Starting /dee2/code/volunteer_pipeline.sh SRR12671366 current disk space = 3053328916480 free memory = 1467031980 SRR12671366 SRAfilesize fdbbcdffd69760aee97a229433e8a1c4 SRR12671366.sra SRR12671366.sra file validated SRR12671366 is paired end SRR12671366 is conventional basespace SRR12671366 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671366_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.511 37.0 37.0 37.0 37.0 37.0 2 36.3855 37.0 37.0 37.0 37.0 37.0 3 36.5335 37.0 37.0 37.0 37.0 37.0 4 36.6475 37.0 37.0 37.0 37.0 37.0 5 36.6115 37.0 37.0 37.0 37.0 37.0 6 36.655 37.0 37.0 37.0 37.0 37.0 7 36.4655 37.0 37.0 37.0 37.0 37.0 8 36.629 37.0 37.0 37.0 37.0 37.0 9 36.6635 37.0 37.0 37.0 37.0 37.0 10-14 36.6329 37.0 37.0 37.0 37.0 37.0 15-19 36.558499999999995 37.0 37.0 37.0 37.0 37.0 20-24 36.5707 37.0 37.0 37.0 37.0 37.0 25-29 36.5781 37.0 37.0 37.0 37.0 37.0 30-34 36.5555 37.0 37.0 37.0 37.0 37.0 35-39 36.5035 37.0 37.0 37.0 37.0 37.0 40-44 36.5058 37.0 37.0 37.0 37.0 37.0 45-49 36.4687 37.0 37.0 37.0 37.0 37.0 50-54 36.477700000000006 37.0 37.0 37.0 37.0 37.0 55-59 36.4134 37.0 37.0 37.0 37.0 37.0 60-64 36.3846 37.0 37.0 37.0 37.0 37.0 65-69 36.37650000000001 37.0 37.0 37.0 37.0 37.0 70-74 36.3917 37.0 37.0 37.0 37.0 37.0 75-79 36.3506 37.0 37.0 37.0 37.0 37.0 80-84 36.3529 37.0 37.0 37.0 37.0 37.0 85-89 36.2863 37.0 37.0 37.0 37.0 37.0 90-94 36.28770000000001 37.0 37.0 37.0 37.0 37.0 95-99 36.2304 37.0 37.0 37.0 37.0 37.0 100-104 36.2605 37.0 37.0 37.0 37.0 37.0 105-109 36.2259 37.0 37.0 37.0 37.0 37.0 110-114 36.133399999999995 37.0 37.0 37.0 37.0 37.0 115-119 36.162400000000005 37.0 37.0 37.0 37.0 37.0 120-124 36.109 37.0 37.0 37.0 37.0 37.0 125-129 36.1531 37.0 37.0 37.0 37.0 37.0 130-134 36.069300000000005 37.0 37.0 37.0 37.0 37.0 135-139 36.0613 37.0 37.0 37.0 37.0 37.0 140-144 35.9679 37.0 37.0 37.0 37.0 37.0 145-149 35.9601 37.0 37.0 37.0 37.0 37.0 150-151 35.84975 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 0.0 23 1.0 24 3.0 25 0.0 26 3.0 27 6.0 28 11.0 29 15.0 30 22.0 31 30.0 32 38.0 33 56.0 34 120.0 35 291.0 36 2958.0 37 445.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.550000000000004 10.25 5.8500000000000005 37.35 2 18.743743743743742 12.862862862862862 39.16416416416417 29.22922922922923 3 17.575 17.849999999999998 28.775000000000002 35.8 4 23.200000000000003 26.05 23.025000000000002 27.725 5 24.025 31.924999999999997 24.525 19.525000000000002 6 19.325 34.025 24.325 22.325 7 14.000000000000002 24.775 44.800000000000004 16.425 8 16.725 24.9 33.0 25.374999999999996 9 18.099999999999998 23.175 34.1 24.625 10-14 19.384999999999998 30.175 28.000000000000004 22.439999999999998 15-19 20.119999999999997 27.555000000000003 28.485 23.84 20-24 19.814999999999998 28.58 27.965 23.64 25-29 19.72 28.765 27.85 23.665 30-34 19.61 27.965 28.705000000000002 23.72 35-39 19.905 28.53 27.755000000000003 23.810000000000002 40-44 19.97 29.04 27.22 23.77 45-49 19.7 28.494999999999997 27.99 23.815 50-54 19.55 28.895 28.065 23.49 55-59 19.865 28.425 27.815 23.895 60-64 20.5 28.349999999999998 27.18 23.97 65-69 20.06 28.660000000000004 28.27 23.01 70-74 19.575 27.985 28.345 24.095 75-79 20.26 28.549999999999997 27.584999999999997 23.605 80-84 20.244999999999997 28.105000000000004 27.755000000000003 23.895 85-89 20.515 28.13 27.93 23.425 90-94 19.485 28.93 27.029999999999998 24.555 95-99 20.205000000000002 28.144999999999996 27.93 23.72 100-104 20.580000000000002 28.025 27.955000000000002 23.44 105-109 19.98 28.82 27.339999999999996 23.86 110-114 20.415 28.18 27.589999999999996 23.815 115-119 20.895 28.33 27.04 23.735 120-124 20.31 28.16 27.860000000000003 23.669999999999998 125-129 20.605 27.76 28.315 23.32 130-134 20.775 27.62 27.860000000000003 23.745 135-139 20.53 28.64 27.045 23.785 140-144 20.435 27.99 27.965 23.61 145-149 20.935000000000002 28.505000000000003 26.775 23.785 150-151 20.674999999999997 29.175 25.924999999999997 24.224999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.5 20 1.0 21 0.5 22 1.0 23 2.0 24 4.5 25 6.5 26 8.0 27 8.0 28 9.5 29 11.5 30 17.5 31 26.5 32 30.0 33 45.5 34 63.5 35 70.0 36 89.0 37 122.5 38 149.0 39 164.0 40 187.0 41 218.0 42 220.5 43 220.5 44 236.0 45 269.5 46 268.5 47 238.5 48 231.0 49 212.0 50 196.0 51 154.5 52 114.0 53 98.5 54 72.0 55 56.5 56 53.0 57 35.5 58 22.5 59 20.0 60 12.0 61 7.0 62 6.5 63 5.0 64 4.0 65 3.5 66 1.0 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 1.0 74 1.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.1 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 83.3 #Duplication Level Percentage of deduplicated Percentage of total 1 83.73349339735896 69.75 2 13.445378151260504 22.400000000000002 3 2.100840336134454 5.25 4 0.6002400960384154 2.0 5 0.030012004801920768 0.125 6 0.060024009603841535 0.3 7 0.030012004801920768 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ATGTATTGTGCATGGATGTCACGTTAGTTACATGCTCATAGGACTTAGAG 7 0.17500000000000002 No Hit TGTGGATATTGGTGGTTCTGTGTGTATGAATTTAGTAGATCAACAGGAAC 6 0.15 No Hit GTCCTAGCATCATGAGAATTCTCAATCTTGTAATAACCAGCATGATTTCC 6 0.15 No Hit GTAGAAAACAAAATCAAGCCCAAATTAACCATAACAAAAGCCAGTAAAGG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.1375 0.0 0.0 0.0 0.0 96-97 0.21250000000000002 0.0 0.0 0.0 0.0 98-99 0.3375 0.0 0.0 0.0 0.0 100-101 0.375 0.0 0.0 0.0 0.0 102-103 0.375 0.0 0.0 0.0 0.0 104-105 0.42500000000000004 0.0 0.0 0.0 0.0 106-107 0.5 0.0 0.0 0.0 0.0 108-109 0.525 0.0 0.0 0.0 0.0 110-111 0.575 0.0 0.0 0.0 0.0 112-113 0.6499999999999999 0.0 0.0 0.0 0.0 114-115 0.7749999999999999 0.0 0.0 0.0 0.0 116-117 0.875 0.0 0.0 0.0 0.0 118-119 0.9125000000000001 0.0 0.0 0.0 0.0 120-121 0.95 0.0 0.0 0.0 0.0 122-123 1.0 0.0 0.0 0.0 0.0 124-125 1.0875 0.0 0.0 0.0 0.0 126-127 1.225 0.0 0.0 0.0 0.0 128-129 1.35 0.0 0.0 0.0 0.0 130-131 1.4375 0.0 0.0 0.0 0.0 132-133 1.575 0.0 0.0 0.0 0.0 134-135 1.675 0.0 0.0 0.0 0.0 136-137 1.9125 0.0 0.0 0.0 0.0 138-139 2.1500000000000004 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12671366 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671366_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2655 37.0 37.0 37.0 37.0 37.0 2 35.9765 37.0 37.0 37.0 37.0 37.0 3 36.227 37.0 37.0 37.0 37.0 37.0 4 36.124 37.0 37.0 37.0 37.0 37.0 5 36.297 37.0 37.0 37.0 37.0 37.0 6 36.251 37.0 37.0 37.0 37.0 37.0 7 36.2295 37.0 37.0 37.0 37.0 37.0 8 36.309 37.0 37.0 37.0 37.0 37.0 9 36.1635 37.0 37.0 37.0 37.0 37.0 10-14 36.2668 37.0 37.0 37.0 37.0 37.0 15-19 36.2652 37.0 37.0 37.0 37.0 37.0 20-24 36.1841 37.0 37.0 37.0 37.0 37.0 25-29 36.1381 37.0 37.0 37.0 37.0 37.0 30-34 36.1312 37.0 37.0 37.0 37.0 37.0 35-39 36.1448 37.0 37.0 37.0 37.0 37.0 40-44 36.11659999999999 37.0 37.0 37.0 37.0 37.0 45-49 36.1109 37.0 37.0 37.0 37.0 37.0 50-54 36.01950000000001 37.0 37.0 37.0 37.0 37.0 55-59 35.9957 37.0 37.0 37.0 37.0 37.0 60-64 36.025400000000005 37.0 37.0 37.0 37.0 37.0 65-69 35.9919 37.0 37.0 37.0 37.0 37.0 70-74 35.9427 37.0 37.0 37.0 37.0 37.0 75-79 35.9303 37.0 37.0 37.0 37.0 37.0 80-84 35.8772 37.0 37.0 37.0 37.0 37.0 85-89 35.885799999999996 37.0 37.0 37.0 37.0 37.0 90-94 35.8227 37.0 37.0 37.0 37.0 37.0 95-99 35.778200000000005 37.0 37.0 37.0 37.0 37.0 100-104 35.7645 37.0 37.0 37.0 37.0 37.0 105-109 35.6861 37.0 37.0 37.0 37.0 37.0 110-114 35.6575 37.0 37.0 37.0 37.0 37.0 115-119 35.7729 37.0 37.0 37.0 37.0 37.0 120-124 35.733900000000006 37.0 37.0 37.0 37.0 37.0 125-129 35.7124 37.0 37.0 37.0 37.0 37.0 130-134 35.5906 37.0 37.0 37.0 37.0 37.0 135-139 35.4615 37.0 37.0 37.0 37.0 37.0 140-144 35.6137 37.0 37.0 37.0 37.0 37.0 145-149 35.4742 37.0 37.0 37.0 37.0 37.0 150-151 35.3005 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 1.0 14 1.0 15 1.0 16 0.0 17 0.0 18 2.0 19 3.0 20 1.0 21 0.0 22 5.0 23 5.0 24 12.0 25 8.0 26 13.0 27 8.0 28 12.0 29 23.0 30 28.0 31 39.0 32 54.0 33 109.0 34 183.0 35 552.0 36 2693.0 37 246.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.15 22.400000000000002 10.45 23.0 2 25.674999999999997 26.950000000000003 32.5 14.875 3 20.974999999999998 27.825 32.975 18.224999999999998 4 24.925 34.0 23.5 17.575 5 24.325 37.9 21.7 16.075 6 17.825 41.5 22.175 18.5 7 18.7 21.75 40.849999999999994 18.7 8 17.825 25.025 31.674999999999997 25.474999999999998 9 23.125 23.425 30.3 23.150000000000002 10-14 23.025000000000002 29.915000000000003 26.340000000000003 20.72 15-19 23.1 27.425 28.29 21.185000000000002 20-24 23.330000000000002 28.470000000000002 27.16 21.04 25-29 23.169999999999998 28.199999999999996 28.09 20.54 30-34 22.71 27.845 28.21 21.235 35-39 22.830000000000002 28.035 27.700000000000003 21.435000000000002 40-44 22.865 28.625 27.985 20.525 45-49 22.650000000000002 28.144999999999996 28.48 20.724999999999998 50-54 22.91 28.01 27.589999999999996 21.490000000000002 55-59 22.814999999999998 27.865000000000002 28.235 21.085 60-64 22.564999999999998 27.834999999999997 27.839999999999996 21.759999999999998 65-69 23.155 27.175 28.055000000000003 21.615000000000002 70-74 23.03 28.105000000000004 27.435 21.43 75-79 22.585 28.1 27.279999999999998 22.035 80-84 23.18 27.98 27.27 21.57 85-89 22.645 28.449999999999996 27.245 21.66 90-94 23.72 27.67 27.605 21.005 95-99 23.665 28.000000000000004 27.334999999999997 21.0 100-104 23.474999999999998 28.060000000000002 27.565 20.9 105-109 23.369999999999997 28.189999999999998 27.83 20.61 110-114 23.82 27.415 27.755000000000003 21.01 115-119 23.43 27.93 27.750000000000004 20.89 120-124 24.03 27.500000000000004 27.474999999999998 20.995 125-129 23.535 28.110000000000003 27.205000000000002 21.15 130-134 23.765 27.615000000000002 27.655 20.965 135-139 23.875 27.805000000000003 28.299999999999997 20.02 140-144 24.345 27.115000000000002 27.67 20.87 145-149 24.684936987397478 27.800560112022403 27.4004800960192 20.114022804560914 150-151 25.15 28.349999999999998 26.8 19.7 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.5 8 0.5 9 0.0 10 0.5 11 0.5 12 0.0 13 0.5 14 2.0 15 1.5 16 1.0 17 1.5 18 1.5 19 1.0 20 1.0 21 2.5 22 3.0 23 3.0 24 2.0 25 2.5 26 8.5 27 12.5 28 11.0 29 14.0 30 21.5 31 29.0 32 37.5 33 37.5 34 44.5 35 66.5 36 79.5 37 100.0 38 127.0 39 155.5 40 172.0 41 215.0 42 289.5 43 302.5 44 276.5 45 264.5 46 237.5 47 218.5 48 216.5 49 209.0 50 170.0 51 126.0 52 103.5 53 80.0 54 68.5 55 68.5 56 62.0 57 43.5 58 29.5 59 16.5 60 10.0 61 8.0 62 8.0 63 6.5 64 2.5 65 1.0 66 1.0 67 2.0 68 2.5 69 0.5 70 0.0 71 0.5 72 0.5 73 0.5 74 1.0 75 1.5 76 1.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.5 96 0.5 97 0.5 98 0.5 99 0.5 100 5.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.02 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 83.575 #Duplication Level Percentage of deduplicated Percentage of total 1 84.86389470535447 70.92500000000001 2 12.443912653305414 20.8 3 1.9742746036494168 4.95 4 0.44869877355668564 1.5 5 0.05982650314089141 0.25 6 0.08973975471133712 0.44999999999999996 7 0.029913251570445706 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.08973975471133712 0.95 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 13 0.325 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 13 0.325 No Hit AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 12 0.3 No Hit GAAAGATCCGGGTGTTGATGTATTTGAGCAAGAGCTACCAGCGCTTCTGA 7 0.17500000000000002 No Hit GAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAAT 6 0.15 No Hit ATTTTGTAGACGTGACTAAAGATGAGAAGCAAATGATGCACTTGTGGAAC 6 0.15 No Hit CGAAAATGGAGAACCTTAATTTCATTTCTCTCTTTCTCCTCTCACTTATC 6 0.15 No Hit GAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCA 5 0.125 No Hit GAGCTATCTGGCATTCCTCCAGCACCAAGGGGTGTTCCTCAAATCACTGT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.16249999999999998 0.0 0.0 0.0 0.0 96-97 0.2375 0.0 0.0 0.0 0.0 98-99 0.3625 0.0 0.0 0.0 0.0 100-101 0.4 0.0 0.0 0.0 0.0 102-103 0.4 0.0 0.0 0.0 0.0 104-105 0.44999999999999996 0.0 0.0 0.0 0.0 106-107 0.525 0.0 0.0 0.0 0.0 108-109 0.55 0.0 0.0 0.0 0.0 110-111 0.6 0.0 0.0 0.0 0.0 112-113 0.675 0.0 0.0 0.0 0.0 114-115 0.8 0.0 0.0 0.0 0.0 116-117 0.9 0.0 0.0 0.0 0.0 118-119 0.9375 0.0 0.0 0.0 0.0 120-121 0.975 0.0 0.0 0.0 0.0 122-123 1.025 0.0 0.0 0.0 0.0 124-125 1.1125 0.0 0.0 0.0 0.0 126-127 1.25 0.0 0.0 0.0 0.0 128-129 1.375 0.0 0.0 0.0 0.0 130-131 1.4625 0.0 0.0 0.0 0.0 132-133 1.6 0.0 0.0 0.0 0.0 134-135 1.7 0.0 0.0 0.0 0.0 136-137 1.95 0.0 0.0 0.0 0.0 138-139 2.2 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 729591 spots for SRR12671366.sra Written 729591 spots for SRR12671366.sra Read 729591 spots for SRR12671366.sra Written 729591 spots for SRR12671366.sra Read 729591 spots for SRR12671366.sra Written 729591 spots for SRR12671366.sra Read 729591 spots for SRR12671366.sra Written 729591 spots for SRR12671366.sra Read 729591 spots for SRR12671366.sra Written 729591 spots for SRR12671366.sra Read 729591 spots for SRR12671366.sra Written 729591 spots for SRR12671366.sra Read 729591 spots for SRR12671366.sra Written 729591 spots for SRR12671366.sra Read 729591 spots for SRR12671366.sra Written 729591 spots for SRR12671366.sra Read 729591 spots for SRR12671366.sra Written 729591 spots for SRR12671366.sra Read 729591 spots for SRR12671366.sra Written 729591 spots for SRR12671366.sra Read 729591 spots for SRR12671366.sra Written 729591 spots for SRR12671366.sra Read 729591 spots for SRR12671366.sra Written 729591 spots for SRR12671366.sra Read 729591 spots for SRR12671366.sra Written 729591 spots for SRR12671366.sra Read 729591 spots for SRR12671366.sra Written 729591 spots for SRR12671366.sra Read 729591 spots for SRR12671366.sra Written 729591 spots for SRR12671366.sra Read 729591 spots for SRR12671366.sra Written 729591 spots for SRR12671366.sra Read 729591 spots for SRR12671366.sra Written 729591 spots for SRR12671366.sra Read 729591 spots for SRR12671366.sra Written 729591 spots for SRR12671366.sra Read 729591 spots for SRR12671366.sra Written 729591 spots for SRR12671366.sra Read 729599 spots for SRR12671366.sra Written 729599 spots for SRR12671366.sra SRR ids: ['SRR12671366.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_wa8rx2d7 SRR12671366.sra spots: 14591828 blocks: [[1, 729591], [729592, 1459182], [1459183, 2188773], [2188774, 2918364], [2918365, 3647955], [3647956, 4377546], [4377547, 5107137], [5107138, 5836728], [5836729, 6566319], [6566320, 7295910], [7295911, 8025501], [8025502, 8755092], [8755093, 9484683], [9484684, 10214274], [10214275, 10943865], [10943866, 11673456], [11673457, 12403047], [12403048, 13132638], [13132639, 13862229], [13862230, 14591828]] SRR12671366 file size 4937241 SRR12671366 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671366 SRR12671366_1.fastq SRR12671366_2.fastq Input file: SRR12671366_1.fastq Paired file: SRR12671366_2.fastq trimmed: SRR12671366-trimmed-pair1.fastq, SRR12671366-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 19:58:19 2025 >> started Tue Feb 11 19:58:36 2025 >> done (16.193s) 14591828 read pairs processed; of these: 58 ( 0.00%) short read pairs filtered out after trimming by size control 2762 ( 0.02%) empty read pairs filtered out after trimming by size control 14589008 (99.98%) read pairs available; of these: 474349 ( 3.25%) trimmed read pairs available after processing 14114659 (96.75%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 4 0.00% 20 1 0.00% 21 4 0.00% 22 7 0.00% 23 10 0.00% 24 9 0.00% 25 10 0.00% 26 8 0.00% 27 7 0.00% 28 8 0.00% 29 10 0.00% 30 14 0.00% 31 13 0.00% 32 9 0.00% 33 12 0.00% 34 9 0.00% 35 9 0.00% 36 7 0.00% 37 14 0.00% 38 13 0.00% 39 10 0.00% 40 22 0.00% 41 14 0.00% 42 8 0.00% 43 17 0.00% 44 15 0.00% 45 14 0.00% 46 16 0.00% 47 25 0.00% 48 19 0.00% 49 22 0.00% 50 31 0.00% 51 30 0.00% 52 31 0.00% 53 41 0.00% 54 39 0.00% 55 42 0.00% 56 48 0.00% 57 64 0.00% 58 64 0.00% 59 78 0.00% 60 85 0.00% 61 93 0.00% 62 132 0.00% 63 137 0.00% 64 136 0.00% 65 165 0.00% 66 162 0.00% 67 186 0.00% 68 224 0.00% 69 288 0.00% 70 318 0.00% 71 327 0.00% 72 380 0.00% 73 419 0.00% 74 418 0.00% 75 512 0.00% 76 590 0.00% 77 637 0.00% 78 661 0.00% 79 735 0.01% 80 744 0.01% 81 991 0.01% 82 1040 0.01% 83 1137 0.01% 84 1254 0.01% 85 1340 0.01% 86 1395 0.01% 87 1534 0.01% 88 1751 0.01% 89 1758 0.01% 90 1740 0.01% 91 1927 0.01% 92 2128 0.01% 93 2204 0.02% 94 2357 0.02% 95 2593 0.02% 96 2705 0.02% 97 2973 0.02% 98 2988 0.02% 99 3034 0.02% 100 3149 0.02% 101 3360 0.02% 102 3424 0.02% 103 3809 0.03% 104 3892 0.03% 105 3946 0.03% 106 4184 0.03% 107 4493 0.03% 108 4415 0.03% 109 4707 0.03% 110 4828 0.03% 111 4942 0.03% 112 5166 0.04% 113 5153 0.04% 114 5540 0.04% 115 5796 0.04% 116 5973 0.04% 117 6253 0.04% 118 6544 0.04% 119 6699 0.05% 120 7003 0.05% 121 6994 0.05% 122 7152 0.05% 123 7379 0.05% 124 7697 0.05% 125 7783 0.05% 126 8172 0.06% 127 8498 0.06% 128 8828 0.06% 129 8885 0.06% 130 9177 0.06% 131 9208 0.06% 132 9702 0.07% 133 10023 0.07% 134 10100 0.07% 135 10591 0.07% 136 10834 0.07% 137 11122 0.08% 138 11537 0.08% 139 11956 0.08% 140 12158 0.08% 141 12367 0.08% 142 12621 0.09% 143 12782 0.09% 144 13307 0.09% 145 13548 0.09% 146 13981 0.10% 147 13960 0.10% 148 14815 0.10% 149 15045 0.10% 150 15818 0.11% 151 14114659 96.75% 14589008 reads passed initial QC criterion=sequence-density sequence-density=0.55 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=23 prefix-density=0.55 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.13 sequence-density-rank=22 fanout-score=20.98 fanout-score-rank=1 prefix-density=0.39 prefix-fanout=6.9 sequence=CCATCTTCTTCATCTATAGATTTCAATCACAACAG criterion=sequence-density sequence-density=1.17 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=26 prefix-density=1.17 prefix-fanout=2.0 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=26.55 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=2.1 sequence=GGAACTCAAACGCATAGCTTCCTACAAATACCCCAGCTAGCCAATACTCTCCACCACTAAACCCAAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTCCTCCCCTTCGCTAGCCGGAAAGGCGGTGAAGCTCAACCCCTCCTCCTCTGAGATCATGGGCAATGGCCGTGTCTCCATGAGGAAAACCACCAAGCCTGTTCCCTCCGGGAGCCCATGGTACGGACCAGACCGTGTTAAATACTTGGGCCCGTTCTCTGGTGAGCCCCCATCCTACTTGACTGGTGAGTTCCCTGGTGACTACGGCTGGGACACTGCTGG SRR12671366 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 19:59:20 Started mapping on | Feb 11 19:59:20 Finished on | Feb 11 20:01:06 Mapping speed, Million of reads per hour | 495.48 Number of input reads | 14589008 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 13515083 Uniquely mapped reads % | 92.64% Average mapped length | 298.91 Number of splices: Total | 13936096 Number of splices: Annotated (sjdb) | 13659912 Number of splices: GT/AG | 13661000 Number of splices: GC/AG | 229532 Number of splices: AT/AC | 8576 Number of splices: Non-canonical | 36988 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.92 Insertion rate per base | 0.02% Insertion average length | 2.22 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 336867 % of reads mapped to multiple loci | 2.31% Number of reads mapped to too many loci | 70258 % of reads mapped to too many loci | 0.48% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.44% % of reads unmapped: other | 0.13% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 737058 737058 737058 N_multimapping 336867 336867 336867 N_noFeature 493208 13286315 552415 N_ambiguous 262512 1066 92316 UnstrandedReadsAssigned:12759363 PositiveStrandReadsAssigned:227702 NegativeStrandReadsAssigned:12870352 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671366 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671366-trimmed-pair1.fastq SRR12671366-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,589,008 reads, 12,825,208 reads pseudoaligned [quant] estimated average fragment length: 321.266 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,150 rounds 52401 SRR12671366.ke.tsv 34699 SRR12671366.se.tsv 87100 total ==> SRR12671366.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1697.73 629 24.4797 Potri.005G024800.1.v4.1 1035 714.734 268 24.7751 Potri.004G059700.1.v4.1 961 641.157 3 0.309159 Potri.007G009000.2.v4.1 1416 1095.73 0 0 Potri.003G141000.2.v4.1 2943 2622.73 841 21.1869 Potri.016G087400.1.v4.1 270 66.3393 705 702.172 Potri.015G069301.1.v4.1 564 270.454 0 0 Potri.010G195200.1.v4.1 1773 1452.73 116 5.2759 Potri.012G127500.1.v4.1 977 656.965 47 4.72695 ==> SRR12671366.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 101 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 180 Potri.001G212900.v4.1 14 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 9 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 8 SRR12671366 completed mapping pipeline successfully