Starting /dee2/code/volunteer_pipeline.sh SRR12671361 current disk space = 3053538951168 free memory = 1403914784 SRR12671361 SRAfilesize 848e6281939c3581dd0e1e7279fcab1c SRR12671361.sra SRR12671361.sra file validated SRR12671361 is paired end SRR12671361 is conventional basespace SRR12671361 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671361_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.6 37.0 37.0 37.0 37.0 37.0 2 36.3225 37.0 37.0 37.0 37.0 37.0 3 36.5365 37.0 37.0 37.0 37.0 37.0 4 36.603 37.0 37.0 37.0 37.0 37.0 5 36.6525 37.0 37.0 37.0 37.0 37.0 6 36.561 37.0 37.0 37.0 37.0 37.0 7 36.521 37.0 37.0 37.0 37.0 37.0 8 36.5915 37.0 37.0 37.0 37.0 37.0 9 36.63 37.0 37.0 37.0 37.0 37.0 10-14 36.613099999999996 37.0 37.0 37.0 37.0 37.0 15-19 36.5708 37.0 37.0 37.0 37.0 37.0 20-24 36.5287 37.0 37.0 37.0 37.0 37.0 25-29 36.507600000000004 37.0 37.0 37.0 37.0 37.0 30-34 36.5074 37.0 37.0 37.0 37.0 37.0 35-39 36.4732 37.0 37.0 37.0 37.0 37.0 40-44 36.4408 37.0 37.0 37.0 37.0 37.0 45-49 36.4114 37.0 37.0 37.0 37.0 37.0 50-54 36.405100000000004 37.0 37.0 37.0 37.0 37.0 55-59 36.3547 37.0 37.0 37.0 37.0 37.0 60-64 36.3489 37.0 37.0 37.0 37.0 37.0 65-69 36.3271 37.0 37.0 37.0 37.0 37.0 70-74 36.36900000000001 37.0 37.0 37.0 37.0 37.0 75-79 36.3537 37.0 37.0 37.0 37.0 37.0 80-84 36.343 37.0 37.0 37.0 37.0 37.0 85-89 36.304899999999996 37.0 37.0 37.0 37.0 37.0 90-94 36.3211 37.0 37.0 37.0 37.0 37.0 95-99 36.2689 37.0 37.0 37.0 37.0 37.0 100-104 36.2023 37.0 37.0 37.0 37.0 37.0 105-109 36.21 37.0 37.0 37.0 37.0 37.0 110-114 36.1432 37.0 37.0 37.0 37.0 37.0 115-119 36.1537 37.0 37.0 37.0 37.0 37.0 120-124 36.1004 37.0 37.0 37.0 37.0 37.0 125-129 36.060500000000005 37.0 37.0 37.0 37.0 37.0 130-134 36.0072 37.0 37.0 37.0 37.0 37.0 135-139 36.0338 37.0 37.0 37.0 37.0 37.0 140-144 35.8895 37.0 37.0 37.0 37.0 37.0 145-149 35.8403 37.0 37.0 37.0 37.0 37.0 150-151 35.77175 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 2.0 22 3.0 23 3.0 24 1.0 25 1.0 26 1.0 27 3.0 28 7.0 29 11.0 30 27.0 31 23.0 32 49.0 33 71.0 34 112.0 35 326.0 36 2974.0 37 386.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 50.6 10.125 4.7 34.575 2 20.73109664496745 11.992989484226339 35.728592889333996 31.54732098147221 3 18.475 18.975 27.750000000000004 34.8 4 23.5 24.95 23.474999999999998 28.075 5 24.325 32.5 23.875 19.3 6 20.5 32.225 24.875 22.400000000000002 7 15.8 26.474999999999998 41.75 15.975 8 16.75 24.45 33.675 25.124999999999996 9 17.275 23.549999999999997 34.475 24.7 10-14 19.645000000000003 29.565 27.950000000000003 22.84 15-19 20.09 28.139999999999997 28.03 23.74 20-24 20.549999999999997 28.005000000000003 27.884999999999998 23.56 25-29 19.415 28.315 28.57 23.7 30-34 20.44 28.58 27.584999999999997 23.395 35-39 19.96 28.075 27.800000000000004 24.165 40-44 19.68 28.655 27.744999999999997 23.919999999999998 45-49 20.424999999999997 28.115000000000002 27.52 23.94 50-54 20.305 28.365000000000002 28.139999999999997 23.189999999999998 55-59 20.26 28.355000000000004 27.51 23.875 60-64 19.64 27.87 28.205000000000002 24.285 65-69 19.81 28.025 28.175 23.990000000000002 70-74 20.674999999999997 27.855 27.79 23.68 75-79 20.97 28.115000000000002 27.224999999999998 23.69 80-84 20.75 28.405 27.544999999999998 23.3 85-89 20.674999999999997 28.904999999999998 27.165 23.255 90-94 21.29 28.01 27.05 23.65 95-99 19.875 28.365000000000002 28.425 23.335 100-104 21.245 27.32 28.335 23.1 105-109 21.43 27.96 27.68 22.93 110-114 21.05 27.87 27.87 23.21 115-119 21.23 28.055000000000003 26.935 23.78 120-124 20.925 28.794999999999998 27.200000000000003 23.080000000000002 125-129 21.065 28.08 27.79 23.064999999999998 130-134 20.355 28.7 27.42 23.525 135-139 21.145 27.450000000000003 27.855 23.549999999999997 140-144 20.66 27.950000000000003 27.455000000000002 23.935000000000002 145-149 21.365000000000002 27.315 27.145000000000003 24.175 150-151 20.9375 27.875 27.175 24.0125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.5 9 0.5 10 0.5 11 0.5 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.5 18 0.5 19 0.5 20 1.0 21 1.0 22 0.5 23 1.5 24 2.5 25 4.5 26 5.5 27 6.0 28 10.5 29 16.5 30 21.0 31 24.0 32 27.5 33 39.0 34 50.5 35 62.5 36 75.5 37 92.0 38 128.5 39 149.0 40 184.5 41 218.5 42 239.0 43 273.5 44 258.5 45 246.5 46 256.5 47 255.0 48 225.5 49 208.5 50 200.5 51 151.5 52 125.5 53 110.0 54 78.0 55 56.0 56 44.0 57 37.0 58 31.5 59 23.0 60 13.5 61 6.0 62 6.0 63 6.0 64 3.5 65 6.0 66 6.0 67 2.0 68 1.5 69 1.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.15 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 85.1 #Duplication Level Percentage of deduplicated Percentage of total 1 85.9870740305523 73.175 2 11.28084606345476 19.2 3 2.0857814336075204 5.325 4 0.5287896592244419 1.7999999999999998 5 0.11750881316098707 0.5 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTGCAATTTCCTTTAGCTCATCGCGATACCTAGTTGCATCCTCAAACCGC 5 0.125 No Hit GACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTG 5 0.125 No Hit GTATAGTTAAGGGCACTGTAATTCTCCAACAACACCATCTCTCCATGAAA 5 0.125 No Hit CTTTCATGTCCGGTCGTTCGGTGCGAATGGGTGCAGCACACTGGATTGCT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.2625 0.0 0.0 0.0 0.0 86-87 0.3125 0.0 0.0 0.0 0.0 88-89 0.3875 0.0 0.0 0.0 0.0 90-91 0.4125 0.0 0.0 0.0 0.0 92-93 0.525 0.0 0.0 0.0 0.0 94-95 0.6375 0.0 0.0 0.0 0.0 96-97 0.75 0.0 0.0 0.0 0.0 98-99 0.825 0.0 0.0 0.0 0.0 100-101 0.975 0.0 0.0 0.0 0.0 102-103 1.0625 0.0 0.0 0.0 0.0 104-105 1.1875 0.0 0.0 0.0 0.0 106-107 1.2999999999999998 0.0 0.0 0.0 0.0 108-109 1.65 0.0 0.0 0.0 0.0 110-111 1.9 0.0 0.0 0.0 0.0 112-113 2.075 0.0 0.0 0.0 0.0 114-115 2.4125 0.0 0.0 0.0 0.0 116-117 2.575 0.0 0.0 0.0 0.0 118-119 2.7249999999999996 0.0 0.0 0.0 0.0 120-121 2.9749999999999996 0.0 0.0 0.0 0.0 122-123 3.25 0.0 0.0 0.0 0.0 124-125 3.5250000000000004 0.0 0.0 0.0 0.0 126-127 3.75 0.0 0.0 0.0 0.0 128-129 4.012499999999999 0.0 0.0 0.0 0.0 130-131 4.3625 0.0 0.0 0.0 0.0 132-133 4.675000000000001 0.0 0.0 0.0 0.0 134-135 5.2 0.0 0.0 0.0 0.0 136-137 5.4875 0.0 0.0 0.0 0.0 138-139 6.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACTAACA 10 0.006830828 145.0 3 GGACTAA 10 0.006830828 145.0 1 CTAACAG 10 0.006830828 145.0 4 TAACAGG 10 0.006830828 145.0 5 CAGGTAA 10 0.006830828 145.0 8 ACAGGTA 10 0.006830828 145.0 7 CAGGATT 10 0.006830828 145.0 145 GACTAAC 10 0.006830828 145.0 2 >>END_MODULE SRR12671361 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671361_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2925 37.0 37.0 37.0 37.0 37.0 2 35.8635 37.0 37.0 37.0 37.0 37.0 3 36.0785 37.0 37.0 37.0 37.0 37.0 4 36.163 37.0 37.0 37.0 37.0 37.0 5 36.1795 37.0 37.0 37.0 37.0 37.0 6 36.2185 37.0 37.0 37.0 37.0 37.0 7 36.138 37.0 37.0 37.0 37.0 37.0 8 36.21 37.0 37.0 37.0 37.0 37.0 9 36.076 37.0 37.0 37.0 37.0 37.0 10-14 36.1561 37.0 37.0 37.0 37.0 37.0 15-19 36.221 37.0 37.0 37.0 37.0 37.0 20-24 36.1649 37.0 37.0 37.0 37.0 37.0 25-29 36.0641 37.0 37.0 37.0 37.0 37.0 30-34 36.067499999999995 37.0 37.0 37.0 37.0 37.0 35-39 36.0234 37.0 37.0 37.0 37.0 37.0 40-44 36.0295 37.0 37.0 37.0 37.0 37.0 45-49 36.0258 37.0 37.0 37.0 37.0 37.0 50-54 35.9904 37.0 37.0 37.0 37.0 37.0 55-59 35.996300000000005 37.0 37.0 37.0 37.0 37.0 60-64 35.9659 37.0 37.0 37.0 37.0 37.0 65-69 35.9689 37.0 37.0 37.0 37.0 37.0 70-74 35.899 37.0 37.0 37.0 37.0 37.0 75-79 35.8844 37.0 37.0 37.0 37.0 37.0 80-84 35.847699999999996 37.0 37.0 37.0 37.0 37.0 85-89 35.88099999999999 37.0 37.0 37.0 37.0 37.0 90-94 35.859700000000004 37.0 37.0 37.0 37.0 37.0 95-99 35.7968 37.0 37.0 37.0 37.0 37.0 100-104 35.7673 37.0 37.0 37.0 37.0 37.0 105-109 35.708 37.0 37.0 37.0 37.0 37.0 110-114 35.5979 37.0 37.0 37.0 37.0 37.0 115-119 35.7573 37.0 37.0 37.0 37.0 37.0 120-124 35.69370000000001 37.0 37.0 37.0 37.0 37.0 125-129 35.659000000000006 37.0 37.0 37.0 37.0 37.0 130-134 35.541399999999996 37.0 37.0 37.0 37.0 37.0 135-139 35.4721 37.0 37.0 37.0 37.0 37.0 140-144 35.5139 37.0 37.0 37.0 37.0 37.0 145-149 35.3831 37.0 37.0 37.0 34.6 37.0 150-151 35.02225 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 0.0 14 3.0 15 1.0 16 1.0 17 1.0 18 0.0 19 2.0 20 3.0 21 2.0 22 4.0 23 4.0 24 3.0 25 13.0 26 10.0 27 10.0 28 12.0 29 17.0 30 23.0 31 37.0 32 78.0 33 122.0 34 223.0 35 544.0 36 2653.0 37 232.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.35 23.549999999999997 9.049999999999999 22.05 2 27.025 24.6 32.675 15.7 3 19.575 26.775 34.225 19.425 4 24.4 34.949999999999996 22.675 17.974999999999998 5 25.4 38.125 20.775 15.7 6 20.05 39.825 21.125 19.0 7 19.725 21.8 40.575 17.9 8 18.75 26.05 29.525000000000002 25.674999999999997 9 22.125 23.875 30.075000000000003 23.925 10-14 23.435 29.054999999999996 26.805 20.705000000000002 15-19 23.3 27.575 27.794999999999998 21.33 20-24 23.05 28.42 27.575 20.955 25-29 22.95 28.29 28.275 20.485 30-34 22.525000000000002 27.98 28.46 21.035 35-39 22.795 28.26 27.74 21.205 40-44 22.67 27.639999999999997 28.655 21.035 45-49 22.32 28.244999999999997 27.939999999999998 21.495 50-54 22.06 28.720000000000002 28.435 20.785 55-59 23.285 27.544999999999998 28.09 21.08 60-64 23.315 27.92 27.534999999999997 21.23 65-69 22.88 27.700000000000003 28.095 21.325 70-74 23.755000000000003 28.425 26.935 20.885 75-79 22.43 28.65 27.57 21.349999999999998 80-84 23.985 28.634999999999998 26.290000000000003 21.09 85-89 23.56 28.485 27.025 20.93 90-94 23.61 28.425 26.775 21.19 95-99 23.325000000000003 27.825 28.57 20.28 100-104 23.544999999999998 27.644999999999996 27.915 20.895 105-109 23.225 27.73 28.360000000000003 20.685000000000002 110-114 23.724999999999998 28.285 27.13 20.86 115-119 24.02 28.475 27.11 20.395 120-124 24.115000000000002 28.165000000000003 27.07 20.65 125-129 23.585 28.24 27.36 20.815 130-134 24.025 28.360000000000003 27.055 20.560000000000002 135-139 24.525 28.16 27.07 20.244999999999997 140-144 25.14 28.375 26.56 19.925 145-149 25.322532253225322 28.467846784678468 26.422642264226422 19.786978697869788 150-151 25.9875 27.437499999999996 26.724999999999998 19.85 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.5 13 1.0 14 1.0 15 1.5 16 1.0 17 0.0 18 1.0 19 2.5 20 2.5 21 2.0 22 1.0 23 2.0 24 3.5 25 5.5 26 6.0 27 8.5 28 13.5 29 14.5 30 22.5 31 28.0 32 27.0 33 30.0 34 40.5 35 64.0 36 83.5 37 106.0 38 134.0 39 153.5 40 188.5 41 230.0 42 260.0 43 269.0 44 274.5 45 279.0 46 265.0 47 239.0 48 214.5 49 208.0 50 164.0 51 124.5 52 117.0 53 91.5 54 70.5 55 53.5 56 45.5 57 42.5 58 30.0 59 22.5 60 14.0 61 7.0 62 7.0 63 5.5 64 5.0 65 3.0 66 1.5 67 0.5 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 1.0 92 1.5 93 1.0 94 0.5 95 0.5 96 1.0 97 0.5 98 0.0 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.01 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 85.7 #Duplication Level Percentage of deduplicated Percentage of total 1 86.49358226371062 74.125 2 11.172695449241541 19.15 3 1.7211201866977828 4.425 4 0.4667444574095682 1.6 5 0.08751458576429405 0.375 6 0.029171528588098013 0.15 7 0.029171528588098013 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 7 0.17500000000000002 No Hit AACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAA 6 0.15 No Hit AGGGGACAATGGGTTACCTAGACCCTGAATATATGAAGACCTATCAACTT 5 0.125 No Hit AGAGAACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 5 0.125 No Hit AAATTATTTCTGGAAAAAATGCAGTCACTCAATCTGAAATTGTTAACGGA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.2625 0.0 0.0 0.0 0.0 86-87 0.3125 0.0 0.0 0.0 0.0 88-89 0.3875 0.0 0.0 0.0 0.0 90-91 0.4125 0.0 0.0 0.0 0.0 92-93 0.525 0.0 0.0 0.0 0.0 94-95 0.6375 0.0 0.0 0.0 0.0 96-97 0.75 0.0 0.0 0.0 0.0 98-99 0.825 0.0 0.0 0.0 0.0 100-101 0.975 0.0 0.0 0.0 0.0 102-103 1.0625 0.0 0.0 0.0 0.0 104-105 1.1625 0.0 0.0 0.0 0.0 106-107 1.275 0.0 0.0 0.0 0.0 108-109 1.6124999999999998 0.0 0.0 0.0 0.0 110-111 1.875 0.0 0.0 0.0 0.0 112-113 2.05 0.0 0.0 0.0 0.0 114-115 2.3875 0.0 0.0 0.0 0.0 116-117 2.5625 0.0 0.0 0.0 0.0 118-119 2.7249999999999996 0.0 0.0 0.0 0.0 120-121 2.9749999999999996 0.0 0.0 0.0 0.0 122-123 3.25 0.0 0.0 0.0 0.0 124-125 3.5250000000000004 0.0 0.0 0.0 0.0 126-127 3.775 0.0 0.0 0.0 0.0 128-129 4.0625 0.0 0.0 0.0 0.0 130-131 4.4125 0.0 0.0 0.0 0.0 132-133 4.7125 0.0 0.0 0.0 0.0 134-135 5.3 0.0 0.0 0.0 0.0 136-137 5.5875 0.0 0.0 0.0 0.0 138-139 6.125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCAGCCT 10 0.006830828 145.0 7 AAAAGTC 10 0.006830828 145.0 4 GTCTTAA 10 0.006830828 145.0 8 CTAAAAG 10 0.006830828 145.0 2 AGTCTTA 10 0.006830828 145.0 7 AAAGTCT 10 0.006830828 145.0 5 AAGTCTT 10 0.006830828 145.0 6 CAGCCTT 10 0.006830828 145.0 8 AAAAAAA 40 0.0076550315 18.125 115-119 >>END_MODULE Read 1087180 spots for SRR12671361.sra Written 1087180 spots for SRR12671361.sra Read 1087180 spots for SRR12671361.sra Written 1087180 spots for SRR12671361.sra Read 1087180 spots for SRR12671361.sra Written 1087180 spots for SRR12671361.sra Read 1087180 spots for SRR12671361.sra Written 1087180 spots for SRR12671361.sra Read 1087180 spots for SRR12671361.sra Written 1087180 spots for SRR12671361.sra Read 1087180 spots for SRR12671361.sra Written 1087180 spots for SRR12671361.sra Read 1087180 spots for SRR12671361.sra Written 1087180 spots for SRR12671361.sra Read 1087180 spots for SRR12671361.sra Written 1087180 spots for SRR12671361.sra Read 1087180 spots for SRR12671361.sra Written 1087180 spots for SRR12671361.sra Read 1087180 spots for SRR12671361.sra Written 1087180 spots for SRR12671361.sra Read 1087180 spots for SRR12671361.sra Written 1087180 spots for SRR12671361.sra Read 1087180 spots for SRR12671361.sra Written 1087180 spots for SRR12671361.sra Read 1087180 spots for SRR12671361.sra Written 1087180 spots for SRR12671361.sra Read 1087180 spots for SRR12671361.sra Written 1087180 spots for SRR12671361.sra Read 1087180 spots for SRR12671361.sra Written 1087180 spots for SRR12671361.sra Read 1087180 spots for SRR12671361.sra Written 1087180 spots for SRR12671361.sra Read 1087180 spots for SRR12671361.sra Written 1087180 spots for SRR12671361.sra Read 1087180 spots for SRR12671361.sra Written 1087180 spots for SRR12671361.sra Read 1087180 spots for SRR12671361.sra Written 1087180 spots for SRR12671361.sra Read 1087184 spots for SRR12671361.sra Written 1087184 spots for SRR12671361.sra SRR ids: ['SRR12671361.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_1le8htqf SRR12671361.sra spots: 21743604 blocks: [[1, 1087180], [1087181, 2174360], [2174361, 3261540], [3261541, 4348720], [4348721, 5435900], [5435901, 6523080], [6523081, 7610260], [7610261, 8697440], [8697441, 9784620], [9784621, 10871800], [10871801, 11958980], [11958981, 13046160], [13046161, 14133340], [14133341, 15220520], [15220521, 16307700], [16307701, 17394880], [17394881, 18482060], [18482061, 19569240], [19569241, 20656420], [20656421, 21743604]] SRR12671361 file size 7367727 SRR12671361 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671361 SRR12671361_1.fastq SRR12671361_2.fastq Input file: SRR12671361_1.fastq Paired file: SRR12671361_2.fastq trimmed: SRR12671361-trimmed-pair1.fastq, SRR12671361-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 18:43:15 2025 >> started Tue Feb 11 18:43:38 2025 >> done (22.731s) 21743604 read pairs processed; of these: 133 ( 0.00%) short read pairs filtered out after trimming by size control 7533 ( 0.03%) empty read pairs filtered out after trimming by size control 21735938 (99.96%) read pairs available; of these: 1824812 ( 8.40%) trimmed read pairs available after processing 19911126 (91.60%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 12 0.00% 19 12 0.00% 20 13 0.00% 21 19 0.00% 22 17 0.00% 23 13 0.00% 24 28 0.00% 25 30 0.00% 26 40 0.00% 27 39 0.00% 28 40 0.00% 29 56 0.00% 30 32 0.00% 31 43 0.00% 32 38 0.00% 33 45 0.00% 34 38 0.00% 35 32 0.00% 36 34 0.00% 37 35 0.00% 38 47 0.00% 39 56 0.00% 40 49 0.00% 41 42 0.00% 42 54 0.00% 43 56 0.00% 44 69 0.00% 45 66 0.00% 46 71 0.00% 47 83 0.00% 48 85 0.00% 49 111 0.00% 50 121 0.00% 51 138 0.00% 52 145 0.00% 53 168 0.00% 54 185 0.00% 55 179 0.00% 56 182 0.00% 57 254 0.00% 58 298 0.00% 59 307 0.00% 60 406 0.00% 61 411 0.00% 62 531 0.00% 63 564 0.00% 64 622 0.00% 65 697 0.00% 66 734 0.00% 67 881 0.00% 68 972 0.00% 69 1119 0.01% 70 1301 0.01% 71 1472 0.01% 72 1656 0.01% 73 1862 0.01% 74 2063 0.01% 75 2376 0.01% 76 2673 0.01% 77 2792 0.01% 78 3021 0.01% 79 3311 0.02% 80 3732 0.02% 81 4133 0.02% 82 4431 0.02% 83 4854 0.02% 84 5528 0.03% 85 6149 0.03% 86 6336 0.03% 87 6725 0.03% 88 7310 0.03% 89 7470 0.03% 90 8144 0.04% 91 8779 0.04% 92 9135 0.04% 93 9892 0.05% 94 10289 0.05% 95 11264 0.05% 96 11547 0.05% 97 12254 0.06% 98 12497 0.06% 99 13454 0.06% 100 13840 0.06% 101 13828 0.06% 102 15270 0.07% 103 15814 0.07% 104 16453 0.08% 105 17048 0.08% 106 17864 0.08% 107 18398 0.08% 108 19169 0.09% 109 19397 0.09% 110 19997 0.09% 111 20792 0.10% 112 21559 0.10% 113 21893 0.10% 114 22603 0.10% 115 23454 0.11% 116 24323 0.11% 117 25555 0.12% 118 25982 0.12% 119 26573 0.12% 120 27572 0.13% 121 28117 0.13% 122 28530 0.13% 123 29576 0.14% 124 30877 0.14% 125 31104 0.14% 126 32647 0.15% 127 32993 0.15% 128 33842 0.16% 129 35065 0.16% 130 35347 0.16% 131 36211 0.17% 132 37035 0.17% 133 38239 0.18% 134 38211 0.18% 135 39392 0.18% 136 39934 0.18% 137 40967 0.19% 138 42303 0.19% 139 43831 0.20% 140 43901 0.20% 141 44496 0.20% 142 45602 0.21% 143 45591 0.21% 144 47084 0.22% 145 47385 0.22% 146 48633 0.22% 147 49073 0.23% 148 50596 0.23% 149 51300 0.24% 150 52777 0.24% 151 19911126 91.60% 21735938 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=8.22 fanout-score-rank=12 prefix-density=0.42 prefix-fanout=3.8 sequence=TTGCAGCCATTCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=40 fanout-score=31.83 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=4.3 sequence=CTCCAAAAACCCAATAAAAAAGGAAGAGGTAAAGCATTTTGCCAAGGTCTAAGTACAATTTAAACAAACCACCCCTAAGGCCCTAACAGATATAGCTAGGGACACATCAAGTTCTGGGACGACTTAGACACCTTTCGGCTTGGCGGCAATAAAGCTGATGCACTGCACTTGACGCGTGTTGTCGAATCCGATTATACGGATAAAGGCGTTAGGGTAAGCTTTCTTTGCCTCCTCAAGCTCAAGCAACACTTGAGATGCCTCAGTGCATCCAAACATGGGTAGCTTCCACATAGTCCAGTAGCGTCCATCATAGTACCCTGGTGAGCTGTGGTGCTCACGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTTCGAGCGAAGAAGGTAATCAATTTCCTTGGCCAATTCCTCCTCTGTGAGATCTGGAAGGTAAGAAAGAGTCTCGAACTTCTTCAATCCAGTTGGTGGCCACACCTGCATGCATTGAACTCGTCCA criterion=sequence-density sequence-density=0.34 sequence-density-rank=1 fanout-score=2.33 fanout-score-rank=26 prefix-density=0.34 prefix-fanout=2.3 sequence=TGCAAGTGCGGCAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=40.39 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=3.8 sequence=GCAAAACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATG SRR12671361 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 18:44:29 Started mapping on | Feb 11 18:44:29 Finished on | Feb 11 18:47:38 Mapping speed, Million of reads per hour | 414.02 Number of input reads | 21735938 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 19785259 Uniquely mapped reads % | 91.03% Average mapped length | 296.05 Number of splices: Total | 19557227 Number of splices: Annotated (sjdb) | 19104396 Number of splices: GT/AG | 19167966 Number of splices: GC/AG | 314499 Number of splices: AT/AC | 13196 Number of splices: Non-canonical | 61566 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.80 Insertion rate per base | 0.02% Insertion average length | 2.32 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 511176 % of reads mapped to multiple loci | 2.35% Number of reads mapped to too many loci | 39087 % of reads mapped to too many loci | 0.18% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.30% % of reads unmapped: other | 0.14% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1439503 1439503 1439503 N_multimapping 511176 511176 511176 N_noFeature 747472 19498755 858591 N_ambiguous 310833 1403 134688 UnstrandedReadsAssigned:18726954 PositiveStrandReadsAssigned:285101 NegativeStrandReadsAssigned:18791980 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671361 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671361-trimmed-pair1.fastq SRR12671361-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,735,938 reads, 18,837,902 reads pseudoaligned [quant] estimated average fragment length: 274.112 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,187 rounds 52401 SRR12671361.ke.tsv 34699 SRR12671361.se.tsv 87100 total ==> SRR12671361.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1744.89 932 27.5207 Potri.005G024800.1.v4.1 1035 761.888 409 27.6594 Potri.004G059700.1.v4.1 961 688.131 7 0.524129 Potri.007G009000.2.v4.1 1416 1142.89 0 0 Potri.003G141000.2.v4.1 2943 2669.89 1105.46 21.3334 Potri.016G087400.1.v4.1 270 82.1758 634 397.518 Potri.015G069301.1.v4.1 564 308.929 0 0 Potri.010G195200.1.v4.1 1773 1499.89 69 2.37029 Potri.012G127500.1.v4.1 977 704.016 37 2.70788 ==> SRR12671361.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 79 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 279 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 24 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR12671361 completed mapping pipeline successfully