Starting /dee2/code/volunteer_pipeline.sh SRR12671368 current disk space = 3053118144512 free memory = 1465267364 SRR12671368 SRAfilesize 1f432bb463b1c4c23fc53e0ee5a78ebf SRR12671368.sra SRR12671368.sra file validated SRR12671368 is paired end SRR12671368 is conventional basespace SRR12671368 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671368_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.622 37.0 37.0 37.0 37.0 37.0 2 36.294 37.0 37.0 37.0 37.0 37.0 3 36.4975 37.0 37.0 37.0 37.0 37.0 4 36.5075 37.0 37.0 37.0 37.0 37.0 5 36.5915 37.0 37.0 37.0 37.0 37.0 6 36.548 37.0 37.0 37.0 37.0 37.0 7 36.4655 37.0 37.0 37.0 37.0 37.0 8 36.53 37.0 37.0 37.0 37.0 37.0 9 36.558 37.0 37.0 37.0 37.0 37.0 10-14 36.6038 37.0 37.0 37.0 37.0 37.0 15-19 36.6146 37.0 37.0 37.0 37.0 37.0 20-24 36.567099999999996 37.0 37.0 37.0 37.0 37.0 25-29 36.5577 37.0 37.0 37.0 37.0 37.0 30-34 36.5151 37.0 37.0 37.0 37.0 37.0 35-39 36.511700000000005 37.0 37.0 37.0 37.0 37.0 40-44 36.485 37.0 37.0 37.0 37.0 37.0 45-49 36.472899999999996 37.0 37.0 37.0 37.0 37.0 50-54 36.4639 37.0 37.0 37.0 37.0 37.0 55-59 36.404399999999995 37.0 37.0 37.0 37.0 37.0 60-64 36.4159 37.0 37.0 37.0 37.0 37.0 65-69 36.3555 37.0 37.0 37.0 37.0 37.0 70-74 36.3664 37.0 37.0 37.0 37.0 37.0 75-79 36.3153 37.0 37.0 37.0 37.0 37.0 80-84 36.3107 37.0 37.0 37.0 37.0 37.0 85-89 36.2787 37.0 37.0 37.0 37.0 37.0 90-94 36.23460000000001 37.0 37.0 37.0 37.0 37.0 95-99 36.264300000000006 37.0 37.0 37.0 37.0 37.0 100-104 36.240300000000005 37.0 37.0 37.0 37.0 37.0 105-109 36.2407 37.0 37.0 37.0 37.0 37.0 110-114 36.065599999999996 37.0 37.0 37.0 37.0 37.0 115-119 36.1279 37.0 37.0 37.0 37.0 37.0 120-124 36.1234 37.0 37.0 37.0 37.0 37.0 125-129 36.1191 37.0 37.0 37.0 37.0 37.0 130-134 36.034800000000004 37.0 37.0 37.0 37.0 37.0 135-139 36.095800000000004 37.0 37.0 37.0 37.0 37.0 140-144 35.9628 37.0 37.0 37.0 37.0 37.0 145-149 35.9535 37.0 37.0 37.0 37.0 37.0 150-151 35.92575 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 0.0 22 2.0 23 0.0 24 6.0 25 2.0 26 4.0 27 7.0 28 12.0 29 11.0 30 23.0 31 27.0 32 47.0 33 51.0 34 112.0 35 261.0 36 2999.0 37 435.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 50.4 10.575 3.975 35.05 2 18.809643395278755 12.12958312405826 41.36112506278252 27.69964841788046 3 17.825 18.6 29.025000000000002 34.55 4 23.400000000000002 25.074999999999996 24.575 26.950000000000003 5 23.525 33.95 23.175 19.35 6 18.5 35.525 25.324999999999996 20.65 7 13.750000000000002 25.775 44.05 16.425 8 14.649999999999999 24.8 36.15 24.4 9 16.8 21.975 36.025 25.2 10-14 18.965 30.84 27.79 22.405 15-19 19.525000000000002 28.78 27.58 24.115000000000002 20-24 19.7 28.34 28.544999999999998 23.415 25-29 19.615 28.560000000000002 27.58 24.245 30-34 19.12 28.62 28.27 23.990000000000002 35-39 20.05 29.165000000000003 27.74 23.044999999999998 40-44 19.900000000000002 29.189999999999998 27.834999999999997 23.075000000000003 45-49 19.97 29.2 27.775 23.055 50-54 20.845 28.16 27.944999999999997 23.05 55-59 20.549999999999997 28.38 27.855 23.215 60-64 20.445 28.57 27.500000000000004 23.485 65-69 19.830000000000002 29.01 27.74 23.419999999999998 70-74 20.11 29.49 26.955000000000002 23.445 75-79 19.759999999999998 28.999999999999996 27.644999999999996 23.595 80-84 19.905 28.754999999999995 28.025 23.315 85-89 19.759999999999998 28.660000000000004 27.66 23.919999999999998 90-94 19.885 28.425 27.894999999999996 23.794999999999998 95-99 19.965 28.810000000000002 27.55 23.674999999999997 100-104 19.75 28.57 27.62 24.060000000000002 105-109 19.75 28.43 27.855 23.965 110-114 19.7 28.405 28.02 23.875 115-119 20.0 28.92 27.744999999999997 23.335 120-124 20.225 28.544999999999998 27.529999999999998 23.7 125-129 20.905 27.875 27.565 23.655 130-134 20.735 28.585 27.750000000000004 22.93 135-139 21.175 28.33 26.805 23.69 140-144 20.565 28.1 27.785 23.549999999999997 145-149 20.44 28.410000000000004 27.68 23.47 150-151 20.25 28.3625 26.687499999999996 24.7 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 2.0 1 1.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.5 7 0.5 8 0.5 9 0.5 10 0.0 11 0.5 12 0.5 13 0.0 14 0.5 15 0.5 16 0.0 17 0.5 18 2.5 19 3.0 20 1.0 21 1.0 22 2.5 23 2.5 24 2.5 25 3.0 26 5.5 27 11.5 28 16.5 29 18.5 30 24.5 31 32.0 32 41.0 33 48.5 34 66.0 35 83.0 36 87.0 37 106.0 38 144.0 39 172.5 40 184.0 41 218.0 42 224.0 43 217.0 44 240.0 45 259.5 46 271.5 47 260.0 48 232.5 49 204.5 50 178.5 51 144.5 52 113.5 53 90.5 54 72.0 55 57.0 56 46.0 57 33.0 58 20.5 59 14.5 60 11.5 61 7.5 62 2.5 63 4.0 64 5.0 65 3.5 66 1.5 67 1.0 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.44999999999999996 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 82.875 #Duplication Level Percentage of deduplicated Percentage of total 1 83.28808446455506 69.025 2 13.604826546003016 22.55 3 2.3529411764705883 5.8500000000000005 4 0.6636500754147813 2.1999999999999997 5 0.09049773755656108 0.375 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCTTTGACTAAGATCGGGATTTCACCAAACCCAAGTATTAATTACATCA 5 0.125 No Hit CTCAGCTTCGCTGGCATTGTGCCTGGCATATATAATATTTTCTTTTATAG 5 0.125 No Hit CTTGGCTGGTCTTCCAGATTATCAGTTCCATCTTGCAGAATAGCATCAGT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.21250000000000002 0.0 0.0 0.0 0.0 96-97 0.225 0.0 0.0 0.0 0.0 98-99 0.2625 0.0 0.0 0.0 0.0 100-101 0.2875 0.0 0.0 0.0 0.0 102-103 0.3125 0.0 0.0 0.0 0.0 104-105 0.4375 0.0 0.0 0.0 0.0 106-107 0.4875 0.0 0.0 0.0 0.0 108-109 0.575 0.0 0.0 0.0 0.0 110-111 0.6625000000000001 0.0 0.0 0.0 0.0 112-113 0.7875 0.0 0.0 0.0 0.0 114-115 0.8625 0.0 0.0 0.0 0.0 116-117 0.95 0.0 0.0 0.0 0.0 118-119 1.025 0.0 0.0 0.0 0.0 120-121 1.1375 0.0 0.0 0.0 0.0 122-123 1.2125 0.0 0.0 0.0 0.0 124-125 1.3250000000000002 0.0 0.0 0.0 0.0 126-127 1.475 0.0 0.0 0.0 0.0 128-129 1.5875 0.0 0.0 0.0 0.0 130-131 1.75 0.0 0.0 0.0 0.0 132-133 1.9 0.0 0.0 0.0 0.0 134-135 2.0875 0.0 0.0 0.0 0.0 136-137 2.275 0.0 0.0 0.0 0.0 138-139 2.5250000000000004 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCACGA 10 0.006830828 145.0 5 GGCATTC 10 0.006830828 145.0 1 TTTCTAA 10 0.006830828 145.0 4 CATCCAT 10 0.006830828 145.0 5 CCATGAA 10 0.006830828 145.0 3 CACGACG 10 0.006830828 145.0 7 CATTCAC 10 0.006830828 145.0 3 TCTAATC 10 0.006830828 145.0 6 TCACGAC 10 0.006830828 145.0 6 ATAGTAA 10 0.006830828 145.0 145 CTAATCG 10 0.006830828 145.0 7 TAATCGA 10 0.006830828 145.0 8 TTCTAAT 10 0.006830828 145.0 5 CGACGAA 10 0.006830828 145.0 9 ACGACGA 10 0.006830828 145.0 8 AATCGAC 10 0.006830828 145.0 9 ATTCACG 10 0.006830828 145.0 4 >>END_MODULE SRR12671368 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671368_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.249 37.0 37.0 37.0 37.0 37.0 2 35.987 37.0 37.0 37.0 37.0 37.0 3 36.0475 37.0 37.0 37.0 37.0 37.0 4 36.2295 37.0 37.0 37.0 37.0 37.0 5 36.296 37.0 37.0 37.0 37.0 37.0 6 36.083 37.0 37.0 37.0 37.0 37.0 7 36.0985 37.0 37.0 37.0 37.0 37.0 8 36.2235 37.0 37.0 37.0 37.0 37.0 9 36.1245 37.0 37.0 37.0 37.0 37.0 10-14 36.152 37.0 37.0 37.0 37.0 37.0 15-19 36.1576 37.0 37.0 37.0 37.0 37.0 20-24 36.085300000000004 37.0 37.0 37.0 37.0 37.0 25-29 36.0824 37.0 37.0 37.0 37.0 37.0 30-34 36.028800000000004 37.0 37.0 37.0 37.0 37.0 35-39 35.9663 37.0 37.0 37.0 37.0 37.0 40-44 36.016600000000004 37.0 37.0 37.0 37.0 37.0 45-49 35.961400000000005 37.0 37.0 37.0 37.0 37.0 50-54 35.9294 37.0 37.0 37.0 37.0 37.0 55-59 35.9196 37.0 37.0 37.0 37.0 37.0 60-64 35.8462 37.0 37.0 37.0 37.0 37.0 65-69 35.8728 37.0 37.0 37.0 37.0 37.0 70-74 35.84930000000001 37.0 37.0 37.0 37.0 37.0 75-79 35.8223 37.0 37.0 37.0 37.0 37.0 80-84 35.798700000000004 37.0 37.0 37.0 37.0 37.0 85-89 35.7863 37.0 37.0 37.0 37.0 37.0 90-94 35.8026 37.0 37.0 37.0 37.0 37.0 95-99 35.7223 37.0 37.0 37.0 37.0 37.0 100-104 35.6909 37.0 37.0 37.0 37.0 37.0 105-109 35.6049 37.0 37.0 37.0 37.0 37.0 110-114 35.643299999999996 37.0 37.0 37.0 37.0 37.0 115-119 35.611900000000006 37.0 37.0 37.0 37.0 37.0 120-124 35.6126 37.0 37.0 37.0 37.0 37.0 125-129 35.5156 37.0 37.0 37.0 37.0 37.0 130-134 35.5033 37.0 37.0 37.0 37.0 37.0 135-139 35.4593 37.0 37.0 37.0 34.6 37.0 140-144 35.46220000000001 37.0 37.0 37.0 37.0 37.0 145-149 35.489999999999995 37.0 37.0 37.0 37.0 37.0 150-151 35.198499999999996 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 5.0 13 2.0 14 5.0 15 1.0 16 1.0 17 1.0 18 1.0 19 1.0 20 3.0 21 3.0 22 5.0 23 7.0 24 3.0 25 10.0 26 13.0 27 9.0 28 25.0 29 19.0 30 38.0 31 31.0 32 71.0 33 100.0 34 194.0 35 523.0 36 2672.0 37 257.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 48.325 23.875 5.125 22.675 2 23.95 25.95 36.1 14.000000000000002 3 21.4 27.450000000000003 32.25 18.9 4 23.825 35.199999999999996 21.725 19.25 5 23.875 38.15 21.625 16.35 6 19.3 40.0 22.425 18.275 7 20.150000000000002 21.625 39.875 18.35 8 18.725 25.650000000000002 30.575000000000003 25.05 9 21.349999999999998 23.325000000000003 30.625000000000004 24.7 10-14 22.84 29.275000000000002 26.505000000000003 21.38 15-19 23.21 28.439999999999998 27.395000000000003 20.955 20-24 22.89 28.720000000000002 27.284999999999997 21.105 25-29 22.395 27.834999999999997 29.294999999999998 20.474999999999998 30-34 22.495 28.725 28.175 20.605 35-39 23.345 27.775 28.475 20.405 40-44 23.235 27.985 27.6 21.18 45-49 21.42 28.455000000000002 28.994999999999997 21.13 50-54 22.91 28.185 27.805000000000003 21.099999999999998 55-59 22.455 27.77 28.244999999999997 21.529999999999998 60-64 23.13 26.590000000000003 28.58 21.7 65-69 23.68 27.47 28.144999999999996 20.705000000000002 70-74 22.445 28.110000000000003 28.000000000000004 21.445 75-79 23.015 28.09 27.915 20.979999999999997 80-84 23.335 27.57 27.805000000000003 21.29 85-89 23.1 27.315 28.565 21.02 90-94 23.494999999999997 27.55 28.360000000000003 20.595 95-99 23.494999999999997 27.544999999999998 28.115000000000002 20.845 100-104 22.98 28.470000000000002 27.92 20.630000000000003 105-109 23.875 27.700000000000003 27.950000000000003 20.474999999999998 110-114 22.955000000000002 27.61 28.499999999999996 20.935000000000002 115-119 23.65 27.985 28.255000000000003 20.11 120-124 23.474999999999998 28.194999999999997 27.810000000000002 20.52 125-129 24.095 27.589999999999996 27.93 20.385 130-134 23.599999999999998 28.51 27.439999999999998 20.45 135-139 23.785 27.79 27.235 21.19 140-144 23.98 28.015 27.589999999999996 20.415 145-149 23.957395739573958 28.452845284528454 27.602760276027606 19.986998699869986 150-151 23.674999999999997 28.212500000000002 27.85 20.2625 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 2.0 1 1.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.5 12 0.5 13 0.0 14 0.5 15 1.0 16 0.5 17 0.5 18 1.0 19 1.0 20 1.0 21 3.0 22 2.5 23 1.5 24 3.0 25 4.5 26 7.5 27 11.0 28 11.0 29 13.0 30 18.5 31 20.0 32 32.5 33 40.5 34 42.0 35 67.5 36 87.0 37 107.5 38 137.0 39 171.5 40 218.0 41 246.0 42 267.0 43 268.0 44 255.5 45 259.5 46 253.0 47 225.5 48 213.5 49 205.0 50 172.0 51 142.0 52 111.5 53 74.0 54 59.0 55 54.0 56 45.0 57 35.5 58 27.0 59 21.0 60 11.5 61 8.0 62 7.0 63 4.0 64 4.0 65 3.5 66 2.5 67 2.0 68 1.5 69 2.0 70 0.5 71 1.0 72 1.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.5 79 1.0 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.5 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.5 97 0.5 98 0.0 99 0.0 100 2.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.01 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 82.675 #Duplication Level Percentage of deduplicated Percentage of total 1 83.55004535833082 69.075 2 13.093438161475657 21.65 3 2.509827638342909 6.225 4 0.6350166313879648 2.1 5 0.12095554883580284 0.5 6 0.09071666162685213 0.44999999999999996 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ACTCTGCATTTGCTAGCTAGAAGTCACTCTACCCTTCGCATTACTTCCTC 6 0.15 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 6 0.15 No Hit GGATATTGCAAATATGGGTGTGATGTACCTGTGCAACTTTGTTGGTGGCA 6 0.15 No Hit GTATATGGTTTTCTCTTTTGCAACATTTGCACTGGTGGAACCTTTTGGAT 5 0.125 No Hit GGGATGTGTAGTCTCTGTGAAATTTTGGAGCATGCAGTTGCTGTATGCTG 5 0.125 No Hit GTCAACGGAACAGTTGCCCATGAATTCATTGTGGACTTGAGAGGCGTTAA 5 0.125 No Hit AGAACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.2 0.0 0.0 0.0 0.0 96-97 0.2 0.0 0.0 0.0 0.0 98-99 0.2375 0.0 0.0 0.0 0.0 100-101 0.2625 0.0 0.0 0.0 0.0 102-103 0.2875 0.0 0.0 0.0 0.0 104-105 0.4125 0.0 0.0 0.0 0.0 106-107 0.4625 0.0 0.0 0.0 0.0 108-109 0.55 0.0 0.0 0.0 0.0 110-111 0.6375 0.0 0.0 0.0 0.0 112-113 0.7625 0.0 0.0 0.0 0.0 114-115 0.8374999999999999 0.0 0.0 0.0 0.0 116-117 0.925 0.0 0.0 0.0 0.0 118-119 1.0 0.0 0.0 0.0 0.0 120-121 1.1125 0.0 0.0 0.0 0.0 122-123 1.1875 0.0 0.0 0.0 0.0 124-125 1.2999999999999998 0.0 0.0 0.0 0.0 126-127 1.4500000000000002 0.0 0.0 0.0 0.0 128-129 1.5625 0.0 0.0 0.0 0.0 130-131 1.7375 0.0 0.0 0.0 0.0 132-133 1.9 0.0 0.0 0.0 0.0 134-135 2.0875 0.0 0.0 0.0 0.0 136-137 2.275 0.0 0.0 0.0 0.0 138-139 2.5250000000000004 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AACTTCA 10 0.006830828 145.0 4 GTTATCG 10 0.006830828 145.0 7 GTAGTTA 10 0.006830828 145.0 4 AGTTATC 10 0.006830828 145.0 6 >>END_MODULE Read 1084524 spots for SRR12671368.sra Written 1084524 spots for SRR12671368.sra Read 1084524 spots for SRR12671368.sra Written 1084524 spots for SRR12671368.sra Read 1084524 spots for SRR12671368.sra Written 1084524 spots for SRR12671368.sra Read 1084524 spots for SRR12671368.sra Written 1084524 spots for SRR12671368.sra Read 1084524 spots for SRR12671368.sra Written 1084524 spots for SRR12671368.sra Read 1084524 spots for SRR12671368.sra Written 1084524 spots for SRR12671368.sra Read 1084524 spots for SRR12671368.sra Written 1084524 spots for SRR12671368.sra Read 1084524 spots for SRR12671368.sra Written 1084524 spots for SRR12671368.sra Read 1084524 spots for SRR12671368.sra Written 1084524 spots for SRR12671368.sra Read 1084524 spots for SRR12671368.sra Written 1084524 spots for SRR12671368.sra Read 1084528 spots for SRR12671368.sra Written 1084528 spots for SRR12671368.sra Read 1084524 spots for SRR12671368.sra Written 1084524 spots for SRR12671368.sra Read 1084524 spots for SRR12671368.sra Written 1084524 spots for SRR12671368.sra Read 1084524 spots for SRR12671368.sra Written 1084524 spots for SRR12671368.sra Read 1084524 spots for SRR12671368.sra Written 1084524 spots for SRR12671368.sra Read 1084524 spots for SRR12671368.sra Written 1084524 spots for SRR12671368.sra Read 1084524 spots for SRR12671368.sra Written 1084524 spots for SRR12671368.sra Read 1084524 spots for SRR12671368.sra Written 1084524 spots for SRR12671368.sra Read 1084524 spots for SRR12671368.sra Written 1084524 spots for SRR12671368.sra Read 1084524 spots for SRR12671368.sra Written 1084524 spots for SRR12671368.sra SRR ids: ['SRR12671368.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_gnx59j5j SRR12671368.sra spots: 21690484 blocks: [[1, 1084524], [1084525, 2169048], [2169049, 3253572], [3253573, 4338096], [4338097, 5422620], [5422621, 6507144], [6507145, 7591668], [7591669, 8676192], [8676193, 9760716], [9760717, 10845240], [10845241, 11929764], [11929765, 13014288], [13014289, 14098812], [14098813, 15183336], [15183337, 16267860], [16267861, 17352384], [17352385, 18436908], [18436909, 19521432], [19521433, 20605956], [20605957, 21690484]] SRR12671368 file size 7349675 SRR12671368 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671368 SRR12671368_1.fastq SRR12671368_2.fastq Input file: SRR12671368_1.fastq Paired file: SRR12671368_2.fastq trimmed: SRR12671368-trimmed-pair1.fastq, SRR12671368-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 20:21:36 2025 >> started Tue Feb 11 20:22:16 2025 >> done (40.069s) 21690484 read pairs processed; of these: 297 ( 0.00%) short read pairs filtered out after trimming by size control 1341 ( 0.01%) empty read pairs filtered out after trimming by size control 21688846 (99.99%) read pairs available; of these: 886421 ( 4.09%) trimmed read pairs available after processing 20802425 (95.91%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 33 0.00% 19 32 0.00% 20 29 0.00% 21 37 0.00% 22 19 0.00% 23 42 0.00% 24 41 0.00% 25 38 0.00% 26 39 0.00% 27 54 0.00% 28 67 0.00% 29 53 0.00% 30 60 0.00% 31 64 0.00% 32 48 0.00% 33 50 0.00% 34 49 0.00% 35 41 0.00% 36 42 0.00% 37 58 0.00% 38 54 0.00% 39 57 0.00% 40 49 0.00% 41 59 0.00% 42 57 0.00% 43 61 0.00% 44 44 0.00% 45 65 0.00% 46 59 0.00% 47 66 0.00% 48 68 0.00% 49 82 0.00% 50 84 0.00% 51 109 0.00% 52 82 0.00% 53 92 0.00% 54 116 0.00% 55 131 0.00% 56 130 0.00% 57 152 0.00% 58 163 0.00% 59 167 0.00% 60 167 0.00% 61 250 0.00% 62 239 0.00% 63 328 0.00% 64 304 0.00% 65 328 0.00% 66 388 0.00% 67 404 0.00% 68 418 0.00% 69 543 0.00% 70 585 0.00% 71 666 0.00% 72 759 0.00% 73 845 0.00% 74 916 0.00% 75 1019 0.00% 76 1115 0.01% 77 1234 0.01% 78 1369 0.01% 79 1509 0.01% 80 1712 0.01% 81 1812 0.01% 82 2071 0.01% 83 2073 0.01% 84 2482 0.01% 85 2527 0.01% 86 2802 0.01% 87 3079 0.01% 88 3217 0.01% 89 3362 0.02% 90 3449 0.02% 91 3712 0.02% 92 4069 0.02% 93 4244 0.02% 94 4484 0.02% 95 4998 0.02% 96 5223 0.02% 97 5515 0.03% 98 5463 0.03% 99 6043 0.03% 100 6255 0.03% 101 6654 0.03% 102 6730 0.03% 103 6978 0.03% 104 7439 0.03% 105 7628 0.04% 106 8135 0.04% 107 8153 0.04% 108 8494 0.04% 109 8828 0.04% 110 9133 0.04% 111 9359 0.04% 112 9886 0.05% 113 10013 0.05% 114 10542 0.05% 115 10546 0.05% 116 11426 0.05% 117 11747 0.05% 118 11963 0.06% 119 12250 0.06% 120 12851 0.06% 121 13530 0.06% 122 13454 0.06% 123 14127 0.07% 124 14546 0.07% 125 14952 0.07% 126 15615 0.07% 127 15865 0.07% 128 16061 0.07% 129 16749 0.08% 130 16996 0.08% 131 17446 0.08% 132 18084 0.08% 133 18592 0.09% 134 18722 0.09% 135 19553 0.09% 136 19764 0.09% 137 20346 0.09% 138 20848 0.10% 139 21710 0.10% 140 22365 0.10% 141 22673 0.10% 142 23415 0.11% 143 23809 0.11% 144 24287 0.11% 145 24856 0.11% 146 25558 0.12% 147 25837 0.12% 148 27295 0.13% 149 27126 0.13% 150 28664 0.13% 151 20802425 95.91% 21688846 reads passed initial QC criterion=sequence-density sequence-density=0.50 sequence-density-rank=1 fanout-score=1.96 fanout-score-rank=32 prefix-density=0.51 prefix-fanout=1.9 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTTCGAGCGAAGAAGGTAATCAATTTCCTTGGCCAATTCCTCCTCTGTGAGATCTGGAAGGTAAGAAAGAGTCTCGAACTTCTTCAATCCAGTTGGTGGCCACACCTGCATGCATTGAACTCGTCCACCATTGCTTGCAATGGAAGTAATGTCATTAGCCTTTCTGGTACTGACTGGGAAAGCTGCGGCAGACTTGAGACCATTGAATGGTGCCACCAT criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=27.92 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=4.2 sequence=TCAAATATATCGGTGACATCTAAGTTCAATGGGTGGTTTTTGTACATAGCAACAGCACTCTATGAGAAATCATAACGATCAGAGACATTACAAGTTCTAGTGATGATACAAAGGTTGCATCGACAAATACAAATATTTCAAGCTCCTTCCTTGATTAGGCAAGCATGTTCACCAGTGTTCCTCACTTGGGGGTGAAAGCAGAAAAAACGGTGGCATGACCAGGATCTGCAAGGTGAGCAAAGAGGTTGTCGATAGGACCAGTGCCAGTGTAAATGTGTTGGAACCAAGCACCCATGACAGCCAACATAGCCAA criterion=sequence-density sequence-density=0.60 sequence-density-rank=1 fanout-score=2.20 fanout-score-rank=25 prefix-density=0.62 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=35.23 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=5.9 sequence=AAACAAGAGCGCGGTGGATAGGAGGAGAGCATAACCATGTTAGTCACATATATTTCCAAGATGAAGGCCTTTCTTATCGCATGCATTCTCTTAGCTACCATCGTCTTCTCTCCCCT SRR12671368 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 20:23:10 Started mapping on | Feb 11 20:23:10 Finished on | Feb 11 20:29:55 Mapping speed, Million of reads per hour | 192.79 Number of input reads | 21688846 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 19909134 Uniquely mapped reads % | 91.79% Average mapped length | 298.17 Number of splices: Total | 20018055 Number of splices: Annotated (sjdb) | 19578992 Number of splices: GT/AG | 19615991 Number of splices: GC/AG | 333252 Number of splices: AT/AC | 12383 Number of splices: Non-canonical | 56429 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.92 Insertion rate per base | 0.03% Insertion average length | 2.22 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 496030 % of reads mapped to multiple loci | 2.29% Number of reads mapped to too many loci | 54933 % of reads mapped to too many loci | 0.25% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.56% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1283682 1283682 1283682 N_multimapping 496030 496030 496030 N_noFeature 727346 19630917 818609 N_ambiguous 324281 1084 136821 UnstrandedReadsAssigned:18857507 PositiveStrandReadsAssigned:277133 NegativeStrandReadsAssigned:18953704 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671368 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671368-trimmed-pair1.fastq SRR12671368-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,688,846 reads, 18,981,173 reads pseudoaligned [quant] estimated average fragment length: 308.7 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,051 rounds 52401 SRR12671368.ke.tsv 34699 SRR12671368.se.tsv 87100 total ==> SRR12671368.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1710.3 697 20.3657 Potri.005G024800.1.v4.1 1035 727.3 272 18.6893 Potri.004G059700.1.v4.1 961 653.747 7 0.53509 Potri.007G009000.2.v4.1 1416 1108.3 0 0 Potri.003G141000.2.v4.1 2943 2635.3 1118 21.2007 Potri.016G087400.1.v4.1 270 70.3698 672.931 477.884 Potri.015G069301.1.v4.1 564 282.747 0 0 Potri.010G195200.1.v4.1 1773 1465.3 66 2.2509 Potri.012G127500.1.v4.1 977 669.521 123 9.18078 ==> SRR12671368.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 394 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 248 Potri.001G212900.v4.1 55 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 3 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR12671368 completed mapping pipeline successfully