Starting /dee2/code/volunteer_pipeline.sh SRR12671360 current disk space = 3053053095936 free memory = 1579744780 SRR12671360 SRAfilesize f380c00cd8f2e735ac1972bc7bbb94c0 SRR12671360.sra SRR12671360.sra file validated SRR12671360 is paired end SRR12671360 is conventional basespace SRR12671360 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671360_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.678 37.0 37.0 37.0 37.0 37.0 2 36.45875 37.0 37.0 37.0 37.0 37.0 3 36.5765 37.0 37.0 37.0 37.0 37.0 4 36.623 37.0 37.0 37.0 37.0 37.0 5 36.638 37.0 37.0 37.0 37.0 37.0 6 36.614 37.0 37.0 37.0 37.0 37.0 7 36.5845 37.0 37.0 37.0 37.0 37.0 8 36.6555 37.0 37.0 37.0 37.0 37.0 9 36.6145 37.0 37.0 37.0 37.0 37.0 10-14 36.6667 37.0 37.0 37.0 37.0 37.0 15-19 36.649699999999996 37.0 37.0 37.0 37.0 37.0 20-24 36.640100000000004 37.0 37.0 37.0 37.0 37.0 25-29 36.5855 37.0 37.0 37.0 37.0 37.0 30-34 36.5501 37.0 37.0 37.0 37.0 37.0 35-39 36.520900000000005 37.0 37.0 37.0 37.0 37.0 40-44 36.5099 37.0 37.0 37.0 37.0 37.0 45-49 36.507400000000004 37.0 37.0 37.0 37.0 37.0 50-54 36.509699999999995 37.0 37.0 37.0 37.0 37.0 55-59 36.4161 37.0 37.0 37.0 37.0 37.0 60-64 36.4086 37.0 37.0 37.0 37.0 37.0 65-69 36.40599999999999 37.0 37.0 37.0 37.0 37.0 70-74 36.4054 37.0 37.0 37.0 37.0 37.0 75-79 36.3917 37.0 37.0 37.0 37.0 37.0 80-84 36.396 37.0 37.0 37.0 37.0 37.0 85-89 36.332100000000004 37.0 37.0 37.0 37.0 37.0 90-94 36.3363 37.0 37.0 37.0 37.0 37.0 95-99 36.3104 37.0 37.0 37.0 37.0 37.0 100-104 36.2785 37.0 37.0 37.0 37.0 37.0 105-109 36.302200000000006 37.0 37.0 37.0 37.0 37.0 110-114 36.2316 37.0 37.0 37.0 37.0 37.0 115-119 36.2494 37.0 37.0 37.0 37.0 37.0 120-124 36.1736 37.0 37.0 37.0 37.0 37.0 125-129 36.166399999999996 37.0 37.0 37.0 37.0 37.0 130-134 36.0871 37.0 37.0 37.0 37.0 37.0 135-139 35.9111 37.0 37.0 37.0 37.0 37.0 140-144 35.7356 37.0 37.0 37.0 37.0 37.0 145-149 35.7195 37.0 37.0 37.0 37.0 37.0 150-151 35.511250000000004 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 0.0 20 0.0 21 0.0 22 2.0 23 1.0 24 1.0 25 0.0 26 2.0 27 6.0 28 8.0 29 14.0 30 17.0 31 36.0 32 32.0 33 82.0 34 128.0 35 266.0 36 2904.0 37 500.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.4 9.475 8.225 38.9 2 21.03284031085485 12.008022060666834 34.31937829029832 32.63975933818 3 17.349999999999998 19.775000000000002 26.474999999999998 36.4 4 24.925 25.2 22.425 27.450000000000003 5 24.825 29.575000000000003 23.275000000000002 22.325 6 18.05 36.775000000000006 23.775 21.4 7 13.825000000000001 26.650000000000002 43.5 16.025 8 17.075000000000003 25.55 30.4 26.974999999999998 9 17.05 24.05 34.575 24.325 10-14 20.294999999999998 29.654999999999998 26.784999999999997 23.265 15-19 20.415 27.93 27.775 23.880000000000003 20-24 20.385 28.76 27.51 23.345 25-29 20.244999999999997 28.455000000000002 27.18 24.12 30-34 20.865000000000002 28.71 27.255000000000003 23.169999999999998 35-39 20.965 28.205000000000002 27.200000000000003 23.630000000000003 40-44 20.365 29.104999999999997 26.584999999999997 23.945 45-49 20.325 28.65 27.060000000000002 23.965 50-54 20.965 27.88 27.860000000000003 23.294999999999998 55-59 20.235 28.060000000000002 27.63 24.075 60-64 20.075000000000003 28.075 27.395000000000003 24.455 65-69 20.365 28.050000000000004 27.55 24.035 70-74 20.935000000000002 28.199999999999996 27.189999999999998 23.674999999999997 75-79 21.145 28.105000000000004 26.76 23.990000000000002 80-84 20.41 28.53 27.435 23.625 85-89 20.61 28.505000000000003 27.305 23.580000000000002 90-94 20.875 28.405 27.265 23.455000000000002 95-99 20.169999999999998 28.285 27.665 23.880000000000003 100-104 20.41 28.439999999999998 27.055 24.095 105-109 20.695 28.360000000000003 27.05 23.895 110-114 21.69 28.660000000000004 26.1 23.549999999999997 115-119 21.355 28.22 26.47 23.955000000000002 120-124 21.745 28.585 25.8 23.87 125-129 21.775 28.58 25.94 23.705000000000002 130-134 21.88 28.199999999999996 25.665 24.255 135-139 22.185 27.534999999999997 26.305 23.974999999999998 140-144 21.78 27.655 26.495 24.07 145-149 21.125 27.744999999999997 27.495000000000005 23.635 150-151 21.2875 27.700000000000003 26.900000000000002 24.1125 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 0.5 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 1.5 17 0.5 18 0.0 19 0.0 20 1.0 21 1.0 22 1.5 23 3.5 24 5.0 25 5.0 26 5.5 27 9.0 28 8.5 29 11.5 30 18.0 31 23.0 32 31.0 33 40.5 34 45.5 35 67.5 36 86.5 37 99.0 38 117.5 39 131.0 40 157.0 41 194.0 42 223.0 43 243.0 44 241.5 45 251.5 46 270.0 47 257.5 48 244.0 49 215.0 50 185.5 51 151.0 52 122.5 53 113.5 54 93.5 55 69.5 56 66.0 57 64.5 58 45.0 59 28.0 60 15.5 61 8.0 62 6.5 63 4.5 64 2.0 65 3.0 66 3.0 67 2.0 68 2.0 69 1.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.27499999999999997 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 85.375 #Duplication Level Percentage of deduplicated Percentage of total 1 86.03221083455344 73.45 2 11.537335285505126 19.7 3 1.815519765739385 4.65 4 0.49780380673499264 1.7000000000000002 5 0.1171303074670571 0.5 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTCCAAAGTAGCACCTACAATGGACCTTGAGTAAGGTTTTTTCGTGGCGC 5 0.125 No Hit TGAGATTTTCGCAGTGTCCAACATAAGCATTCGATACATACAAGTAAATG 5 0.125 No Hit ACCAGCTCCCCAGCCACCAGGAAAAGCTTCCCTGCCAGGTGAGTTTTGGA 5 0.125 No Hit CTCCACAACGCTACAGGTGCTTTATGAACCCCGAAGCTATGCACAGCGTT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.0625 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1125 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.175 0.0 0.0 0.0 0.0 76-77 0.225 0.0 0.0 0.0 0.0 78-79 0.3125 0.0 0.0 0.0 0.0 80-81 0.4375 0.0 0.0 0.0 0.0 82-83 0.625 0.0 0.0 0.0 0.0 84-85 0.7875 0.0 0.0 0.0 0.0 86-87 0.925 0.0 0.0 0.0 0.0 88-89 1.15 0.0 0.0 0.0 0.0 90-91 1.4874999999999998 0.0 0.0 0.0 0.0 92-93 1.75 0.0 0.0 0.0 0.0 94-95 1.975 0.0 0.0 0.0 0.0 96-97 2.2625 0.0 0.0 0.0 0.0 98-99 2.7 0.0 0.0 0.0 0.0 100-101 2.9125 0.0 0.0 0.0 0.0 102-103 3.3375 0.0 0.0 0.0 0.0 104-105 3.6625 0.0 0.0 0.0 0.0 106-107 4.1 0.0 0.0 0.0 0.0 108-109 4.7125 0.0 0.0 0.0 0.0 110-111 5.2875 0.0 0.0 0.0 0.0 112-113 5.8375 0.0 0.0 0.0 0.0 114-115 6.512499999999999 0.0 0.0 0.0 0.0 116-117 7.1125 0.0 0.0 0.0 0.0 118-119 7.675 0.0 0.0 0.0 0.0 120-121 8.25 0.0 0.0 0.0 0.0 122-123 8.9 0.0 0.0 0.0 0.0 124-125 9.475000000000001 0.0 0.0 0.0 0.0 126-127 10.3625 0.0 0.0 0.0 0.0 128-129 11.05 0.0 0.0 0.0 0.0 130-131 11.899999999999999 0.0 0.0 0.0 0.0 132-133 12.625 0.0 0.0 0.0 0.0 134-135 13.212499999999999 0.0 0.0 0.0 0.0 136-137 13.7 0.0 0.0 0.0 0.0 138-139 14.5 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AACGCTA 10 0.006830828 145.0 7 GTGTTTC 10 0.006830828 145.0 3 CCAACGA 10 0.006830828 145.0 9 ACGCTAC 10 0.006830828 145.0 8 AGCTTGA 10 0.006830828 145.0 145 CACAACG 10 0.006830828 145.0 4 TGTTTCC 10 0.006830828 145.0 4 GTTTCCA 10 0.006830828 145.0 5 GCTCGGG 10 0.006830828 145.0 145 CTGTGTT 10 0.006830828 145.0 1 CCACAAC 10 0.006830828 145.0 3 TGTGTTT 10 0.006830828 145.0 2 ACAACGC 10 0.006830828 145.0 5 GATCCCC 20 0.00593511 29.0 70-74 >>END_MODULE SRR12671360 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671360_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.443 37.0 37.0 37.0 37.0 37.0 2 36.143 37.0 37.0 37.0 37.0 37.0 3 36.2865 37.0 37.0 37.0 37.0 37.0 4 36.313 37.0 37.0 37.0 37.0 37.0 5 36.26 37.0 37.0 37.0 37.0 37.0 6 36.2605 37.0 37.0 37.0 37.0 37.0 7 36.4175 37.0 37.0 37.0 37.0 37.0 8 36.3775 37.0 37.0 37.0 37.0 37.0 9 36.3435 37.0 37.0 37.0 37.0 37.0 10-14 36.3 37.0 37.0 37.0 37.0 37.0 15-19 36.2992 37.0 37.0 37.0 37.0 37.0 20-24 36.213499999999996 37.0 37.0 37.0 37.0 37.0 25-29 36.1922 37.0 37.0 37.0 37.0 37.0 30-34 36.1774 37.0 37.0 37.0 37.0 37.0 35-39 36.1231 37.0 37.0 37.0 37.0 37.0 40-44 36.111399999999996 37.0 37.0 37.0 37.0 37.0 45-49 36.096799999999995 37.0 37.0 37.0 37.0 37.0 50-54 36.1177 37.0 37.0 37.0 37.0 37.0 55-59 36.0705 37.0 37.0 37.0 37.0 37.0 60-64 36.0086 37.0 37.0 37.0 37.0 37.0 65-69 36.0787 37.0 37.0 37.0 37.0 37.0 70-74 36.003499999999995 37.0 37.0 37.0 37.0 37.0 75-79 35.976800000000004 37.0 37.0 37.0 37.0 37.0 80-84 35.9194 37.0 37.0 37.0 37.0 37.0 85-89 35.9528 37.0 37.0 37.0 37.0 37.0 90-94 35.9219 37.0 37.0 37.0 37.0 37.0 95-99 35.9273 37.0 37.0 37.0 37.0 37.0 100-104 35.9095 37.0 37.0 37.0 37.0 37.0 105-109 35.784299999999995 37.0 37.0 37.0 37.0 37.0 110-114 35.802099999999996 37.0 37.0 37.0 37.0 37.0 115-119 35.8971 37.0 37.0 37.0 37.0 37.0 120-124 35.7302 37.0 37.0 37.0 37.0 37.0 125-129 35.605599999999995 37.0 37.0 37.0 37.0 37.0 130-134 35.550399999999996 37.0 37.0 37.0 37.0 37.0 135-139 35.3411 37.0 37.0 37.0 34.6 37.0 140-144 35.368399999999994 37.0 37.0 37.0 37.0 37.0 145-149 35.2257 37.0 37.0 37.0 34.6 37.0 150-151 34.977000000000004 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 3.0 14 6.0 15 6.0 16 6.0 17 3.0 18 3.0 19 2.0 20 3.0 21 3.0 22 4.0 23 3.0 24 7.0 25 8.0 26 9.0 27 6.0 28 7.0 29 13.0 30 25.0 31 32.0 32 38.0 33 86.0 34 183.0 35 457.0 36 2739.0 37 346.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.8 18.6 13.25 24.349999999999998 2 30.599999999999998 23.825 28.225 17.349999999999998 3 22.075 27.125 30.075000000000003 20.724999999999998 4 26.700000000000003 32.45 22.5 18.35 5 27.0 36.15 20.200000000000003 16.650000000000002 6 22.35 37.65 22.775000000000002 17.224999999999998 7 20.45 22.125 37.325 20.1 8 22.025 24.95 26.900000000000002 26.125 9 23.35 23.974999999999998 29.675 23.0 10-14 24.325 29.415000000000003 25.735000000000003 20.525 15-19 23.995 27.875 26.775 21.355 20-24 24.0 28.115000000000002 27.375 20.51 25-29 23.36 28.315 28.035 20.29 30-34 23.815 27.275 28.16 20.75 35-39 23.599999999999998 27.18 27.87 21.349999999999998 40-44 23.919999999999998 28.285 27.595 20.200000000000003 45-49 23.415 27.07 28.194999999999997 21.32 50-54 23.46 27.92 27.74 20.880000000000003 55-59 23.74 27.279999999999998 27.944999999999997 21.035 60-64 23.9 27.57 27.750000000000004 20.78 65-69 23.89 27.145000000000003 27.689999999999998 21.275 70-74 23.515 28.155 27.38 20.95 75-79 23.705000000000002 27.66 27.485 21.15 80-84 24.12 27.555000000000003 27.195000000000004 21.13 85-89 24.104999999999997 27.800000000000004 26.86 21.235 90-94 24.715 27.22 26.875 21.19 95-99 23.625 28.345 27.060000000000002 20.97 100-104 24.2 27.685 27.485 20.630000000000003 105-109 24.104999999999997 27.55 27.93 20.415 110-114 24.695 27.794999999999998 26.755000000000003 20.755000000000003 115-119 25.185000000000002 28.095 26.505000000000003 20.215 120-124 25.69 28.155 26.040000000000003 20.115 125-129 26.150000000000002 27.55 26.41 19.89 130-134 26.85 27.315 26.565 19.27 135-139 26.974999999999998 27.794999999999998 25.895000000000003 19.335 140-144 27.66 27.07 25.785000000000004 19.485 145-149 28.48284828482848 27.102710271027103 25.16251625162516 19.251925192519252 150-151 28.9375 26.7125 24.9125 19.4375 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.5 7 0.5 8 1.0 9 1.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.5 15 2.5 16 2.5 17 0.5 18 1.0 19 2.0 20 2.0 21 1.0 22 2.0 23 3.0 24 2.5 25 1.5 26 3.0 27 6.0 28 9.5 29 12.5 30 13.5 31 18.0 32 20.5 33 30.5 34 44.5 35 60.5 36 71.5 37 91.0 38 116.0 39 146.5 40 185.0 41 202.0 42 220.5 43 247.5 44 257.0 45 246.5 46 252.5 47 272.5 48 248.0 49 205.0 50 178.5 51 158.5 52 136.5 53 111.5 54 95.5 55 74.0 56 52.5 57 44.5 58 36.0 59 29.5 60 21.5 61 10.5 62 7.5 63 4.5 64 3.5 65 2.5 66 2.5 67 2.5 68 1.5 69 1.0 70 0.5 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.5 78 0.5 79 0.5 80 1.0 81 1.5 82 1.0 83 0.0 84 0.5 85 0.5 86 0.0 87 0.5 88 0.5 89 0.5 90 0.5 91 0.0 92 0.5 93 1.0 94 0.5 95 0.0 96 1.5 97 2.0 98 0.5 99 0.5 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.01 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 85.2 #Duplication Level Percentage of deduplicated Percentage of total 1 86.09154929577466 73.35000000000001 2 11.443661971830986 19.5 3 1.7605633802816902 4.5 4 0.4988262910798122 1.7000000000000002 5 0.14671361502347416 0.625 6 0.029342723004694836 0.15 7 0.029342723004694836 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAGAACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 7 0.17500000000000002 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 6 0.15 No Hit CTGCATAGCTTATAAGCTTGTAAGAGATGGCTTCCTCCTCTATGATCTCA 5 0.125 No Hit CCCTGCCAAAAAATCAGTAGCTGCTGCCGCCATGGTTCTCAAGACTGAAC 5 0.125 No Hit GGCTTCCTCCTCTATGATCTCATCGGCAGCCGTTGCCACCGTCAACCGCA 5 0.125 No Hit ATCTGACCTACACATTTGGCTCGGATGGTGTCCAAGTTGTTGATATGGAC 5 0.125 No Hit GTGGCAATGAGAGGCGGGATTCTGGTTATGATAAGCCCAGATGGGATTCA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.0625 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1125 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.2 0.0 0.0 0.0 0.0 76-77 0.25 0.0 0.0 0.0 0.0 78-79 0.3375 0.0 0.0 0.0 0.0 80-81 0.4625 0.0 0.0 0.0 0.0 82-83 0.6375 0.0 0.0 0.0 0.0 84-85 0.7875 0.0 0.0 0.0 0.0 86-87 0.925 0.0 0.0 0.0 0.0 88-89 1.1625 0.0 0.0 0.0 0.0 90-91 1.5375 0.0 0.0 0.0 0.0 92-93 1.8 0.0 0.0 0.0 0.0 94-95 2.025 0.0 0.0 0.0 0.0 96-97 2.3125 0.0 0.0 0.0 0.0 98-99 2.75 0.0 0.0 0.0 0.0 100-101 2.9625 0.0 0.0 0.0 0.0 102-103 3.3875 0.0 0.0 0.0 0.0 104-105 3.7125 0.0 0.0 0.0 0.0 106-107 4.1625 0.0 0.0 0.0 0.0 108-109 4.7875 0.0 0.0 0.0 0.0 110-111 5.4125 0.0 0.0 0.0 0.0 112-113 5.9625 0.0 0.0 0.0 0.0 114-115 6.5875 0.0 0.0 0.0 0.0 116-117 7.1875 0.0 0.0 0.0 0.0 118-119 7.75 0.0 0.0 0.0 0.0 120-121 8.325 0.0 0.0 0.0 0.0 122-123 8.975 0.0 0.0 0.0 0.0 124-125 9.55 0.0 0.0 0.0 0.0 126-127 10.4125 0.0 0.0 0.0 0.0 128-129 11.1125 0.0 0.0 0.0 0.0 130-131 11.975000000000001 0.0 0.0 0.0 0.0 132-133 12.7 0.0 0.0 0.0 0.0 134-135 13.287500000000001 0.0 0.0 0.0 0.0 136-137 13.774999999999999 0.0 0.0 0.0 0.0 138-139 14.575 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTACACA 10 0.006830828 145.0 8 TGACCTA 10 0.006830828 145.0 4 GAAGTGG 10 0.006830828 145.0 9 AGGAATC 10 0.006830828 145.0 3 GTCGAGA 10 0.006830828 145.0 145 CCTTGCT 10 0.006830828 145.0 145 TACACAT 10 0.006830828 145.0 9 ACATTCA 10 0.006830828 145.0 8 AGAACAC 10 0.006830828 145.0 3 TGAAGTG 10 0.006830828 145.0 8 TCTGACC 10 0.006830828 145.0 2 ACCTACA 10 0.006830828 145.0 6 GACCTAC 10 0.006830828 145.0 5 ATCAATC 20 0.00593511 29.0 50-54 GGGGGGG 245 3.274181E-11 11.244898 140-144 >>END_MODULE Read 783367 spots for SRR12671360.sra Written 783367 spots for SRR12671360.sra Read 783367 spots for SRR12671360.sra Written 783367 spots for SRR12671360.sra Read 783367 spots for SRR12671360.sra Written 783367 spots for SRR12671360.sra Read 783367 spots for SRR12671360.sra Written 783367 spots for SRR12671360.sra Read 783367 spots for SRR12671360.sra Written 783367 spots for SRR12671360.sra Read 783367 spots for SRR12671360.sra Written 783367 spots for SRR12671360.sra Read 783367 spots for SRR12671360.sra Written 783367 spots for SRR12671360.sra Read 783367 spots for SRR12671360.sra Written 783367 spots for SRR12671360.sra Read 783367 spots for SRR12671360.sra Written 783367 spots for SRR12671360.sra Read 783367 spots for SRR12671360.sra Written 783367 spots for SRR12671360.sra Read 783367 spots for SRR12671360.sra Written 783367 spots for SRR12671360.sra Read 783367 spots for SRR12671360.sra Written 783367 spots for SRR12671360.sra Read 783367 spots for SRR12671360.sra Written 783367 spots for SRR12671360.sra Read 783367 spots for SRR12671360.sra Written 783367 spots for SRR12671360.sra Read 783382 spots for SRR12671360.sra Written 783382 spots for SRR12671360.sra Read 783367 spots for SRR12671360.sra Written 783367 spots for SRR12671360.sra Read 783367 spots for SRR12671360.sra Written 783367 spots for SRR12671360.sra Read 783367 spots for SRR12671360.sra Written 783367 spots for SRR12671360.sra Read 783367 spots for SRR12671360.sra Written 783367 spots for SRR12671360.sra Read 783367 spots for SRR12671360.sra Written 783367 spots for SRR12671360.sra SRR ids: ['SRR12671360.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_eh55rgo3 SRR12671360.sra spots: 15667355 blocks: [[1, 783367], [783368, 1566734], [1566735, 2350101], [2350102, 3133468], [3133469, 3916835], [3916836, 4700202], [4700203, 5483569], [5483570, 6266936], [6266937, 7050303], [7050304, 7833670], [7833671, 8617037], [8617038, 9400404], [9400405, 10183771], [10183772, 10967138], [10967139, 11750505], [11750506, 12533872], [12533873, 13317239], [13317240, 14100606], [14100607, 14883973], [14883974, 15667355]] SRR12671360 file size 5302752 SRR12671360 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671360 SRR12671360_1.fastq SRR12671360_2.fastq Input file: SRR12671360_1.fastq Paired file: SRR12671360_2.fastq trimmed: SRR12671360-trimmed-pair1.fastq, SRR12671360-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 20:34:46 2025 >> started Tue Feb 11 20:35:03 2025 >> done (16.390s) 15667355 read pairs processed; of these: 144 ( 0.00%) short read pairs filtered out after trimming by size control 16133 ( 0.10%) empty read pairs filtered out after trimming by size control 15651078 (99.90%) read pairs available; of these: 2805180 (17.92%) trimmed read pairs available after processing 12845898 (82.08%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 11 0.00% 19 16 0.00% 20 13 0.00% 21 15 0.00% 22 13 0.00% 23 10 0.00% 24 5 0.00% 25 12 0.00% 26 13 0.00% 27 19 0.00% 28 11 0.00% 29 18 0.00% 30 16 0.00% 31 9 0.00% 32 19 0.00% 33 13 0.00% 34 15 0.00% 35 10 0.00% 36 25 0.00% 37 21 0.00% 38 13 0.00% 39 22 0.00% 40 29 0.00% 41 38 0.00% 42 43 0.00% 43 33 0.00% 44 45 0.00% 45 54 0.00% 46 62 0.00% 47 65 0.00% 48 92 0.00% 49 101 0.00% 50 153 0.00% 51 127 0.00% 52 169 0.00% 53 189 0.00% 54 190 0.00% 55 238 0.00% 56 258 0.00% 57 319 0.00% 58 354 0.00% 59 451 0.00% 60 551 0.00% 61 657 0.00% 62 704 0.00% 63 818 0.01% 64 882 0.01% 65 1055 0.01% 66 1176 0.01% 67 1279 0.01% 68 1622 0.01% 69 1711 0.01% 70 2134 0.01% 71 2464 0.02% 72 2951 0.02% 73 3174 0.02% 74 3559 0.02% 75 3753 0.02% 76 4171 0.03% 77 4651 0.03% 78 5196 0.03% 79 5714 0.04% 80 6183 0.04% 81 7082 0.05% 82 8114 0.05% 83 8709 0.06% 84 9844 0.06% 85 10524 0.07% 86 11153 0.07% 87 11599 0.07% 88 12610 0.08% 89 13385 0.09% 90 14467 0.09% 91 15601 0.10% 92 16237 0.10% 93 17420 0.11% 94 19070 0.12% 95 20302 0.13% 96 20888 0.13% 97 21696 0.14% 98 22085 0.14% 99 23359 0.15% 100 24335 0.16% 101 25397 0.16% 102 27050 0.17% 103 27611 0.18% 104 28962 0.19% 105 30233 0.19% 106 31403 0.20% 107 32658 0.21% 108 33077 0.21% 109 33894 0.22% 110 34125 0.22% 111 35557 0.23% 112 37012 0.24% 113 37749 0.24% 114 39893 0.25% 115 40732 0.26% 116 42265 0.27% 117 43720 0.28% 118 43824 0.28% 119 44524 0.28% 120 45059 0.29% 121 46598 0.30% 122 46924 0.30% 123 48508 0.31% 124 49704 0.32% 125 50092 0.32% 126 51693 0.33% 127 52305 0.33% 128 52738 0.34% 129 53382 0.34% 130 54086 0.35% 131 54323 0.35% 132 54998 0.35% 133 56054 0.36% 134 57095 0.36% 135 57679 0.37% 136 58846 0.38% 137 59022 0.38% 138 59392 0.38% 139 61292 0.39% 140 60584 0.39% 141 60890 0.39% 142 61614 0.39% 143 62199 0.40% 144 63520 0.41% 145 63367 0.40% 146 64434 0.41% 147 65000 0.42% 148 66469 0.42% 149 64949 0.41% 150 66464 0.42% 151 12845898 82.08% 15651078 reads passed initial QC criterion=sequence-density sequence-density=0.45 sequence-density-rank=1 fanout-score=2.19 fanout-score-rank=17 prefix-density=0.47 prefix-fanout=2.1 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.02 sequence-density-rank=26 fanout-score=202.67 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=14.4 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAG criterion=sequence-density sequence-density=1.10 sequence-density-rank=1 fanout-score=2.08 fanout-score-rank=27 prefix-density=1.10 prefix-fanout=2.1 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTCTTCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=14.47 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=2.1 sequence=CCACCACTAAACCCAAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTCCTCCCCTTCGCTAGCCGGAAAGGCGGTGAAGCTCAACCCCTCCTCCTCTGAGATCATGGGCAATGGCCGTGTCTCCATGAGGAAAACCACCAAGCCTGTTCCCTCCGGGAGCCCATGGTACGGACCAGACCGTGTTAAATACTTGGGCCCGTTCTCTGGTGAGCCCCCATCCTACTTGACTGGTGAGTTCCCTGGTGACTACGGCTGGGACACTGCTGG SRR12671360 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 20:35:46 Started mapping on | Feb 11 20:35:46 Finished on | Feb 11 20:37:59 Mapping speed, Million of reads per hour | 423.64 Number of input reads | 15651078 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 14309103 Uniquely mapped reads % | 91.43% Average mapped length | 290.82 Number of splices: Total | 13308089 Number of splices: Annotated (sjdb) | 13036950 Number of splices: GT/AG | 13034664 Number of splices: GC/AG | 219868 Number of splices: AT/AC | 8921 Number of splices: Non-canonical | 44636 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.96 Insertion rate per base | 0.02% Insertion average length | 2.12 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 453573 % of reads mapped to multiple loci | 2.90% Number of reads mapped to too many loci | 74750 % of reads mapped to too many loci | 0.48% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.97% % of reads unmapped: other | 0.22% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 888402 888402 888402 N_multimapping 453573 453573 453573 N_noFeature 536307 14027076 659957 N_ambiguous 251145 1319 91828 UnstrandedReadsAssigned:13521651 PositiveStrandReadsAssigned:280708 NegativeStrandReadsAssigned:13557318 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671360 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671360-trimmed-pair1.fastq SRR12671360-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,651,078 reads, 13,665,333 reads pseudoaligned [quant] estimated average fragment length: 232.037 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,033 rounds 52401 SRR12671360.ke.tsv 34699 SRR12671360.se.tsv 87100 total ==> SRR12671360.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1786.96 537 18.9379 Potri.005G024800.1.v4.1 1035 803.963 195 15.2852 Potri.004G059700.1.v4.1 961 730.059 0 0 Potri.007G009000.2.v4.1 1416 1184.96 0 0 Potri.003G141000.2.v4.1 2943 2711.96 837.575 19.4631 Potri.016G087400.1.v4.1 270 97.1778 652 422.818 Potri.015G069301.1.v4.1 564 343.507 0 0 Potri.010G195200.1.v4.1 1773 1541.96 53 2.16608 Potri.012G127500.1.v4.1 977 745.992 71 5.99787 ==> SRR12671360.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 120 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 302 Potri.001G212900.v4.1 57 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR12671360 completed mapping pipeline successfully