.7 0.0 0.0 0.0 0.0 106-107 0.8 0.0 0.0 0.0 0.0 108-109 0.925 0.0 0.0 0.0 0.0 110-111 1.0750000000000002 0.0 0.0 0.0 0.0 112-113 1.25 0.0 0.0 0.0 0.0 114-115 1.3875000000000002 0.0 0.0 0.0 0.0 116-117 1.525 0.0 0.0 0.0 0.0 118-119 1.7000000000000002 0.0 0.0 0.0 0.0 120-121 2.0125 0.0 0.0 0.0 0.0 122-123 2.1875 0.0 0.0 0.0 0.0 124-125 2.3499999999999996 0.0 0.0 0.0 0.0 126-127 2.5875 0.0 0.0 0.0 0.0 128-129 2.7 0.0 0.0 0.0 0.0 130-131 2.9125 0.0 0.0 0.0 0.0 132-133 3.1875 0.0 0.0 0.0 0.0 134-135 3.4125 0.0 0.0 0.0 0.0 136-137 3.7625 0.0 0.0 0.0 0.0 138-139 4.125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTGTCAT 10 0.006830828 145.0 1 GGTCTTT 10 0.006830828 145.0 4 TCATCTT 10 0.006830828 145.0 9 >>END_MODULE SRR12671359 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671359_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2515 37.0 37.0 37.0 37.0 37.0 2 35.935 37.0 37.0 37.0 37.0 37.0 3 36.0455 37.0 37.0 37.0 37.0 37.0 4 36.197 37.0 37.0 37.0 37.0 37.0 5 36.159 37.0 37.0 37.0 37.0 37.0 6 36.193 37.0 37.0 37.0 37.0 37.0 7 36.1725 37.0 37.0 37.0 37.0 37.0 8 36.23 37.0 37.0 37.0 37.0 37.0 9 36.1935 37.0 37.0 37.0 37.0 37.0 10-14 36.2208 37.0 37.0 37.0 37.0 37.0 15-19 36.2452 37.0 37.0 37.0 37.0 37.0 20-24 36.149 37.0 37.0 37.0 37.0 37.0 25-29 36.121500000000005 37.0 37.0 37.0 37.0 37.0 30-34 36.106700000000004 37.0 37.0 37.0 37.0 37.0 35-39 36.140299999999996 37.0 37.0 37.0 37.0 37.0 40-44 36.1224 37.0 37.0 37.0 37.0 37.0 45-49 36.0169 37.0 37.0 37.0 37.0 37.0 50-54 36.005399999999995 37.0 37.0 37.0 37.0 37.0 55-59 35.999399999999994 37.0 37.0 37.0 37.0 37.0 60-64 35.952600000000004 37.0 37.0 37.0 37.0 37.0 65-69 35.9515 37.0 37.0 37.0 37.0 37.0 70-74 35.871 37.0 37.0 37.0 37.0 37.0 75-79 35.8795 37.0 37.0 37.0 37.0 37.0 80-84 35.926 37.0 37.0 37.0 37.0 37.0 85-89 35.9807 37.0 37.0 37.0 37.0 37.0 90-94 35.8386 37.0 37.0 37.0 37.0 37.0 95-99 35.7485 37.0 37.0 37.0 37.0 37.0 100-104 35.734399999999994 37.0 37.0 37.0 37.0 37.0 105-109 35.7231 37.0 37.0 37.0 37.0 37.0 110-114 35.6445 37.0 37.0 37.0 37.0 37.0 115-119 35.8423 37.0 37.0 37.0 37.0 37.0 120-124 35.7144 37.0 37.0 37.0 37.0 37.0 125-129 35.659800000000004 37.0 37.0 37.0 37.0 37.0 130-134 35.5934 37.0 37.0 37.0 37.0 37.0 135-139 35.4786 37.0 37.0 37.0 37.0 37.0 140-144 35.5654 37.0 37.0 37.0 37.0 37.0 145-149 35.4505 37.0 37.0 37.0 37.0 37.0 150-151 35.31625 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 3.0 13 2.0 14 1.0 15 2.0 16 0.0 17 2.0 18 3.0 19 0.0 20 0.0 21 3.0 22 1.0 23 3.0 24 5.0 25 8.0 26 9.0 27 8.0 28 11.0 29 26.0 30 24.0 31 43.0 32 53.0 33 105.0 34 235.0 35 565.0 36 2630.0 37 258.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.45 22.875 9.625 28.050000000000004 2 25.775 24.25 34.375 15.6 3 20.424999999999997 26.775 33.45 19.35 4 25.124999999999996 34.5 21.0 19.375 5 26.375 36.925000000000004 20.75 15.950000000000001 6 20.0 40.375 22.15 17.474999999999998 7 19.75 21.875 40.125 18.25 8 19.25 25.775 30.325000000000003 24.65 9 22.15 23.549999999999997 28.875 25.424999999999997 10-14 22.725 29.845 26.775 20.655 15-19 22.93 28.560000000000002 27.315 21.195 20-24 22.455 28.675 27.58 21.29 25-29 21.95 28.115000000000002 28.494999999999997 21.44 30-34 22.525000000000002 27.99 28.095 21.39 35-39 22.335 28.13 28.199999999999996 21.335 40-44 23.02 27.689999999999998 28.139999999999997 21.15 45-49 22.57 28.28 27.900000000000002 21.25 50-54 22.470000000000002 27.750000000000004 28.375 21.404999999999998 55-59 22.79 28.000000000000004 28.025 21.185000000000002 60-64 23.025000000000002 27.93 27.834999999999997 21.21 65-69 22.58 27.99 28.03 21.4 70-74 23.645 28.265 27.24 20.849999999999998 75-79 23.305 27.875 27.625 21.195 80-84 22.439999999999998 28.71 27.66 21.19 85-89 23.18 28.27 26.924999999999997 21.625 90-94 23.085 27.334999999999997 27.474999999999998 22.105 95-99 23.73 28.175 27.665 20.43 100-104 23.425 28.08 27.175 21.32 105-109 23.395 28.144999999999996 27.625 20.835 110-114 23.45 28.065 27.800000000000004 20.685000000000002 115-119 23.505000000000003 28.405 27.279999999999998 20.810000000000002 120-124 23.255 28.384999999999998 27.22 21.14 125-129 23.98 28.67 26.840000000000003 20.51 130-134 23.43 27.800000000000004 27.98 20.79 135-139 24.77 27.275 27.445000000000004 20.51 140-144 24.215 27.750000000000004 27.744999999999997 20.29 145-149 24.159831966393277 28.21564312862572 27.3004600920184 20.324064812962593 150-151 24.7 29.3375 26.5625 19.400000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.5 15 1.0 16 1.0 17 1.0 18 0.5 19 0.0 20 2.5 21 3.0 22 3.0 23 4.5 24 4.5 25 8.5 26 9.5 27 6.5 28 8.0 29 10.0 30 15.0 31 25.0 32 31.5 33 39.5 34 53.5 35 62.0 36 83.0 37 117.0 38 139.0 39 148.5 40 191.5 41 232.5 42 246.5 43 264.0 44 264.5 45 258.5 46 265.0 47 244.5 48 205.0 49 189.0 50 163.5 51 137.5 52 124.0 53 98.5 54 83.0 55 70.0 56 55.5 57 41.5 58 21.0 59 20.0 60 16.5 61 7.0 62 5.0 63 5.0 64 2.5 65 0.5 66 0.0 67 0.0 68 0.0 69 1.0 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.5 78 1.0 79 1.0 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.5 92 0.5 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.02 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 83.55 #Duplication Level Percentage of deduplicated Percentage of total 1 84.1113105924596 70.275 2 12.98623578695392 21.7 3 2.2740873728306403 5.7 4 0.4488330341113106 1.5 5 0.11968880909634949 0.5 6 0.029922202274087373 0.15 7 0.029922202274087373 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTTCGTCCCAAGTGAGAGAAAAGATGTAATCACTTCCACCTTATGCTGGA 7 0.17500000000000002 No Hit AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 6 0.15 No Hit AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 5 0.125 No Hit GGGAGCACTGCATAGCTTACAAGCTTGTAAGAGATGGCTTCCTCCTCTAT 5 0.125 No Hit GGGGAACCTCTTGTTGACACTGTAGATCAGAATCAAATTGTTACAAATTG 5 0.125 No Hit ACCAGGTCCAGACATAGTAAGGATTGACAGACTGAGAGCTCTTTCTTGAT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.037500000000000006 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.16249999999999998 0.0 0.0 0.0 0.0 88-89 0.2375 0.0 0.0 0.0 0.0 90-91 0.2875 0.0 0.0 0.0 0.0 92-93 0.35 0.0 0.0 0.0 0.0 94-95 0.375 0.0 0.0 0.0 0.0 96-97 0.42500000000000004 0.0 0.0 0.0 0.0 98-99 0.4875 0.0 0.0 0.0 0.0 100-101 0.55 0.0 0.0 0.0 0.0 102-103 0.6125 0.0 0.0 0.0 0.0 104-105 0.7 0.0 0.0 0.0 0.0 106-107 0.8 0.0 0.0 0.0 0.0 108-109 0.9 0.0 0.0 0.0 0.0 110-111 1.0499999999999998 0.0 0.0 0.0 0.0 112-113 1.225 0.0 0.0 0.0 0.0 114-115 1.3624999999999998 0.0 0.0 0.0 0.0 116-117 1.5 0.0 0.0 0.0 0.0 118-119 1.7000000000000002 0.0 0.0 0.0 0.0 120-121 2.0125 0.0 0.0 0.0 0.0 122-123 2.1875 0.0 0.0 0.0 0.0 124-125 2.3499999999999996 0.0 0.0 0.0 0.0 126-127 2.5875 0.0 0.0 0.0 0.0 128-129 2.7 0.0 0.0 0.0 0.0 130-131 2.8875 0.0 0.0 0.0 0.0 132-133 3.1625 0.0 0.0 0.0 0.0 134-135 3.3875 0.0 0.0 0.0 0.0 136-137 3.7625 0.0 0.0 0.0 0.0 138-139 4.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGAAGAT 10 0.006830828 145.0 4 >>END_MODULE Read 778755 spots for SRR12671359.sra Written 778755 spots for SRR12671359.sra Read 778755 spots for SRR12671359.sra Written 778755 spots for SRR12671359.sra Read 778755 spots for SRR12671359.sra Written 778755 spots for SRR12671359.sra Read 778755 spots for SRR12671359.sra Written 778755 spots for SRR12671359.sra Read 778755 spots for SRR12671359.sra Written 778755 spots for SRR12671359.sra Read 778755 spots for SRR12671359.sra Written 778755 spots for SRR12671359.sra Read 778755 spots for SRR12671359.sra Written 778755 spots for SRR12671359.sra Read 778755 spots for SRR12671359.sra Written 778755 spots for SRR12671359.sra Read 778755 spots for SRR12671359.sra Written 778755 spots for SRR12671359.sra Read 778755 spots for SRR12671359.sra Written 778755 spots for SRR12671359.sra Read 778755 spots for SRR12671359.sra Written 778755 spots for SRR12671359.sra Read 778755 spots for SRR12671359.sra Written 778755 spots for SRR12671359.sra Read 778755 spots for SRR12671359.sra Written 778755 spots for SRR12671359.sra Read 778769 spots for SRR12671359.sra Written 778769 spots for SRR12671359.sra Read 778755 spots for SRR12671359.sra Written 778755 spots for SRR12671359.sra Read 778755 spots for SRR12671359.sra Written 778755 spots for SRR12671359.sra Read 778755 spots for SRR12671359.sra Written 778755 spots for SRR12671359.sra Read 778755 spots for SRR12671359.sra Written 778755 spots for SRR12671359.sra Read 778755 spots for SRR12671359.sra Written 778755 spots for SRR12671359.sra Read 778755 spots for SRR12671359.sra Written 778755 spots for SRR12671359.sra SRR ids: ['SRR12671359.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_f7ve3v2g SRR12671359.sra spots: 15575114 blocks: [[1, 778755], [778756, 1557510], [1557511, 2336265], [2336266, 3115020], [3115021, 3893775], [3893776, 4672530], [4672531, 5451285], [5451286, 6230040], [6230041, 7008795], [7008796, 7787550], [7787551, 8566305], [8566306, 9345060], [9345061, 10123815], [10123816, 10902570], [10902571, 11681325], [11681326, 12460080], [12460081, 13238835], [13238836, 14017590], [14017591, 14796345], [14796346, 15575114]] SRR12671359 file size 5271404 SRR12671359 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671359 SRR12671359_1.fastq SRR12671359_2.fastq Input file: SRR12671359_1.fastq Paired file: SRR12671359_2.fastq trimmed: SRR12671359-trimmed-pair1.fastq, SRR12671359-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 19:34:13 2025 >> started Tue Feb 11 19:34:31 2025 >> done (18.127s) 15575114 read pairs processed; of these: 127 ( 0.00%) short read pairs filtered out after trimming by size control 3211 ( 0.02%) empty read pairs filtered out after trimming by size control 15571776 (99.98%) read pairs available; of these: 900105 ( 5.78%) trimmed read pairs available after processing 14671671 (94.22%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 10 0.00% 20 10 0.00% 21 11 0.00% 22 14 0.00% 23 9 0.00% 24 9 0.00% 25 13 0.00% 26 12 0.00% 27 16 0.00% 28 11 0.00% 29 15 0.00% 30 19 0.00% 31 17 0.00% 32 25 0.00% 33 16 0.00% 34 20 0.00% 35 21 0.00% 36 14 0.00% 37 12 0.00% 38 17 0.00% 39 14 0.00% 40 20 0.00% 41 27 0.00% 42 28 0.00% 43 31 0.00% 44 23 0.00% 45 30 0.00% 46 22 0.00% 47 29 0.00% 48 35 0.00% 49 50 0.00% 50 53 0.00% 51 60 0.00% 52 79 0.00% 53 69 0.00% 54 60 0.00% 55 70 0.00% 56 89 0.00% 57 98 0.00% 58 98 0.00% 59 133 0.00% 60 128 0.00% 61 173 0.00% 62 175 0.00% 63 221 0.00% 64 262 0.00% 65 300 0.00% 66 314 0.00% 67 396 0.00% 68 376 0.00% 69 450 0.00% 70 555 0.00% 71 565 0.00% 72 648 0.00% 73 737 0.00% 74 844 0.01% 75 927 0.01% 76 1006 0.01% 77 1203 0.01% 78 1318 0.01% 79 1398 0.01% 80 1526 0.01% 81 1705 0.01% 82 1992 0.01% 83 2066 0.01% 84 2267 0.01% 85 2544 0.02% 86 2669 0.02% 87 2946 0.02% 88 3145 0.02% 89 3383 0.02% 90 3679 0.02% 91 3908 0.03% 92 4042 0.03% 93 4441 0.03% 94 4898 0.03% 95 5355 0.03% 96 5358 0.03% 97 5727 0.04% 98 5883 0.04% 99 6140 0.04% 100 6384 0.04% 101 6815 0.04% 102 7144 0.05% 103 7379 0.05% 104 7909 0.05% 105 8259 0.05% 106 8294 0.05% 107 8896 0.06% 108 9091 0.06% 109 9286 0.06% 110 9500 0.06% 111 10027 0.06% 112 10415 0.07% 113 10431 0.07% 114 10865 0.07% 115 11229 0.07% 116 11755 0.08% 117 12313 0.08% 118 12709 0.08% 119 13048 0.08% 120 13644 0.09% 121 14068 0.09% 122 14349 0.09% 123 14382 0.09% 124 15336 0.10% 125 15511 0.10% 126 16068 0.10% 127 16476 0.11% 128 16564 0.11% 129 17150 0.11% 130 17642 0.11% 131 17962 0.12% 132 18325 0.12% 133 18810 0.12% 134 19208 0.12% 135 19491 0.13% 136 20094 0.13% 137 20611 0.13% 138 21304 0.14% 139 21975 0.14% 140 22496 0.14% 141 22691 0.15% 142 22899 0.15% 143 23614 0.15% 144 24128 0.15% 145 24456 0.16% 146 25119 0.16% 147 25609 0.16% 148 26574 0.17% 149 26692 0.17% 150 28021 0.18% 151 14671671 94.22% 15571776 reads passed initial QC criterion=sequence-density sequence-density=0.52 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=26 prefix-density=0.52 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=31.89 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=4.6 sequence=TAAAAGCAGAATCAAGCTTCCGATTAAAGATACATAATTCCATGGAATGGAACCAACAAAGCAGCAGGAAATACAAGACACTTACAGATTACTAGCCATCAAATGAGATCCTGTAGAAAGGATTTGAGGAGGCCATGGCTAGCTAACTGTACTTTAATTTACAGCAAATACTATATTAGACAAACATGGAGTGACCAGACTTCTTCTTTTTATTTATTATAGTTCCATAAAACTGCTTGGTTGGAGCCATGCGGCGACGTTTTCTCATTTGCAGGAGCATGGATCACAGGTGCAGTTTGATCCACATTTGCAGCCATTCTCAGCACCAAAGTTCATCTCAGAGCTCTCGTAGAACATCCTAACTGGAGCTACACCAGCAATGATTGTCTGACTTGTGGTGGTCTCGGAGAAACTCAAGTCTGGGTACATGCTGCATCCATTGCAGCCACTGCCGCACTTGCA criterion=sequence-density sequence-density=1.10 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=28 prefix-density=1.09 prefix-fanout=2.0 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTCTTCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=23.35 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=2.8 sequence=GCCAAAACTCTGCATTTGCTAGCTAGAAGTCACTCTACCCTTCGCATTACTTCCTCAATCAACCACTGCTGTTTGATCATGGCAGCAACCATCTCAACCGTTGGAGCTGTCAACACAGCACCGCTGGCTTTGAATGGCTCTGGCGCTGGATCCACAGTCCCAA SRR12671359 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 19:35:33 Started mapping on | Feb 11 19:35:33 Finished on | Feb 11 19:37:09 Mapping speed, Million of reads per hour | 583.94 Number of input reads | 15571776 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 13969485 Uniquely mapped reads % | 89.71% Average mapped length | 294.69 Number of splices: Total | 14296593 Number of splices: Annotated (sjdb) | 14019444 Number of splices: GT/AG | 14013042 Number of splices: GC/AG | 234138 Number of splices: AT/AC | 7646 Number of splices: Non-canonical | 41767 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.92 Insertion rate per base | 0.02% Insertion average length | 2.22 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 326699 % of reads mapped to multiple loci | 2.10% Number of reads mapped to too many loci | 67890 % of reads mapped to too many loci | 0.44% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 7.64% % of reads unmapped: other | 0.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1275592 1275592 1275592 N_multimapping 326699 326699 326699 N_noFeature 517668 13753239 584782 N_ambiguous 267903 1315 117886 UnstrandedReadsAssigned:13183914 PositiveStrandReadsAssigned:214931 NegativeStrandReadsAssigned:13266817 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671359 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671359-trimmed-pair1.fastq SRR12671359-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,571,776 reads, 13,820,327 reads pseudoaligned [quant] estimated average fragment length: 286.929 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,084 rounds 52401 SRR12671359.ke.tsv 34699 SRR12671359.se.tsv 87100 total ==> SRR12671359.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1732.07 555 21.259 Potri.005G024800.1.v4.1 1035 749.071 194 17.1828 Potri.004G059700.1.v4.1 961 675.23 0 0 Potri.007G009000.2.v4.1 1416 1130.07 0 0 Potri.003G141000.2.v4.1 2943 2657.07 1039 25.9434 Potri.016G087400.1.v4.1 270 76.6951 646 558.83 Potri.015G069301.1.v4.1 564 295.944 0 0 Potri.010G195200.1.v4.1 1773 1487.07 68 3.03383 Potri.012G127500.1.v4.1 977 691.17 58 5.56747 ==> SRR12671359.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 75 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 153 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR12671359 completed mapping pipeline successfully