Starting /dee2/code/volunteer_pipeline.sh SRR12671369 current disk space = 3052903129088 free memory = 1479366420 SRR12671369 SRAfilesize b692c1f65c6ff4b1ef9a8d91144c8b9f SRR12671369.sra SRR12671369.sra file validated SRR12671369 is paired end SRR12671369 is conventional basespace SRR12671369 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671369_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.427 37.0 37.0 37.0 37.0 37.0 2 36.34275 37.0 37.0 37.0 37.0 37.0 3 36.5765 37.0 37.0 37.0 37.0 37.0 4 36.6555 37.0 37.0 37.0 37.0 37.0 5 36.639 37.0 37.0 37.0 37.0 37.0 6 36.605 37.0 37.0 37.0 37.0 37.0 7 36.4655 37.0 37.0 37.0 37.0 37.0 8 36.61 37.0 37.0 37.0 37.0 37.0 9 36.638 37.0 37.0 37.0 37.0 37.0 10-14 36.60359999999999 37.0 37.0 37.0 37.0 37.0 15-19 36.594100000000005 37.0 37.0 37.0 37.0 37.0 20-24 36.613800000000005 37.0 37.0 37.0 37.0 37.0 25-29 36.5809 37.0 37.0 37.0 37.0 37.0 30-34 36.5515 37.0 37.0 37.0 37.0 37.0 35-39 36.5366 37.0 37.0 37.0 37.0 37.0 40-44 36.547000000000004 37.0 37.0 37.0 37.0 37.0 45-49 36.5356 37.0 37.0 37.0 37.0 37.0 50-54 36.47869999999999 37.0 37.0 37.0 37.0 37.0 55-59 36.4423 37.0 37.0 37.0 37.0 37.0 60-64 36.4437 37.0 37.0 37.0 37.0 37.0 65-69 36.4539 37.0 37.0 37.0 37.0 37.0 70-74 36.3879 37.0 37.0 37.0 37.0 37.0 75-79 36.370799999999996 37.0 37.0 37.0 37.0 37.0 80-84 36.326800000000006 37.0 37.0 37.0 37.0 37.0 85-89 36.3343 37.0 37.0 37.0 37.0 37.0 90-94 36.3143 37.0 37.0 37.0 37.0 37.0 95-99 36.3023 37.0 37.0 37.0 37.0 37.0 100-104 36.2817 37.0 37.0 37.0 37.0 37.0 105-109 36.282799999999995 37.0 37.0 37.0 37.0 37.0 110-114 36.1722 37.0 37.0 37.0 37.0 37.0 115-119 36.263400000000004 37.0 37.0 37.0 37.0 37.0 120-124 36.1832 37.0 37.0 37.0 37.0 37.0 125-129 36.1716 37.0 37.0 37.0 37.0 37.0 130-134 36.14659999999999 37.0 37.0 37.0 37.0 37.0 135-139 36.0936 37.0 37.0 37.0 37.0 37.0 140-144 36.029700000000005 37.0 37.0 37.0 37.0 37.0 145-149 36.012800000000006 37.0 37.0 37.0 37.0 37.0 150-151 35.9245 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 1.0 23 1.0 24 0.0 25 1.0 26 2.0 27 6.0 28 7.0 29 19.0 30 15.0 31 20.0 32 38.0 33 64.0 34 100.0 35 279.0 36 3033.0 37 413.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.574999999999996 10.6 4.5 52.325 2 15.359559007767476 12.47807567025808 42.871460786770236 29.29090453520421 3 17.075000000000003 16.925 26.5 39.5 4 22.975 25.374999999999996 23.150000000000002 28.499999999999996 5 22.95 32.1 25.3 19.650000000000002 6 19.400000000000002 34.75 25.525 20.325 7 13.575000000000001 26.025 42.55 17.849999999999998 8 15.0 23.45 36.35 25.2 9 16.025 21.65 38.125 24.2 10-14 18.834999999999997 30.12 28.15 22.895 15-19 19.355 27.855 27.825 24.965 20-24 19.375 28.055000000000003 28.494999999999997 24.075 25-29 18.88 29.304999999999996 28.110000000000003 23.705000000000002 30-34 19.29 28.134999999999998 28.185 24.39 35-39 19.98 27.450000000000003 28.005000000000003 24.565 40-44 19.48 29.15 27.310000000000002 24.060000000000002 45-49 19.845 28.945 27.325 23.885 50-54 19.725 28.82 27.66 23.794999999999998 55-59 19.3 28.02 28.299999999999997 24.38 60-64 20.275000000000002 29.054999999999996 27.255000000000003 23.415 65-69 19.0 29.659999999999997 27.82 23.52 70-74 19.885 28.4 27.384999999999998 24.33 75-79 19.42 28.435 28.17 23.974999999999998 80-84 19.99 27.725 28.77 23.515 85-89 19.345000000000002 28.249999999999996 27.955000000000002 24.45 90-94 19.355 28.365000000000002 27.61 24.67 95-99 20.73 28.035 27.825 23.41 100-104 19.86 28.754999999999995 27.68 23.705000000000002 105-109 20.43 27.18 28.110000000000003 24.279999999999998 110-114 19.96 28.08 27.725 24.235 115-119 20.28 28.134999999999998 28.335 23.25 120-124 19.98 28.17 27.339999999999996 24.51 125-129 20.315 28.449999999999996 27.560000000000002 23.674999999999997 130-134 20.9 27.894999999999996 28.194999999999997 23.01 135-139 20.325 28.425 27.79 23.46 140-144 20.255000000000003 27.894999999999996 28.16 23.69 145-149 20.59 27.99 27.63 23.79 150-151 20.075000000000003 28.275 27.275 24.375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 0.5 23 1.5 24 4.5 25 4.5 26 5.0 27 9.5 28 13.5 29 19.5 30 25.5 31 27.0 32 32.0 33 39.5 34 48.0 35 67.0 36 86.5 37 109.5 38 135.5 39 159.5 40 176.5 41 188.5 42 241.0 43 272.5 44 272.0 45 269.0 46 265.0 47 282.5 48 248.0 49 213.5 50 189.5 51 147.0 52 103.5 53 83.5 54 78.0 55 51.0 56 38.0 57 26.5 58 14.5 59 14.0 60 13.5 61 7.0 62 5.0 63 3.0 64 1.0 65 1.0 66 1.5 67 2.0 68 1.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.22499999999999998 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 83.675 #Duplication Level Percentage of deduplicated Percentage of total 1 84.04541380340603 70.325 2 13.056468479235136 21.85 3 2.5097101882282637 6.3 4 0.268897520167314 0.8999999999999999 5 0.05975500448162533 0.25 6 0.029877502240812665 0.15 7 0.0 0.0 8 0.0 0.0 9 0.029877502240812665 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAAC 9 0.22499999999999998 No Hit CTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCG 6 0.15 No Hit GTGCGTTTAATAATCCCTTCCAAGTTGTCCAAGGAGGAAGCCTCTCATTC 5 0.125 No Hit CTTGGATGATCTTCCCTGCACAATGATCTTCCGCAGATAGTCTCTCTCTG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.07500000000000001 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.1375 0.0 0.0 0.0 0.0 98-99 0.175 0.0 0.0 0.0 0.0 100-101 0.21250000000000002 0.0 0.0 0.0 0.0 102-103 0.2875 0.0 0.0 0.0 0.0 104-105 0.3375 0.0 0.0 0.0 0.0 106-107 0.35 0.0 0.0 0.0 0.0 108-109 0.4 0.0 0.0 0.0 0.0 110-111 0.4625 0.0 0.0 0.0 0.0 112-113 0.475 0.0 0.0 0.0 0.0 114-115 0.525 0.0 0.0 0.0 0.0 116-117 0.6375 0.0 0.0 0.0 0.0 118-119 0.6625000000000001 0.0 0.0 0.0 0.0 120-121 0.7250000000000001 0.0 0.0 0.0 0.0 122-123 0.825 0.0 0.0 0.0 0.0 124-125 1.0 0.0 0.0 0.0 0.0 126-127 1.1375000000000002 0.0 0.0 0.0 0.0 128-129 1.4125 0.0 0.0 0.0 0.0 130-131 1.5375 0.0 0.0 0.0 0.0 132-133 1.8624999999999998 0.0 0.0 0.0 0.0 134-135 1.9874999999999998 0.0 0.0 0.0 0.0 136-137 2.0999999999999996 0.0 0.0 0.0 0.0 138-139 2.2375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12671369 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671369_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.33 37.0 37.0 37.0 37.0 37.0 2 35.9695 37.0 37.0 37.0 37.0 37.0 3 36.205 37.0 37.0 37.0 37.0 37.0 4 36.204 37.0 37.0 37.0 37.0 37.0 5 36.2245 37.0 37.0 37.0 37.0 37.0 6 36.1595 37.0 37.0 37.0 37.0 37.0 7 36.2535 37.0 37.0 37.0 37.0 37.0 8 36.2795 37.0 37.0 37.0 37.0 37.0 9 36.2335 37.0 37.0 37.0 37.0 37.0 10-14 36.2361 37.0 37.0 37.0 37.0 37.0 15-19 36.2996 37.0 37.0 37.0 37.0 37.0 20-24 36.262299999999996 37.0 37.0 37.0 37.0 37.0 25-29 36.1575 37.0 37.0 37.0 37.0 37.0 30-34 36.1125 37.0 37.0 37.0 37.0 37.0 35-39 36.1476 37.0 37.0 37.0 37.0 37.0 40-44 36.1012 37.0 37.0 37.0 37.0 37.0 45-49 36.0805 37.0 37.0 37.0 37.0 37.0 50-54 36.0595 37.0 37.0 37.0 37.0 37.0 55-59 36.0644 37.0 37.0 37.0 37.0 37.0 60-64 35.980500000000006 37.0 37.0 37.0 37.0 37.0 65-69 36.036 37.0 37.0 37.0 37.0 37.0 70-74 35.8977 37.0 37.0 37.0 37.0 37.0 75-79 35.959199999999996 37.0 37.0 37.0 37.0 37.0 80-84 35.863 37.0 37.0 37.0 37.0 37.0 85-89 35.8965 37.0 37.0 37.0 37.0 37.0 90-94 35.837199999999996 37.0 37.0 37.0 37.0 37.0 95-99 35.799699999999994 37.0 37.0 37.0 37.0 37.0 100-104 35.836400000000005 37.0 37.0 37.0 37.0 37.0 105-109 35.7187 37.0 37.0 37.0 37.0 37.0 110-114 35.7493 37.0 37.0 37.0 37.0 37.0 115-119 35.81700000000001 37.0 37.0 37.0 37.0 37.0 120-124 35.6899 37.0 37.0 37.0 37.0 37.0 125-129 35.7193 37.0 37.0 37.0 37.0 37.0 130-134 35.60509999999999 37.0 37.0 37.0 37.0 37.0 135-139 35.502500000000005 37.0 37.0 37.0 37.0 37.0 140-144 35.584 37.0 37.0 37.0 37.0 37.0 145-149 35.495799999999996 37.0 37.0 37.0 37.0 37.0 150-151 35.348 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 0.0 16 1.0 17 0.0 18 0.0 19 1.0 20 0.0 21 3.0 22 3.0 23 5.0 24 4.0 25 6.0 26 7.0 27 12.0 28 16.0 29 18.0 30 27.0 31 41.0 32 78.0 33 109.0 34 196.0 35 575.0 36 2663.0 37 234.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 33.25 23.225 8.85 34.675 2 22.575 27.150000000000002 36.975 13.3 3 19.625 27.750000000000004 33.074999999999996 19.55 4 21.85 33.95 25.45 18.75 5 25.124999999999996 38.45 20.825 15.6 6 17.599999999999998 41.699999999999996 23.175 17.525 7 18.725 22.425 41.05 17.8 8 17.625 23.3 32.75 26.325 9 21.275 22.825 31.974999999999998 23.925 10-14 22.425 29.65 27.150000000000002 20.775 15-19 22.405 28.52 28.134999999999998 20.94 20-24 22.15 28.685 28.415000000000003 20.75 25-29 21.94 28.09 28.825 21.145 30-34 22.195 28.59 28.410000000000004 20.805 35-39 22.175 27.875 28.439999999999998 21.51 40-44 22.634999999999998 28.57 28.22 20.575 45-49 22.16 28.815 28.194999999999997 20.830000000000002 50-54 22.205 27.88 28.689999999999998 21.224999999999998 55-59 21.834999999999997 28.465 27.860000000000003 21.84 60-64 22.515 27.744999999999997 28.375 21.365000000000002 65-69 22.775000000000002 28.244999999999997 28.355000000000004 20.625 70-74 22.67 28.62 27.435 21.275 75-79 22.545 27.98 27.884999999999998 21.59 80-84 22.605 28.34 28.09 20.965 85-89 23.32 28.04 27.63 21.01 90-94 23.155 28.58 27.389999999999997 20.875 95-99 23.27 28.26 28.055000000000003 20.415 100-104 22.525000000000002 28.205000000000002 28.055000000000003 21.215 105-109 23.84 28.105000000000004 27.49 20.565 110-114 23.68 27.66 27.794999999999998 20.865000000000002 115-119 23.87 28.395 27.445000000000004 20.29 120-124 23.365 28.465 27.794999999999998 20.375 125-129 24.03 27.345000000000002 28.144999999999996 20.48 130-134 24.005000000000003 26.965 28.71 20.32 135-139 23.715 27.700000000000003 27.665 20.919999999999998 140-144 23.825 27.46 27.994999999999997 20.72 145-149 24.70747074707471 28.30783078307831 26.857685768576857 20.12701270127013 150-151 24.087500000000002 28.7 27.187499999999996 20.025000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 1.0 3 1.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 1.0 15 0.5 16 0.5 17 0.0 18 1.0 19 1.5 20 0.5 21 0.5 22 3.0 23 3.0 24 5.0 25 6.0 26 4.0 27 5.0 28 11.5 29 15.5 30 17.5 31 26.5 32 33.5 33 44.5 34 62.0 35 83.0 36 104.0 37 117.0 38 147.0 39 174.0 40 202.5 41 244.5 42 261.0 43 283.0 44 291.5 45 260.5 46 253.5 47 260.5 48 207.0 49 163.5 50 170.5 51 135.5 52 90.5 53 79.5 54 61.5 55 37.5 56 30.5 57 25.5 58 17.5 59 18.0 60 15.5 61 8.0 62 2.5 63 0.5 64 0.0 65 1.0 66 1.0 67 0.0 68 0.5 69 1.5 70 1.0 71 0.0 72 0.0 73 1.0 74 1.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 1.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.01 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 84.05 #Duplication Level Percentage of deduplicated Percentage of total 1 84.83045806067817 71.3 2 12.254610350981558 20.599999999999998 3 2.379535990481856 6.0 4 0.297441998810232 1.0 5 0.1784651992861392 0.75 6 0.0297441998810232 0.15 7 0.0 0.0 8 0.0297441998810232 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCA 8 0.2 No Hit CAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTA 6 0.15 No Hit CACGAACATGGCTGCAACGACTGCTGTTGCCGCGTCCTATTTTTCGGGGA 5 0.125 No Hit CACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATC 5 0.125 No Hit GTTGTCAAAGATTCACTCTTGCAACATGTCCGTGTTTTGAGTCCACTCTT 5 0.125 No Hit CGCACATCTTCCTTCTTTCTATATTTACTGTTTTTGTTTCCTTCTTTCAT 5 0.125 No Hit GTCGATGATGAGAGAGTTTCATTATTACATTCAGCTTGGAGTGCCTTACT 5 0.125 No Hit AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.16249999999999998 0.0 0.0 0.0 0.0 98-99 0.2 0.0 0.0 0.0 0.0 100-101 0.2375 0.0 0.0 0.0 0.0 102-103 0.3125 0.0 0.0 0.0 0.0 104-105 0.3625 0.0 0.0 0.0 0.0 106-107 0.375 0.0 0.0 0.0 0.0 108-109 0.425 0.0 0.0 0.0 0.0 110-111 0.4875 0.0 0.0 0.0 0.0 112-113 0.5 0.0 0.0 0.0 0.0 114-115 0.55 0.0 0.0 0.0 0.0 116-117 0.6625000000000001 0.0 0.0 0.0 0.0 118-119 0.6875 0.0 0.0 0.0 0.0 120-121 0.75 0.0 0.0 0.0 0.0 122-123 0.85 0.0 0.0 0.0 0.0 124-125 1.0375 0.0 0.0 0.0 0.0 126-127 1.1749999999999998 0.0 0.0 0.0 0.0 128-129 1.4375 0.0 0.0 0.0 0.0 130-131 1.5625 0.0 0.0 0.0 0.0 132-133 1.8875000000000002 0.0 0.0 0.0 0.0 134-135 2.0125 0.0 0.0 0.0 0.0 136-137 2.1125 0.0 0.0 0.0 0.0 138-139 2.2375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AATGTCG 10 0.006830828 145.0 7 >>END_MODULE Read 776928 spots for SRR12671369.sra Written 776928 spots for SRR12671369.sra Read 776928 spots for SRR12671369.sra Written 776928 spots for SRR12671369.sra Read 776928 spots for SRR12671369.sra Written 776928 spots for SRR12671369.sra Read 776928 spots for SRR12671369.sra Written 776928 spots for SRR12671369.sra Read 776928 spots for SRR12671369.sra Written 776928 spots for SRR12671369.sra Read 776928 spots for SRR12671369.sra Written 776928 spots for SRR12671369.sra Read 776928 spots for SRR12671369.sra Written 776928 spots for SRR12671369.sra Read 776928 spots for SRR12671369.sra Written 776928 spots for SRR12671369.sra Read 776928 spots for SRR12671369.sra Written 776928 spots for SRR12671369.sra Read 776928 spots for SRR12671369.sra Written 776928 spots for SRR12671369.sra Read 776928 spots for SRR12671369.sra Written 776928 spots for SRR12671369.sra Read 776928 spots for SRR12671369.sra Written 776928 spots for SRR12671369.sra Read 776928 spots for SRR12671369.sra Written 776928 spots for SRR12671369.sra Read 776928 spots for SRR12671369.sra Written 776928 spots for SRR12671369.sra Read 776928 spots for SRR12671369.sra Written 776928 spots for SRR12671369.sra Read 776928 spots for SRR12671369.sra Written 776928 spots for SRR12671369.sra Read 776928 spots for SRR12671369.sra Written 776928 spots for SRR12671369.sra Read 776928 spots for SRR12671369.sra Written 776928 spots for SRR12671369.sra Read 776928 spots for SRR12671369.sra Written 776928 spots for SRR12671369.sra Read 776939 spots for SRR12671369.sra Written 776939 spots for SRR12671369.sra SRR ids: ['SRR12671369.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_63k6vfmj SRR12671369.sra spots: 15538571 blocks: [[1, 776928], [776929, 1553856], [1553857, 2330784], [2330785, 3107712], [3107713, 3884640], [3884641, 4661568], [4661569, 5438496], [5438497, 6215424], [6215425, 6992352], [6992353, 7769280], [7769281, 8546208], [8546209, 9323136], [9323137, 10100064], [10100065, 10876992], [10876993, 11653920], [11653921, 12430848], [12430849, 13207776], [13207777, 13984704], [13984705, 14761632], [14761633, 15538571]] SRR12671369 file size 5258985 SRR12671369 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671369 SRR12671369_1.fastq SRR12671369_2.fastq Input file: SRR12671369_1.fastq Paired file: SRR12671369_2.fastq trimmed: SRR12671369-trimmed-pair1.fastq, SRR12671369-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 20:41:34 2025 >> started Tue Feb 11 20:41:51 2025 >> done (16.856s) 15538571 read pairs processed; of these: 40 ( 0.00%) short read pairs filtered out after trimming by size control 218 ( 0.00%) empty read pairs filtered out after trimming by size control 15538313 (100.00%) read pairs available; of these: 410201 ( 2.64%) trimmed read pairs available after processing 15128112 (97.36%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 1 0.00% 20 4 0.00% 21 4 0.00% 22 1 0.00% 23 10 0.00% 24 5 0.00% 25 8 0.00% 26 6 0.00% 27 7 0.00% 28 7 0.00% 29 11 0.00% 30 8 0.00% 31 5 0.00% 32 10 0.00% 33 5 0.00% 34 2 0.00% 35 11 0.00% 36 14 0.00% 37 13 0.00% 38 10 0.00% 39 9 0.00% 40 22 0.00% 41 14 0.00% 42 23 0.00% 43 19 0.00% 44 17 0.00% 45 19 0.00% 46 21 0.00% 47 23 0.00% 48 26 0.00% 49 42 0.00% 50 34 0.00% 51 41 0.00% 52 50 0.00% 53 35 0.00% 54 50 0.00% 55 56 0.00% 56 47 0.00% 57 70 0.00% 58 79 0.00% 59 67 0.00% 60 77 0.00% 61 136 0.00% 62 134 0.00% 63 118 0.00% 64 148 0.00% 65 167 0.00% 66 171 0.00% 67 181 0.00% 68 197 0.00% 69 236 0.00% 70 283 0.00% 71 305 0.00% 72 316 0.00% 73 389 0.00% 74 411 0.00% 75 474 0.00% 76 539 0.00% 77 507 0.00% 78 560 0.00% 79 631 0.00% 80 758 0.00% 81 819 0.01% 82 890 0.01% 83 923 0.01% 84 1055 0.01% 85 1241 0.01% 86 1260 0.01% 87 1362 0.01% 88 1524 0.01% 89 1610 0.01% 90 1742 0.01% 91 1801 0.01% 92 1881 0.01% 93 1959 0.01% 94 2089 0.01% 95 2383 0.02% 96 2459 0.02% 97 2647 0.02% 98 2622 0.02% 99 2796 0.02% 100 2835 0.02% 101 3064 0.02% 102 3239 0.02% 103 3399 0.02% 104 3423 0.02% 105 3510 0.02% 106 3759 0.02% 107 4039 0.03% 108 4039 0.03% 109 4141 0.03% 110 4378 0.03% 111 4384 0.03% 112 4720 0.03% 113 4746 0.03% 114 4993 0.03% 115 5293 0.03% 116 5370 0.03% 117 5561 0.04% 118 5706 0.04% 119 5927 0.04% 120 5990 0.04% 121 6290 0.04% 122 6337 0.04% 123 6402 0.04% 124 6717 0.04% 125 6846 0.04% 126 7055 0.05% 127 7428 0.05% 128 7287 0.05% 129 7567 0.05% 130 7970 0.05% 131 8138 0.05% 132 8460 0.05% 133 8475 0.05% 134 8721 0.06% 135 8917 0.06% 136 9183 0.06% 137 9432 0.06% 138 9524 0.06% 139 9996 0.06% 140 10368 0.07% 141 10533 0.07% 142 10581 0.07% 143 10755 0.07% 144 11055 0.07% 145 11376 0.07% 146 11666 0.08% 147 11725 0.08% 148 12607 0.08% 149 12276 0.08% 150 13287 0.09% 151 15128112 97.36% 15538313 reads passed initial QC criterion=sequence-density sequence-density=0.36 sequence-density-rank=1 fanout-score=2.23 fanout-score-rank=28 prefix-density=0.37 prefix-fanout=2.1 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.12 sequence-density-rank=14 fanout-score=25.74 fanout-score-rank=1 prefix-density=0.41 prefix-fanout=7.8 sequence=CCATCTTCTTCATCTATAGATTTCAATCACAACAG criterion=sequence-density sequence-density=0.93 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=35 prefix-density=0.94 prefix-fanout=2.0 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGT criterion=fanout-score sequence-density=0.08 sequence-density-rank=30 fanout-score=83.82 fanout-score-rank=1 prefix-density=0.68 prefix-fanout=10.4 sequence=AAAAGAAAAGAAAA SRR12671369 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 20:42:35 Started mapping on | Feb 11 20:42:35 Finished on | Feb 11 20:44:12 Mapping speed, Million of reads per hour | 576.68 Number of input reads | 15538313 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 14699860 Uniquely mapped reads % | 94.60% Average mapped length | 299.28 Number of splices: Total | 15199219 Number of splices: Annotated (sjdb) | 14890839 Number of splices: GT/AG | 14902497 Number of splices: GC/AG | 246366 Number of splices: AT/AC | 9280 Number of splices: Non-canonical | 41076 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.88 Insertion rate per base | 0.02% Insertion average length | 2.25 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 392879 % of reads mapped to multiple loci | 2.53% Number of reads mapped to too many loci | 36848 % of reads mapped to too many loci | 0.24% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.50% % of reads unmapped: other | 0.13% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 445574 445574 445574 N_multimapping 392879 392879 392879 N_noFeature 522220 14477125 579007 N_ambiguous 264781 1020 98296 UnstrandedReadsAssigned:13912859 PositiveStrandReadsAssigned:221715 NegativeStrandReadsAssigned:14022557 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671369 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671369-trimmed-pair1.fastq SRR12671369-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,538,313 reads, 13,939,726 reads pseudoaligned [quant] estimated average fragment length: 338.429 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,028 rounds 52401 SRR12671369.ke.tsv 34699 SRR12671369.se.tsv 87100 total ==> SRR12671369.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1680.57 820 31.9122 Potri.005G024800.1.v4.1 1035 697.571 211 19.783 Potri.004G059700.1.v4.1 961 624.034 4 0.419229 Potri.007G009000.2.v4.1 1416 1078.57 0 0 Potri.003G141000.2.v4.1 2943 2605.57 899.06 22.5676 Potri.016G087400.1.v4.1 270 64.0379 591 603.6 Potri.015G069301.1.v4.1 564 257.156 0 0 Potri.010G195200.1.v4.1 1773 1435.57 39 1.7768 Potri.012G127500.1.v4.1 977 639.816 24 2.45333 ==> SRR12671369.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 158 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 196 Potri.001G212900.v4.1 8 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 8 SRR12671369 completed mapping pipeline successfully