Starting /dee2/code/volunteer_pipeline.sh SRR12671367 current disk space = 3053082914816 free memory = 1253724128 SRR12671367 SRAfilesize f6b01ab7e842c0b0a1f4ae82e5b2135f SRR12671367.sra SRR12671367.sra file validated SRR12671367 is paired end SRR12671367 is conventional basespace SRR12671367 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671367_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.6875 37.0 37.0 37.0 37.0 37.0 2 36.462 37.0 37.0 37.0 37.0 37.0 3 36.59 37.0 37.0 37.0 37.0 37.0 4 36.5715 37.0 37.0 37.0 37.0 37.0 5 36.6845 37.0 37.0 37.0 37.0 37.0 6 36.6315 37.0 37.0 37.0 37.0 37.0 7 36.564 37.0 37.0 37.0 37.0 37.0 8 36.5645 37.0 37.0 37.0 37.0 37.0 9 36.598 37.0 37.0 37.0 37.0 37.0 10-14 36.624 37.0 37.0 37.0 37.0 37.0 15-19 36.5918 37.0 37.0 37.0 37.0 37.0 20-24 36.6045 37.0 37.0 37.0 37.0 37.0 25-29 36.603300000000004 37.0 37.0 37.0 37.0 37.0 30-34 36.555499999999995 37.0 37.0 37.0 37.0 37.0 35-39 36.541199999999996 37.0 37.0 37.0 37.0 37.0 40-44 36.5668 37.0 37.0 37.0 37.0 37.0 45-49 36.503 37.0 37.0 37.0 37.0 37.0 50-54 36.4413 37.0 37.0 37.0 37.0 37.0 55-59 36.518299999999996 37.0 37.0 37.0 37.0 37.0 60-64 36.454299999999996 37.0 37.0 37.0 37.0 37.0 65-69 36.4462 37.0 37.0 37.0 37.0 37.0 70-74 36.40839999999999 37.0 37.0 37.0 37.0 37.0 75-79 36.4408 37.0 37.0 37.0 37.0 37.0 80-84 36.426700000000004 37.0 37.0 37.0 37.0 37.0 85-89 36.3085 37.0 37.0 37.0 37.0 37.0 90-94 36.372 37.0 37.0 37.0 37.0 37.0 95-99 36.3617 37.0 37.0 37.0 37.0 37.0 100-104 36.3231 37.0 37.0 37.0 37.0 37.0 105-109 36.2942 37.0 37.0 37.0 37.0 37.0 110-114 36.268299999999996 37.0 37.0 37.0 37.0 37.0 115-119 36.2562 37.0 37.0 37.0 37.0 37.0 120-124 36.1909 37.0 37.0 37.0 37.0 37.0 125-129 36.258799999999994 37.0 37.0 37.0 37.0 37.0 130-134 36.1541 37.0 37.0 37.0 37.0 37.0 135-139 36.174899999999994 37.0 37.0 37.0 37.0 37.0 140-144 36.1327 37.0 37.0 37.0 37.0 37.0 145-149 36.0778 37.0 37.0 37.0 37.0 37.0 150-151 35.9755 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 1.0 24 0.0 25 1.0 26 4.0 27 1.0 28 7.0 29 17.0 30 20.0 31 33.0 32 44.0 33 64.0 34 92.0 35 217.0 36 2960.0 37 539.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.1 12.025 5.2749999999999995 38.6 2 22.617853560682047 11.359077231695085 33.6258776328987 32.39719157472417 3 17.549999999999997 15.925 28.775000000000002 37.75 4 24.075 22.5 23.7 29.725 5 25.324999999999996 30.375000000000004 22.650000000000002 21.65 6 20.925 32.775 22.85 23.45 7 14.499999999999998 28.4 40.925 16.175 8 16.075 26.125 33.650000000000006 24.15 9 17.5 24.275 36.025 22.2 10-14 19.07 30.740000000000002 27.77 22.42 15-19 20.16 28.87 27.18 23.79 20-24 20.18 28.64 27.29 23.89 25-29 20.355 28.799999999999997 27.565 23.28 30-34 19.919999999999998 28.904999999999998 27.134999999999998 24.04 35-39 19.814999999999998 29.29 27.375 23.52 40-44 20.185 29.765000000000004 27.07 22.98 45-49 20.225 28.915000000000003 27.015 23.845 50-54 20.4 28.505000000000003 26.895000000000003 24.2 55-59 19.689999999999998 28.78 27.155 24.375 60-64 19.66 28.82 27.889999999999997 23.630000000000003 65-69 20.72 28.939999999999998 26.625 23.715 70-74 20.21 28.26 27.43 24.099999999999998 75-79 19.939999999999998 28.62 27.61 23.830000000000002 80-84 20.275000000000002 28.835 27.315 23.575 85-89 19.925 28.754999999999995 27.275 24.044999999999998 90-94 20.275000000000002 28.449999999999996 26.875 24.4 95-99 20.46 28.21 27.185 24.145 100-104 20.735 28.144999999999996 26.619999999999997 24.5 105-109 20.51 28.015 27.465 24.01 110-114 20.91 27.87 26.924999999999997 24.295 115-119 20.505000000000003 28.439999999999998 27.33 23.724999999999998 120-124 20.715 27.29 27.625 24.37 125-129 20.085 27.889999999999997 26.815 25.21 130-134 21.325 27.375 27.01 24.29 135-139 20.76 27.375 27.134999999999998 24.73 140-144 21.21 27.525 26.765 24.5 145-149 20.880000000000003 28.005000000000003 26.745 24.37 150-151 21.1375 27.1625 27.0125 24.6875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.5 20 1.0 21 0.5 22 0.5 23 1.5 24 4.0 25 5.0 26 5.0 27 5.0 28 9.0 29 16.5 30 23.5 31 31.0 32 40.5 33 51.0 34 64.5 35 83.5 36 96.5 37 102.5 38 132.0 39 154.5 40 167.0 41 183.0 42 218.5 43 248.0 44 254.5 45 250.0 46 218.0 47 207.5 48 224.5 49 221.0 50 190.0 51 157.5 52 140.5 53 116.0 54 83.5 55 66.5 56 56.5 57 43.0 58 29.5 59 26.5 60 21.5 61 15.0 62 9.0 63 9.0 64 6.5 65 1.0 66 1.0 67 1.0 68 0.5 69 2.5 70 2.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.3 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 83.25 #Duplication Level Percentage of deduplicated Percentage of total 1 84.44444444444444 70.3 2 12.192192192192191 20.3 3 2.4324324324324325 6.075 4 0.6906906906906907 2.3 5 0.21021021021021022 0.8750000000000001 6 0.03003003003003003 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CAGAGTGGTATCTCACTGACGGCTCGGACCCCCCCCGAAGGGGGCCTTCT 6 0.15 No Hit CTTCGGTCAGAGTCCCCGGCCCGTTTTCACTGCTAGTTGCTGGCTGGGAG 5 0.125 No Hit GCAGACACCAATCCTATCATCTCTGGTTGGAGCCCAGTAGAATTTCTCCA 5 0.125 No Hit CCTTAGAGATGTAATAGCCCATGACAATAGGAAATATCAGAAATCCAATA 5 0.125 No Hit GCTGCTTCCAAAGTTTACATCACATGGGCTGCAAAACCTTGCTTTTGGCA 5 0.125 No Hit CCACCAACAAGAGGCCCAGCCCAGTAGATCCAGTTGTCATGGAAATCACC 5 0.125 No Hit GCTCCACCGCTTGTGCGGGCCCCCGTCAATTCCTTTGAGTTTCATTCTTG 5 0.125 No Hit GATAGAACTCGCACCGAGCTCCAGCTATCCTGAGGGAAACTTCGGAGGGA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.16249999999999998 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.30000000000000004 0.0 0.0 0.0 0.0 94-95 0.3375 0.0 0.0 0.0 0.0 96-97 0.3625 0.0 0.0 0.0 0.0 98-99 0.4375 0.0 0.0 0.0 0.0 100-101 0.55 0.0 0.0 0.0 0.0 102-103 0.5874999999999999 0.0 0.0 0.0 0.0 104-105 0.6375 0.0 0.0 0.0 0.0 106-107 0.6875 0.0 0.0 0.0 0.0 108-109 0.7124999999999999 0.0 0.0 0.0 0.0 110-111 0.85 0.0 0.0 0.0 0.0 112-113 1.0 0.0 0.0 0.0 0.0 114-115 1.1875 0.0 0.0 0.0 0.0 116-117 1.3250000000000002 0.0 0.0 0.0 0.0 118-119 1.45 0.0 0.0 0.0 0.0 120-121 1.625 0.0 0.0 0.0 0.0 122-123 1.9 0.0 0.0 0.0 0.0 124-125 2.2625 0.0 0.0 0.0 0.0 126-127 2.7125 0.0 0.0 0.0 0.0 128-129 3.0 0.0 0.0 0.0 0.0 130-131 3.1875 0.0 0.0 0.0 0.0 132-133 3.2875 0.0 0.0 0.0 0.0 134-135 3.525 0.0 0.0 0.0 0.0 136-137 3.85 0.0 0.0 0.0 0.0 138-139 4.0625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12671367 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671367_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4405 37.0 37.0 37.0 37.0 37.0 2 36.298 37.0 37.0 37.0 37.0 37.0 3 36.315 37.0 37.0 37.0 37.0 37.0 4 36.354 37.0 37.0 37.0 37.0 37.0 5 36.3785 37.0 37.0 37.0 37.0 37.0 6 36.448 37.0 37.0 37.0 37.0 37.0 7 36.3805 37.0 37.0 37.0 37.0 37.0 8 36.4675 37.0 37.0 37.0 37.0 37.0 9 36.4615 37.0 37.0 37.0 37.0 37.0 10-14 36.4696 37.0 37.0 37.0 37.0 37.0 15-19 36.4211 37.0 37.0 37.0 37.0 37.0 20-24 36.3654 37.0 37.0 37.0 37.0 37.0 25-29 36.3602 37.0 37.0 37.0 37.0 37.0 30-34 36.34740000000001 37.0 37.0 37.0 37.0 37.0 35-39 36.323499999999996 37.0 37.0 37.0 37.0 37.0 40-44 36.3178 37.0 37.0 37.0 37.0 37.0 45-49 36.2979 37.0 37.0 37.0 37.0 37.0 50-54 36.2476 37.0 37.0 37.0 37.0 37.0 55-59 36.2738 37.0 37.0 37.0 37.0 37.0 60-64 36.242200000000004 37.0 37.0 37.0 37.0 37.0 65-69 36.23459999999999 37.0 37.0 37.0 37.0 37.0 70-74 36.1986 37.0 37.0 37.0 37.0 37.0 75-79 36.1649 37.0 37.0 37.0 37.0 37.0 80-84 36.179199999999994 37.0 37.0 37.0 37.0 37.0 85-89 36.2122 37.0 37.0 37.0 37.0 37.0 90-94 36.1537 37.0 37.0 37.0 37.0 37.0 95-99 36.135400000000004 37.0 37.0 37.0 37.0 37.0 100-104 36.0797 37.0 37.0 37.0 37.0 37.0 105-109 36.018899999999995 37.0 37.0 37.0 37.0 37.0 110-114 36.0215 37.0 37.0 37.0 37.0 37.0 115-119 36.1365 37.0 37.0 37.0 37.0 37.0 120-124 36.036300000000004 37.0 37.0 37.0 37.0 37.0 125-129 35.9847 37.0 37.0 37.0 37.0 37.0 130-134 35.9815 37.0 37.0 37.0 37.0 37.0 135-139 35.8633 37.0 37.0 37.0 37.0 37.0 140-144 35.9085 37.0 37.0 37.0 37.0 37.0 145-149 35.8214 37.0 37.0 37.0 37.0 37.0 150-151 35.59425 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 1.0 15 2.0 16 3.0 17 1.0 18 0.0 19 1.0 20 2.0 21 2.0 22 4.0 23 4.0 24 4.0 25 5.0 26 4.0 27 5.0 28 7.0 29 14.0 30 14.0 31 21.0 32 32.0 33 52.0 34 138.0 35 418.0 36 2894.0 37 371.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.975 25.85 8.275 23.9 2 28.175 25.674999999999997 30.175 15.975 3 21.349999999999998 27.500000000000004 33.324999999999996 17.825 4 23.65 33.75 24.675 17.925 5 24.8 37.525 20.3 17.375 6 20.825 40.575 21.2 17.4 7 23.150000000000002 22.5 35.9 18.45 8 20.125 25.95 28.749999999999996 25.174999999999997 9 22.3 24.2 28.875 24.625 10-14 23.505000000000003 30.320000000000004 25.385 20.79 15-19 24.645 27.384999999999998 27.305 20.665 20-24 24.044999999999998 28.754999999999995 26.965 20.235 25-29 23.580000000000002 28.585 27.22 20.615 30-34 23.724999999999998 28.15 27.22 20.905 35-39 23.465 28.189999999999998 27.24 21.105 40-44 23.799999999999997 27.575 27.66 20.965 45-49 23.54 28.32 27.075 21.065 50-54 24.09 28.03 26.765 21.115000000000002 55-59 24.395 27.439999999999998 27.055 21.11 60-64 24.205 27.275 27.375 21.145 65-69 24.265 26.700000000000003 28.15 20.885 70-74 23.474999999999998 27.77 26.995 21.759999999999998 75-79 23.785 27.21 27.88 21.125 80-84 24.0 27.279999999999998 27.284999999999997 21.435000000000002 85-89 23.98 26.825 26.88 22.314999999999998 90-94 24.305 27.71 26.965 21.02 95-99 23.885 27.77 26.57 21.775 100-104 24.21 27.42 26.93 21.44 105-109 24.27 26.905 27.46 21.365000000000002 110-114 24.115000000000002 27.66 27.355 20.87 115-119 24.154999999999998 28.134999999999998 26.995 20.715 120-124 24.279999999999998 27.529999999999998 27.27 20.919999999999998 125-129 24.12 27.67 27.305 20.905 130-134 24.84 27.26 27.43 20.47 135-139 24.91 27.544999999999998 27.05 20.495 140-144 24.560000000000002 27.700000000000003 27.46 20.28 145-149 24.91 27.345000000000002 27.12 20.625 150-151 25.724999999999998 26.637499999999996 27.224999999999998 20.4125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 1.0 8 0.5 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 1.0 21 0.5 22 1.5 23 4.0 24 3.5 25 3.5 26 4.0 27 4.0 28 6.0 29 9.5 30 19.5 31 21.5 32 25.0 33 31.5 34 36.0 35 53.5 36 76.0 37 94.5 38 106.0 39 144.0 40 182.0 41 177.5 42 213.5 43 273.0 44 272.0 45 258.0 46 261.0 47 247.5 48 225.5 49 201.5 50 190.5 51 187.5 52 139.0 53 102.0 54 101.0 55 71.5 56 46.0 57 47.0 58 42.0 59 35.0 60 20.5 61 9.5 62 13.0 63 14.0 64 6.5 65 0.0 66 0.5 67 1.0 68 0.5 69 0.0 70 1.0 71 2.0 72 1.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.5 87 1.0 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.5 96 1.0 97 0.5 98 0.0 99 0.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 83.675 #Duplication Level Percentage of deduplicated Percentage of total 1 85.21063639079773 71.3 2 11.293695847027188 18.9 3 2.5993426949507024 6.525 4 0.717060053779504 2.4 5 0.11951000896325066 0.5 6 0.029877502240812665 0.15 7 0.0 0.0 8 0.0 0.0 9 0.029877502240812665 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 9 0.22499999999999998 No Hit TAACGATCTGGGCACTGTCTCGGAGAGAGGCTCGGTGAAATAGACATGTC 6 0.15 No Hit GGGATTTCTAAAAATAATGTTAAGAATTTTTGCTGGTTTTTTGCGACGTT 5 0.125 No Hit GTTTTTGGCTGGAAACGGTGGGTCTTCTGGAACGCCGAACAAGCCAATCT 5 0.125 No Hit ATCTTGGCTGCAGGCCCATTCTCTGGTGGATCCATGAACCCAGCCCGATC 5 0.125 No Hit ACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.16249999999999998 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.32499999999999996 0.0 0.0 0.0 0.0 94-95 0.3625 0.0 0.0 0.0 0.0 96-97 0.3875 0.0 0.0 0.0 0.0 98-99 0.4625 0.0 0.0 0.0 0.0 100-101 0.575 0.0 0.0 0.0 0.0 102-103 0.6 0.0 0.0 0.0 0.0 104-105 0.6375 0.0 0.0 0.0 0.0 106-107 0.6875 0.0 0.0 0.0 0.0 108-109 0.7124999999999999 0.0 0.0 0.0 0.0 110-111 0.85 0.0 0.0 0.0 0.0 112-113 1.0 0.0 0.0 0.0 0.0 114-115 1.1875 0.0 0.0 0.0 0.0 116-117 1.35 0.0 0.0 0.0 0.0 118-119 1.475 0.0 0.0 0.0 0.0 120-121 1.65 0.0 0.0 0.0 0.0 122-123 1.9249999999999998 0.0 0.0 0.0 0.0 124-125 2.2875 0.0 0.0 0.0 0.0 126-127 2.7375 0.0 0.0 0.0 0.0 128-129 3.0250000000000004 0.0 0.0 0.0 0.0 130-131 3.2125 0.0 0.0 0.0 0.0 132-133 3.3125 0.0 0.0 0.0 0.0 134-135 3.55 0.0 0.0 0.0 0.0 136-137 3.8375000000000004 0.0 0.0 0.0 0.0 138-139 4.0375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 838734 spots for SRR12671367.sra Written 838734 spots for SRR12671367.sra Read 838734 spots for SRR12671367.sra Written 838734 spots for SRR12671367.sra Read 838734 spots for SRR12671367.sra Written 838734 spots for SRR12671367.sra Read 838734 spots for SRR12671367.sra Written 838734 spots for SRR12671367.sra Read 838734 spots for SRR12671367.sra Written 838734 spots for SRR12671367.sra Read 838734 spots for SRR12671367.sra Written 838734 spots for SRR12671367.sra Read 838734 spots for SRR12671367.sra Written 838734 spots for SRR12671367.sra Read 838734 spots for SRR12671367.sra Written 838734 spots for SRR12671367.sra Read 838734 spots for SRR12671367.sra Written 838734 spots for SRR12671367.sra Read 838734 spots for SRR12671367.sra Written 838734 spots for SRR12671367.sra Read 838734 spots for SRR12671367.sra Written 838734 spots for SRR12671367.sra Read 838734 spots for SRR12671367.sra Written 838734 spots for SRR12671367.sra Read 838734 spots for SRR12671367.sra Written 838734 spots for SRR12671367.sra Read 838734 spots for SRR12671367.sra Written 838734 spots for SRR12671367.sra Read 838734 spots for SRR12671367.sra Written 838734 spots for SRR12671367.sra Read 838751 spots for SRR12671367.sra Written 838751 spots for SRR12671367.sra Read 838734 spots for SRR12671367.sra Written 838734 spots for SRR12671367.sra Read 838734 spots for SRR12671367.sra Written 838734 spots for SRR12671367.sra Read 838734 spots for SRR12671367.sra Written 838734 spots for SRR12671367.sra Read 838734 spots for SRR12671367.sra Written 838734 spots for SRR12671367.sra SRR ids: ['SRR12671367.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_o2ucw0qc SRR12671367.sra spots: 16774697 blocks: [[1, 838734], [838735, 1677468], [1677469, 2516202], [2516203, 3354936], [3354937, 4193670], [4193671, 5032404], [5032405, 5871138], [5871139, 6709872], [6709873, 7548606], [7548607, 8387340], [8387341, 9226074], [9226075, 10064808], [10064809, 10903542], [10903543, 11742276], [11742277, 12581010], [12581011, 13419744], [13419745, 14258478], [14258479, 15097212], [15097213, 15935946], [15935947, 16774697]] SRR12671367 file size 5679075 SRR12671367 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671367 SRR12671367_1.fastq SRR12671367_2.fastq Input file: SRR12671367_1.fastq Paired file: SRR12671367_2.fastq trimmed: SRR12671367-trimmed-pair1.fastq, SRR12671367-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 20:22:36 2025 >> started Tue Feb 11 20:23:03 2025 >> done (27.492s) 16774697 read pairs processed; of these: 75 ( 0.00%) short read pairs filtered out after trimming by size control 7462 ( 0.04%) empty read pairs filtered out after trimming by size control 16767160 (99.96%) read pairs available; of these: 958688 ( 5.72%) trimmed read pairs available after processing 15808472 (94.28%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 5 0.00% 20 9 0.00% 21 7 0.00% 22 8 0.00% 23 10 0.00% 24 7 0.00% 25 10 0.00% 26 14 0.00% 27 11 0.00% 28 18 0.00% 29 10 0.00% 30 9 0.00% 31 14 0.00% 32 24 0.00% 33 20 0.00% 34 13 0.00% 35 18 0.00% 36 21 0.00% 37 28 0.00% 38 22 0.00% 39 21 0.00% 40 21 0.00% 41 39 0.00% 42 29 0.00% 43 34 0.00% 44 30 0.00% 45 40 0.00% 46 30 0.00% 47 49 0.00% 48 55 0.00% 49 62 0.00% 50 68 0.00% 51 87 0.00% 52 89 0.00% 53 90 0.00% 54 77 0.00% 55 106 0.00% 56 98 0.00% 57 136 0.00% 58 152 0.00% 59 207 0.00% 60 196 0.00% 61 262 0.00% 62 283 0.00% 63 308 0.00% 64 342 0.00% 65 360 0.00% 66 435 0.00% 67 488 0.00% 68 492 0.00% 69 608 0.00% 70 707 0.00% 71 772 0.00% 72 892 0.01% 73 958 0.01% 74 1041 0.01% 75 1155 0.01% 76 1314 0.01% 77 1316 0.01% 78 1539 0.01% 79 1763 0.01% 80 1826 0.01% 81 2027 0.01% 82 2311 0.01% 83 2435 0.01% 84 2886 0.02% 85 3013 0.02% 86 3108 0.02% 87 3534 0.02% 88 3618 0.02% 89 3734 0.02% 90 3993 0.02% 91 4443 0.03% 92 4452 0.03% 93 4999 0.03% 94 5432 0.03% 95 5859 0.03% 96 5931 0.04% 97 6502 0.04% 98 6480 0.04% 99 6766 0.04% 100 7093 0.04% 101 7196 0.04% 102 7538 0.04% 103 7766 0.05% 104 8352 0.05% 105 8795 0.05% 106 9103 0.05% 107 9359 0.06% 108 9597 0.06% 109 10066 0.06% 110 10373 0.06% 111 10410 0.06% 112 11161 0.07% 113 11018 0.07% 114 11499 0.07% 115 12117 0.07% 116 12617 0.08% 117 13320 0.08% 118 13379 0.08% 119 13890 0.08% 120 14184 0.08% 121 14665 0.09% 122 14611 0.09% 123 15061 0.09% 124 15568 0.09% 125 15950 0.10% 126 16648 0.10% 127 17113 0.10% 128 17944 0.11% 129 18224 0.11% 130 18749 0.11% 131 18782 0.11% 132 19075 0.11% 133 19816 0.12% 134 20074 0.12% 135 20650 0.12% 136 21158 0.13% 137 21916 0.13% 138 22468 0.13% 139 23387 0.14% 140 23820 0.14% 141 24050 0.14% 142 24682 0.15% 143 24731 0.15% 144 25226 0.15% 145 25534 0.15% 146 26299 0.16% 147 27035 0.16% 148 28290 0.17% 149 28408 0.17% 150 29541 0.18% 151 15808472 94.28% 16767160 reads passed initial QC criterion=sequence-density sequence-density=0.78 sequence-density-rank=1 fanout-score=2.41 fanout-score-rank=12 prefix-density=0.83 prefix-fanout=2.3 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.22 sequence-density-rank=26 fanout-score=4.89 fanout-score-rank=1 prefix-density=0.56 prefix-fanout=1.9 sequence=TTCACCAAGAGAAGCCTCGCTCAGGTACTTGTCAGCCAATTGGACTCTCTTCACATTCTCTTGCTCCTGGACAAGCATGTTTCCATACTCAAGGAGCTTCTCGATTGTCATCTTCGGCTGCTCAAA criterion=sequence-density sequence-density=0.63 sequence-density-rank=1 fanout-score=2.04 fanout-score-rank=28 prefix-density=0.64 prefix-fanout=2.0 sequence=TACCTTCTTCGC criterion=fanout-score sequence-density=0.22 sequence-density-rank=27 fanout-score=12.10 fanout-score-rank=1 prefix-density=0.72 prefix-fanout=3.7 sequence=AATGGCAGCCTCAGTTATGGCTTCACTGAACCTGAAACCATCTCCATTCACGGTTGAGAAGTCTTCAGTGAGAGGCCTCCCAACTCTTTCAAGGAGATCTTTCAAGATT SRR12671367 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 20:23:55 Started mapping on | Feb 11 20:23:55 Finished on | Feb 11 20:26:23 Mapping speed, Million of reads per hour | 407.85 Number of input reads | 16767160 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 15494116 Uniquely mapped reads % | 92.41% Average mapped length | 298.04 Number of splices: Total | 15242156 Number of splices: Annotated (sjdb) | 14973828 Number of splices: GT/AG | 14914874 Number of splices: GC/AG | 284474 Number of splices: AT/AC | 9276 Number of splices: Non-canonical | 33532 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.91 Insertion rate per base | 0.03% Insertion average length | 2.18 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 375647 % of reads mapped to multiple loci | 2.24% Number of reads mapped to too many loci | 168864 % of reads mapped to too many loci | 1.01% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.16% % of reads unmapped: other | 0.18% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 897397 897397 897397 N_multimapping 375647 375647 375647 N_noFeature 543792 15181751 627105 N_ambiguous 329055 1344 99339 UnstrandedReadsAssigned:14621269 PositiveStrandReadsAssigned:311021 NegativeStrandReadsAssigned:14767672 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671367 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671367-trimmed-pair1.fastq SRR12671367-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,767,160 reads, 14,802,552 reads pseudoaligned [quant] estimated average fragment length: 278.529 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,136 rounds 52401 SRR12671367.ke.tsv 34699 SRR12671367.se.tsv 87100 total ==> SRR12671367.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1740.47 470 14.0482 Potri.005G024800.1.v4.1 1035 757.471 225 15.4527 Potri.004G059700.1.v4.1 961 683.55 1 0.0761058 Potri.007G009000.2.v4.1 1416 1138.47 0 0 Potri.003G141000.2.v4.1 2943 2665.47 921 17.9752 Potri.016G087400.1.v4.1 270 71.7719 559 405.178 Potri.015G069301.1.v4.1 564 297.72 0 0 Potri.010G195200.1.v4.1 1773 1495.47 87 3.02642 Potri.012G127500.1.v4.1 977 699.534 64 4.75947 ==> SRR12671367.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 83 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 346 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 4 SRR12671367 completed mapping pipeline successfully