Starting /dee2/code/volunteer_pipeline.sh SRR12671364 current disk space = 3053265395712 free memory = 1278536060 SRR12671364 SRAfilesize 7f1c50925b70ee3f5c7345df83b5bea3 SRR12671364.sra SRR12671364.sra file validated SRR12671364 is paired end SRR12671364 is conventional basespace SRR12671364 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671364_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.6055 37.0 37.0 37.0 37.0 37.0 2 36.27725 37.0 37.0 37.0 37.0 37.0 3 36.4745 37.0 37.0 37.0 37.0 37.0 4 36.5635 37.0 37.0 37.0 37.0 37.0 5 36.549 37.0 37.0 37.0 37.0 37.0 6 36.5315 37.0 37.0 37.0 37.0 37.0 7 36.4645 37.0 37.0 37.0 37.0 37.0 8 36.514 37.0 37.0 37.0 37.0 37.0 9 36.5615 37.0 37.0 37.0 37.0 37.0 10-14 36.551 37.0 37.0 37.0 37.0 37.0 15-19 36.468999999999994 37.0 37.0 37.0 37.0 37.0 20-24 36.4767 37.0 37.0 37.0 37.0 37.0 25-29 36.4798 37.0 37.0 37.0 37.0 37.0 30-34 36.374 37.0 37.0 37.0 37.0 37.0 35-39 36.3129 37.0 37.0 37.0 37.0 37.0 40-44 36.306799999999996 37.0 37.0 37.0 37.0 37.0 45-49 36.2764 37.0 37.0 37.0 37.0 37.0 50-54 36.2594 37.0 37.0 37.0 37.0 37.0 55-59 36.2401 37.0 37.0 37.0 37.0 37.0 60-64 36.19539999999999 37.0 37.0 37.0 37.0 37.0 65-69 36.1601 37.0 37.0 37.0 37.0 37.0 70-74 36.175200000000004 37.0 37.0 37.0 37.0 37.0 75-79 36.1659 37.0 37.0 37.0 37.0 37.0 80-84 36.1528 37.0 37.0 37.0 37.0 37.0 85-89 36.041399999999996 37.0 37.0 37.0 37.0 37.0 90-94 36.1354 37.0 37.0 37.0 37.0 37.0 95-99 36.0553 37.0 37.0 37.0 37.0 37.0 100-104 36.008599999999994 37.0 37.0 37.0 37.0 37.0 105-109 36.0345 37.0 37.0 37.0 37.0 37.0 110-114 35.920100000000005 37.0 37.0 37.0 37.0 37.0 115-119 35.9031 37.0 37.0 37.0 37.0 37.0 120-124 35.973 37.0 37.0 37.0 37.0 37.0 125-129 35.9326 37.0 37.0 37.0 37.0 37.0 130-134 35.813300000000005 37.0 37.0 37.0 37.0 37.0 135-139 35.7759 37.0 37.0 37.0 37.0 37.0 140-144 35.637299999999996 37.0 37.0 37.0 37.0 37.0 145-149 35.698899999999995 37.0 37.0 37.0 37.0 37.0 150-151 35.5095 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 2.0 21 6.0 22 6.0 23 6.0 24 3.0 25 6.0 26 8.0 27 9.0 28 6.0 29 29.0 30 32.0 31 47.0 32 44.0 33 80.0 34 129.0 35 309.0 36 2841.0 37 436.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 59.650000000000006 11.825 5.825 22.7 2 22.466850137603203 12.709532149111835 35.20140105078809 29.622216662496875 3 17.8 22.125 30.775000000000002 29.299999999999997 4 22.775000000000002 28.7 25.75 22.775000000000002 5 22.475 33.800000000000004 24.6 19.125 6 18.725 37.824999999999996 22.650000000000002 20.8 7 14.899999999999999 25.05 43.025000000000006 17.025000000000002 8 17.0 23.400000000000002 32.625 26.974999999999998 9 15.9 22.25 35.3 26.55 10-14 20.515 28.74 28.21 22.535 15-19 20.52 27.61 27.889999999999997 23.98 20-24 20.39 28.144999999999996 27.884999999999998 23.580000000000002 25-29 20.665 28.655 27.315 23.365 30-34 20.455000000000002 28.415000000000003 27.63 23.5 35-39 20.28 28.720000000000002 27.35 23.65 40-44 20.405 28.62 27.3 23.674999999999997 45-49 20.89 28.76 27.08 23.27 50-54 20.685000000000002 28.33 27.24 23.745 55-59 19.935 28.275 28.015 23.775 60-64 20.69 28.499999999999996 27.625 23.185 65-69 20.53 28.194999999999997 27.465 23.810000000000002 70-74 20.005 28.16 28.050000000000004 23.785 75-79 20.265 27.860000000000003 27.805000000000003 24.07 80-84 21.08 28.694999999999997 26.724999999999998 23.5 85-89 20.815 29.294999999999998 26.795 23.095 90-94 20.595 27.88 27.365000000000002 24.16 95-99 20.51 28.57 27.605 23.315 100-104 20.73 28.7 26.685 23.885 105-109 20.7 27.889999999999997 27.29 24.12 110-114 20.44 28.444999999999997 27.644999999999996 23.47 115-119 21.385 27.939999999999998 26.834999999999997 23.84 120-124 21.73 28.144999999999996 26.840000000000003 23.285 125-129 21.115000000000002 27.685 26.424999999999997 24.775 130-134 20.435 27.63 27.98 23.955000000000002 135-139 22.11 27.36 26.405 24.125 140-144 21.654999999999998 28.42 26.085 23.84 145-149 21.43 27.455000000000002 26.35 24.765 150-151 21.1875 28.3375 27.0 23.474999999999998 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.5 2 1.0 3 0.5 4 1.0 5 1.5 6 1.0 7 0.5 8 0.0 9 1.0 10 2.0 11 2.5 12 1.5 13 0.5 14 0.5 15 1.5 16 2.0 17 2.0 18 2.5 19 2.0 20 1.5 21 1.5 22 3.5 23 3.0 24 3.0 25 7.0 26 9.5 27 11.0 28 15.0 29 13.5 30 15.5 31 29.0 32 37.5 33 46.0 34 56.0 35 68.5 36 79.5 37 96.0 38 115.0 39 138.0 40 170.0 41 189.0 42 218.5 43 234.5 44 252.5 45 248.5 46 225.5 47 251.0 48 243.0 49 212.0 50 187.5 51 163.0 52 137.5 53 106.5 54 87.5 55 80.0 56 57.5 57 33.0 58 30.5 59 31.5 60 26.0 61 13.0 62 7.5 63 5.5 64 3.5 65 2.0 66 2.5 67 2.5 68 1.0 69 1.5 70 1.5 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.075 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 84.89999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 85.60070671378092 72.675 2 11.57243816254417 19.650000000000002 3 2.4440518256772674 6.225 4 0.2944640753828033 1.0 5 0.029446407538280327 0.125 6 0.029446407538280327 0.15 7 0.029446407538280327 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTTCAGGGAATAAGCTTGCTACCAGCAACATCGACAACGAATCTATATCT 7 0.17500000000000002 No Hit GGCCAATTCCTCCTCTGTGAGATCTGGAAGGTAAGAAAGAGTCTCGAACT 6 0.15 No Hit GCTTCAACAACTTTAACCAGCTCCTTGTAGAATGCCCTATCAGAATTTTC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.037500000000000006 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.2125 0.0 0.0 0.0 0.0 78-79 0.25 0.0 0.0 0.0 0.0 80-81 0.3125 0.0 0.0 0.0 0.0 82-83 0.3875 0.0 0.0 0.0 0.0 84-85 0.4625 0.0 0.0 0.0 0.0 86-87 0.5375000000000001 0.0 0.0 0.0 0.0 88-89 0.625 0.0 0.0 0.0 0.0 90-91 0.675 0.0 0.0 0.0 0.0 92-93 0.975 0.0 0.0 0.0 0.0 94-95 1.275 0.0 0.0 0.0 0.0 96-97 1.4625 0.0 0.0 0.0 0.0 98-99 1.625 0.0 0.0 0.0 0.0 100-101 1.7875 0.0 0.0 0.0 0.0 102-103 2.0625 0.0 0.0 0.0 0.0 104-105 2.3625 0.0 0.0 0.0 0.0 106-107 2.6375 0.0 0.0 0.0 0.0 108-109 2.9625000000000004 0.0 0.0 0.0 0.0 110-111 3.325 0.0 0.0 0.0 0.0 112-113 3.6 0.0 0.0 0.0 0.0 114-115 4.0875 0.0 0.0 0.0 0.0 116-117 4.5375 0.0 0.0 0.0 0.0 118-119 4.9125 0.0 0.0 0.0 0.0 120-121 5.5 0.0 0.0 0.0 0.0 122-123 6.1 0.0 0.0 0.0 0.0 124-125 6.675000000000001 0.0 0.0 0.0 0.0 126-127 7.2375 0.0 0.0 0.0 0.0 128-129 7.7625 0.0 0.0 0.0 0.0 130-131 8.1375 0.0 0.0 0.0 0.0 132-133 8.850000000000001 0.0 0.0 0.0 0.0 134-135 9.537500000000001 0.0 0.0 0.0 0.0 136-137 10.3625 0.0 0.0 0.0 0.0 138-139 11.3125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12671364 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671364_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.1065 37.0 37.0 37.0 37.0 37.0 2 35.846 37.0 37.0 37.0 37.0 37.0 3 35.9855 37.0 37.0 37.0 37.0 37.0 4 35.9385 37.0 37.0 37.0 37.0 37.0 5 36.0545 37.0 37.0 37.0 37.0 37.0 6 36.0575 37.0 37.0 37.0 37.0 37.0 7 35.9485 37.0 37.0 37.0 37.0 37.0 8 36.114 37.0 37.0 37.0 37.0 37.0 9 36.022 37.0 37.0 37.0 37.0 37.0 10-14 36.036500000000004 37.0 37.0 37.0 37.0 37.0 15-19 35.981700000000004 37.0 37.0 37.0 37.0 37.0 20-24 35.9334 37.0 37.0 37.0 37.0 37.0 25-29 35.9005 37.0 37.0 37.0 37.0 37.0 30-34 35.863800000000005 37.0 37.0 37.0 37.0 37.0 35-39 35.8476 37.0 37.0 37.0 37.0 37.0 40-44 35.7957 37.0 37.0 37.0 37.0 37.0 45-49 35.7838 37.0 37.0 37.0 37.0 37.0 50-54 35.7293 37.0 37.0 37.0 37.0 37.0 55-59 35.6793 37.0 37.0 37.0 37.0 37.0 60-64 35.6881 37.0 37.0 37.0 37.0 37.0 65-69 35.66479999999999 37.0 37.0 37.0 37.0 37.0 70-74 35.658100000000005 37.0 37.0 37.0 37.0 37.0 75-79 35.6649 37.0 37.0 37.0 37.0 37.0 80-84 35.5664 37.0 37.0 37.0 37.0 37.0 85-89 35.5436 37.0 37.0 37.0 37.0 37.0 90-94 35.5879 37.0 37.0 37.0 37.0 37.0 95-99 35.41440000000001 37.0 37.0 37.0 37.0 37.0 100-104 35.4485 37.0 37.0 37.0 37.0 37.0 105-109 35.328199999999995 37.0 37.0 37.0 37.0 37.0 110-114 35.3071 37.0 37.0 37.0 37.0 37.0 115-119 35.395799999999994 37.0 37.0 37.0 37.0 37.0 120-124 35.286199999999994 37.0 37.0 37.0 37.0 37.0 125-129 35.21640000000001 37.0 37.0 37.0 29.8 37.0 130-134 35.0842 37.0 37.0 37.0 29.8 37.0 135-139 34.942099999999996 37.0 37.0 37.0 25.0 37.0 140-144 34.8134 37.0 37.0 37.0 25.0 37.0 145-149 34.6836 37.0 37.0 37.0 25.0 37.0 150-151 34.32625 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 8.0 14 9.0 15 7.0 16 5.0 17 3.0 18 4.0 19 3.0 20 3.0 21 5.0 22 6.0 23 9.0 24 15.0 25 10.0 26 9.0 27 20.0 28 28.0 29 29.0 30 31.0 31 71.0 32 89.0 33 119.0 34 186.0 35 517.0 36 2497.0 37 316.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 58.025000000000006 20.25 6.25 15.475 2 28.625 20.474999999999998 31.525 19.375 3 24.275 23.525 33.5 18.7 4 25.4 33.1 24.325 17.175 5 26.0 36.8 20.424999999999997 16.775000000000002 6 24.6 37.125 19.45 18.825 7 21.375 21.95 35.775 20.9 8 20.3 25.15 29.275000000000002 25.275 9 21.15 24.5 29.45 24.9 10-14 23.96 28.93 26.169999999999998 20.94 15-19 24.02 28.63 26.865 20.485 20-24 23.915 28.535 27.305 20.244999999999997 25-29 23.51 27.810000000000002 27.43 21.25 30-34 23.51 27.82 27.82 20.849999999999998 35-39 22.6 27.915 27.794999999999998 21.69 40-44 23.474999999999998 27.765 27.48 21.279999999999998 45-49 22.54 27.72 27.985 21.755 50-54 23.465 28.055000000000003 27.91 20.57 55-59 23.22 27.115000000000002 28.395 21.27 60-64 23.09 27.255000000000003 27.62 22.035 65-69 24.13 27.88 27.450000000000003 20.54 70-74 23.805 27.41 27.72 21.065 75-79 23.265 27.700000000000003 27.42 21.615000000000002 80-84 22.955000000000002 28.17 27.405 21.47 85-89 23.91 28.845 26.69 20.555 90-94 23.76 28.42 26.825 20.995 95-99 23.215 27.735 27.200000000000003 21.85 100-104 23.94 28.1 27.215 20.745 105-109 24.165 27.54 27.495000000000005 20.8 110-114 24.395 27.694999999999997 27.16 20.75 115-119 24.535 28.43 26.834999999999997 20.200000000000003 120-124 25.119999999999997 27.750000000000004 27.08 20.05 125-129 24.62 27.595 27.310000000000002 20.474999999999998 130-134 25.31 27.74 26.715 20.235 135-139 25.230000000000004 27.805000000000003 26.775 20.19 140-144 25.945 27.68 26.51 19.865 145-149 27.07270727072707 27.912791279127912 25.82758275827583 19.186918691869188 150-151 27.1625 27.5125 25.837500000000002 19.4875 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 1.0 6 1.5 7 0.5 8 0.0 9 1.0 10 2.0 11 2.0 12 2.5 13 2.5 14 1.5 15 1.5 16 1.5 17 1.0 18 1.5 19 2.0 20 3.0 21 3.0 22 2.5 23 4.0 24 4.0 25 2.0 26 3.5 27 5.5 28 6.5 29 10.0 30 16.0 31 23.5 32 20.0 33 29.5 34 45.5 35 55.5 36 71.5 37 92.0 38 111.5 39 146.5 40 189.5 41 217.0 42 228.0 43 244.5 44 257.5 45 248.5 46 246.5 47 266.5 48 254.5 49 209.5 50 181.5 51 145.0 52 113.0 53 97.5 54 87.0 55 75.0 56 67.0 57 50.0 58 33.0 59 28.5 60 18.0 61 11.0 62 9.0 63 5.0 64 4.5 65 4.0 66 2.0 67 0.5 68 1.0 69 1.5 70 1.0 71 0.5 72 0.5 73 0.5 74 1.0 75 2.5 76 2.5 77 2.0 78 1.5 79 0.5 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.5 91 0.5 92 0.0 93 1.0 94 1.0 95 0.0 96 0.0 97 0.5 98 0.5 99 0.0 100 4.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.01 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 85.02499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 86.18053513672449 73.275 2 11.026168773890033 18.75 3 2.2346368715083798 5.7 4 0.38224051749485444 1.3 5 0.058806233460746836 0.25 6 0.058806233460746836 0.3 7 0.029403116730373418 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.029403116730373418 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 10 0.25 No Hit AGCTGATCTTGATGGGTGTTATTAATGCCCCATTGCAGTTTGTTACGCCT 7 0.17500000000000002 No Hit GGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCA 6 0.15 No Hit GGGAGCACTGCATAGCTTATAAGCTTGTAAGAGATGGCTTCCTCCTCTAT 6 0.15 No Hit GCTCAAAGCACCAGGGCTATCTATTACTTTCATTTCCATTACCAATGTAA 5 0.125 No Hit AGGTGGCAAACCAAGTATTCTACATCCCAGGTCTTTTGCCAAAGGTGCCT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.037500000000000006 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.1875 0.0 0.0 0.0 0.0 78-79 0.225 0.0 0.0 0.0 0.0 80-81 0.2875 0.0 0.0 0.0 0.0 82-83 0.3625 0.0 0.0 0.0 0.0 84-85 0.4375 0.0 0.0 0.0 0.0 86-87 0.525 0.0 0.0 0.0 0.0 88-89 0.625 0.0 0.0 0.0 0.0 90-91 0.675 0.0 0.0 0.0 0.0 92-93 0.95 0.0 0.0 0.0 0.0 94-95 1.25 0.0 0.0 0.0 0.0 96-97 1.4375 0.0 0.0 0.0 0.0 98-99 1.6 0.0 0.0 0.0 0.0 100-101 1.775 0.0 0.0 0.0 0.0 102-103 2.0625 0.0 0.0 0.0 0.0 104-105 2.3875 0.0 0.0 0.0 0.0 106-107 2.6875 0.0 0.0 0.0 0.0 108-109 3.0125 0.0 0.0 0.0 0.0 110-111 3.375 0.0 0.0 0.0 0.0 112-113 3.625 0.0 0.0 0.0 0.0 114-115 4.1125 0.0 0.0 0.0 0.0 116-117 4.5625 0.0 0.0 0.0 0.0 118-119 4.9375 0.0 0.0 0.0 0.0 120-121 5.525 0.0 0.0 0.0 0.0 122-123 6.15 0.0 0.0 0.0 0.0 124-125 6.75 0.0 0.0 0.0 0.0 126-127 7.2875 0.0 0.0 0.0 0.0 128-129 7.8125 0.0 0.0 0.0 0.0 130-131 8.1875 0.0 0.0 0.0 0.0 132-133 8.925 0.0 0.0 0.0 0.0 134-135 9.625 0.0 0.0 0.0 0.0 136-137 10.475000000000001 0.0 0.0 0.0 0.0 138-139 11.4125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGAGTGC 10 0.006830828 145.0 145 TTTCCCA 20 0.00593511 29.0 140-144 AAGTCTG 20 0.00593511 29.0 125-129 CAAGTCT 20 0.00593511 29.0 125-129 AAAAAAA 80 0.0020131238 12.6875 40-44 >>END_MODULE Read 695699 spots for SRR12671364.sra Written 695699 spots for SRR12671364.sra Read 695701 spots for SRR12671364.sra Written 695701 spots for SRR12671364.sra Read 695699 spots for SRR12671364.sra Written 695699 spots for SRR12671364.sra Read 695699 spots for SRR12671364.sra Written 695699 spots for SRR12671364.sra Read 695699 spots for SRR12671364.sra Written 695699 spots for SRR12671364.sra Read 695699 spots for SRR12671364.sra Written 695699 spots for SRR12671364.sra Read 695699 spots for SRR12671364.sra Written 695699 spots for SRR12671364.sra Read 695699 spots for SRR12671364.sra Written 695699 spots for SRR12671364.sra Read 695699 spots for SRR12671364.sra Written 695699 spots for SRR12671364.sra Read 695699 spots for SRR12671364.sra Written 695699 spots for SRR12671364.sra Read 695699 spots for SRR12671364.sra Written 695699 spots for SRR12671364.sra Read 695699 spots for SRR12671364.sra Written 695699 spots for SRR12671364.sra Read 695699 spots for SRR12671364.sra Written 695699 spots for SRR12671364.sra Read 695699 spots for SRR12671364.sra Written 695699 spots for SRR12671364.sra Read 695699 spots for SRR12671364.sra Written 695699 spots for SRR12671364.sra Read 695699 spots for SRR12671364.sra Written 695699 spots for SRR12671364.sra Read 695699 spots for SRR12671364.sra Written 695699 spots for SRR12671364.sra Read 695699 spots for SRR12671364.sra Written 695699 spots for SRR12671364.sra Read 695699 spots for SRR12671364.sra Written 695699 spots for SRR12671364.sra Read 695699 spots for SRR12671364.sra Written 695699 spots for SRR12671364.sra SRR ids: ['SRR12671364.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_7rq1avm2 SRR12671364.sra spots: 13913982 blocks: [[1, 695699], [695700, 1391398], [1391399, 2087097], [2087098, 2782796], [2782797, 3478495], [3478496, 4174194], [4174195, 4869893], [4869894, 5565592], [5565593, 6261291], [6261292, 6956990], [6956991, 7652689], [7652690, 8348388], [8348389, 9044087], [9044088, 9739786], [9739787, 10435485], [10435486, 11131184], [11131185, 11826883], [11826884, 12522582], [12522583, 13218281], [13218282, 13913982]] SRR12671364 file size 4706879 SRR12671364 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671364 SRR12671364_1.fastq SRR12671364_2.fastq Input file: SRR12671364_1.fastq Paired file: SRR12671364_2.fastq trimmed: SRR12671364-trimmed-pair1.fastq, SRR12671364-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 19:56:03 2025 >> started Tue Feb 11 19:56:20 2025 >> done (16.294s) 13913982 read pairs processed; of these: 820 ( 0.01%) short read pairs filtered out after trimming by size control 6167 ( 0.04%) empty read pairs filtered out after trimming by size control 13906995 (99.95%) read pairs available; of these: 2128759 (15.31%) trimmed read pairs available after processing 11778236 (84.69%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 87 0.00% 19 67 0.00% 20 70 0.00% 21 60 0.00% 22 63 0.00% 23 88 0.00% 24 100 0.00% 25 86 0.00% 26 91 0.00% 27 97 0.00% 28 97 0.00% 29 90 0.00% 30 78 0.00% 31 65 0.00% 32 58 0.00% 33 77 0.00% 34 78 0.00% 35 75 0.00% 36 86 0.00% 37 66 0.00% 38 69 0.00% 39 90 0.00% 40 69 0.00% 41 90 0.00% 42 81 0.00% 43 75 0.00% 44 66 0.00% 45 66 0.00% 46 80 0.00% 47 103 0.00% 48 106 0.00% 49 116 0.00% 50 123 0.00% 51 124 0.00% 52 155 0.00% 53 185 0.00% 54 182 0.00% 55 239 0.00% 56 220 0.00% 57 258 0.00% 58 260 0.00% 59 366 0.00% 60 392 0.00% 61 504 0.00% 62 542 0.00% 63 708 0.01% 64 720 0.01% 65 708 0.01% 66 765 0.01% 67 936 0.01% 68 1093 0.01% 69 1219 0.01% 70 1498 0.01% 71 1795 0.01% 72 2074 0.01% 73 2268 0.02% 74 2547 0.02% 75 2730 0.02% 76 2846 0.02% 77 3139 0.02% 78 3535 0.03% 79 4087 0.03% 80 4634 0.03% 81 5379 0.04% 82 6224 0.04% 83 6757 0.05% 84 7032 0.05% 85 7427 0.05% 86 7664 0.06% 87 8228 0.06% 88 8488 0.06% 89 9363 0.07% 90 10478 0.08% 91 11618 0.08% 92 12665 0.09% 93 13787 0.10% 94 14363 0.10% 95 15056 0.11% 96 15083 0.11% 97 14990 0.11% 98 15781 0.11% 99 16560 0.12% 100 17851 0.13% 101 19065 0.14% 102 20582 0.15% 103 21999 0.16% 104 22939 0.16% 105 23205 0.17% 106 23223 0.17% 107 23055 0.17% 108 23681 0.17% 109 23950 0.17% 110 24773 0.18% 111 26710 0.19% 112 29051 0.21% 113 29642 0.21% 114 31324 0.23% 115 31070 0.22% 116 31833 0.23% 117 31723 0.23% 118 31201 0.22% 119 31934 0.23% 120 33098 0.24% 121 34552 0.25% 122 35945 0.26% 123 38071 0.27% 124 39837 0.29% 125 39691 0.29% 126 40519 0.29% 127 39941 0.29% 128 39639 0.29% 129 39457 0.28% 130 39789 0.29% 131 40554 0.29% 132 42156 0.30% 133 44357 0.32% 134 45307 0.33% 135 46579 0.33% 136 46208 0.33% 137 45887 0.33% 138 45532 0.33% 139 45564 0.33% 140 44654 0.32% 141 45247 0.33% 142 46255 0.33% 143 48300 0.35% 144 50107 0.36% 145 51121 0.37% 146 51207 0.37% 147 50539 0.36% 148 50412 0.36% 149 49210 0.35% 150 49828 0.36% 151 11778236 84.69% 13906995 reads passed initial QC criterion=sequence-density sequence-density=0.61 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=20 prefix-density=0.61 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=24 fanout-score=574.95 fanout-score-rank=1 prefix-density=0.28 prefix-fanout=20.0 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGG criterion=sequence-density sequence-density=0.85 sequence-density-rank=1 fanout-score=2.03 fanout-score-rank=24 prefix-density=0.85 prefix-fanout=2.0 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.16 sequence-density-rank=21 fanout-score=18.21 fanout-score-rank=1 prefix-density=0.39 prefix-fanout=7.3 sequence=ATGGCTTCAACTTC SRR12671364 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 19:57:06 Started mapping on | Feb 11 19:57:06 Finished on | Feb 11 19:58:58 Mapping speed, Million of reads per hour | 447.01 Number of input reads | 13906995 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 12186860 Uniquely mapped reads % | 87.63% Average mapped length | 291.19 Number of splices: Total | 11146680 Number of splices: Annotated (sjdb) | 10912970 Number of splices: GT/AG | 10927935 Number of splices: GC/AG | 175584 Number of splices: AT/AC | 7193 Number of splices: Non-canonical | 35968 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.93 Insertion rate per base | 0.02% Insertion average length | 2.22 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 381341 % of reads mapped to multiple loci | 2.74% Number of reads mapped to too many loci | 64421 % of reads mapped to too many loci | 0.46% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 8.83% % of reads unmapped: other | 0.33% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1338794 1338794 1338794 N_multimapping 381341 381341 381341 N_noFeature 417340 11998455 493834 N_ambiguous 191138 748 78804 UnstrandedReadsAssigned:11578382 PositiveStrandReadsAssigned:187657 NegativeStrandReadsAssigned:11614222 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671364 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671364-trimmed-pair1.fastq SRR12671364-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,906,995 reads, 11,812,587 reads pseudoaligned [quant] estimated average fragment length: 246.772 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,036 rounds 52401 SRR12671364.ke.tsv 34699 SRR12671364.se.tsv 87100 total ==> SRR12671364.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1772.23 426 19.5095 Potri.005G024800.1.v4.1 1035 789.228 123 12.6491 Potri.004G059700.1.v4.1 961 715.608 16 1.81468 Potri.007G009000.2.v4.1 1416 1170.23 0 0 Potri.003G141000.2.v4.1 2943 2697.23 391.515 11.7811 Potri.016G087400.1.v4.1 270 96.2932 593 499.821 Potri.015G069301.1.v4.1 564 336.911 0 0 Potri.010G195200.1.v4.1 1773 1527.23 52 2.76347 Potri.012G127500.1.v4.1 977 731.427 268 29.7385 ==> SRR12671364.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 782 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 135 Potri.001G212900.v4.1 37 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 7 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 9 SRR12671364 completed mapping pipeline successfully