Starting /dee2/code/volunteer_pipeline.sh SRR12671370 current disk space = 3053295054848 free memory = 1441806916 SRR12671370 SRAfilesize a25cfb58c28d99d8178e6f89cb27f1dd SRR12671370.sra SRR12671370.sra file validated SRR12671370 is paired end SRR12671370 is conventional basespace SRR12671370 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671370_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.547 37.0 37.0 37.0 37.0 37.0 2 36.26825 37.0 37.0 37.0 37.0 37.0 3 36.6145 37.0 37.0 37.0 37.0 37.0 4 36.6095 37.0 37.0 37.0 37.0 37.0 5 36.58 37.0 37.0 37.0 37.0 37.0 6 36.544 37.0 37.0 37.0 37.0 37.0 7 36.544 37.0 37.0 37.0 37.0 37.0 8 36.6305 37.0 37.0 37.0 37.0 37.0 9 36.6475 37.0 37.0 37.0 37.0 37.0 10-14 36.627500000000005 37.0 37.0 37.0 37.0 37.0 15-19 36.62330000000001 37.0 37.0 37.0 37.0 37.0 20-24 36.57260000000001 37.0 37.0 37.0 37.0 37.0 25-29 36.5536 37.0 37.0 37.0 37.0 37.0 30-34 36.527100000000004 37.0 37.0 37.0 37.0 37.0 35-39 36.4972 37.0 37.0 37.0 37.0 37.0 40-44 36.4948 37.0 37.0 37.0 37.0 37.0 45-49 36.430600000000005 37.0 37.0 37.0 37.0 37.0 50-54 36.4144 37.0 37.0 37.0 37.0 37.0 55-59 36.4524 37.0 37.0 37.0 37.0 37.0 60-64 36.3963 37.0 37.0 37.0 37.0 37.0 65-69 36.321799999999996 37.0 37.0 37.0 37.0 37.0 70-74 36.361599999999996 37.0 37.0 37.0 37.0 37.0 75-79 36.3765 37.0 37.0 37.0 37.0 37.0 80-84 36.380100000000006 37.0 37.0 37.0 37.0 37.0 85-89 36.3345 37.0 37.0 37.0 37.0 37.0 90-94 36.2607 37.0 37.0 37.0 37.0 37.0 95-99 36.237700000000004 37.0 37.0 37.0 37.0 37.0 100-104 36.2314 37.0 37.0 37.0 37.0 37.0 105-109 36.237199999999994 37.0 37.0 37.0 37.0 37.0 110-114 36.178999999999995 37.0 37.0 37.0 37.0 37.0 115-119 36.1926 37.0 37.0 37.0 37.0 37.0 120-124 36.1712 37.0 37.0 37.0 37.0 37.0 125-129 36.134 37.0 37.0 37.0 37.0 37.0 130-134 36.0731 37.0 37.0 37.0 37.0 37.0 135-139 36.006600000000006 37.0 37.0 37.0 37.0 37.0 140-144 35.93429999999999 37.0 37.0 37.0 37.0 37.0 145-149 35.9111 37.0 37.0 37.0 37.0 37.0 150-151 35.84125 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 1.0 18 0.0 19 0.0 20 1.0 21 1.0 22 1.0 23 1.0 24 0.0 25 4.0 26 6.0 27 3.0 28 8.0 29 15.0 30 17.0 31 26.0 32 40.0 33 65.0 34 105.0 35 292.0 36 3001.0 37 413.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.550000000000004 11.225 6.7250000000000005 42.5 2 19.005774541802662 13.53251318101933 38.16218930454431 29.299522972633696 3 18.05 17.150000000000002 27.224999999999998 37.574999999999996 4 23.925 23.9 22.875 29.299999999999997 5 21.75 32.2 25.825 20.225 6 18.625 34.225 26.5 20.65 7 13.05 25.025 43.9 18.025 8 16.3 24.224999999999998 33.800000000000004 25.674999999999997 9 16.6 22.575 36.55 24.275 10-14 18.84 30.5 27.815 22.845 15-19 19.145 27.534999999999997 29.145 24.175 20-24 19.235 28.185 28.42 24.16 25-29 19.11 28.349999999999998 28.82 23.72 30-34 19.52 28.105000000000004 28.65 23.724999999999998 35-39 19.77 28.515 27.639999999999997 24.075 40-44 19.77 27.800000000000004 28.015 24.415 45-49 19.064999999999998 28.939999999999998 27.694999999999997 24.3 50-54 19.79 28.76 28.065 23.385 55-59 19.355 28.939999999999998 28.21 23.494999999999997 60-64 20.150000000000002 28.439999999999998 27.365000000000002 24.044999999999998 65-69 19.875 28.115000000000002 28.64 23.369999999999997 70-74 20.49 28.79 27.584999999999997 23.135 75-79 20.05 28.64 27.85 23.46 80-84 19.63 27.894999999999996 28.689999999999998 23.785 85-89 19.785 28.084999999999997 28.084999999999997 24.044999999999998 90-94 19.965 28.999999999999996 27.889999999999997 23.145 95-99 19.89 28.03 28.005000000000003 24.075 100-104 20.095 29.310000000000002 27.334999999999997 23.26 105-109 19.75 28.42 28.225 23.605 110-114 19.950000000000003 28.155 28.044999999999998 23.849999999999998 115-119 20.95 28.58 27.49 22.98 120-124 20.09 28.42 27.794999999999998 23.695 125-129 20.395 28.84 27.47 23.294999999999998 130-134 20.075000000000003 28.725 27.445000000000004 23.755000000000003 135-139 20.53 29.304999999999996 27.245 22.919999999999998 140-144 20.71 28.275 27.21 23.805 145-149 20.419999999999998 29.225 27.105 23.25 150-151 20.775 28.462500000000002 26.825 23.9375 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.5 16 1.0 17 1.0 18 1.5 19 1.0 20 1.5 21 2.0 22 1.0 23 3.0 24 6.0 25 5.0 26 6.0 27 12.5 28 16.5 29 19.0 30 25.5 31 34.0 32 41.5 33 39.0 34 55.0 35 74.0 36 80.0 37 100.5 38 135.0 39 169.0 40 192.0 41 212.0 42 234.0 43 244.0 44 249.5 45 278.5 46 289.0 47 255.0 48 215.5 49 191.5 50 169.0 51 134.0 52 110.5 53 100.0 54 74.0 55 54.0 56 45.5 57 36.5 58 28.0 59 16.5 60 10.5 61 8.0 62 3.5 63 2.5 64 3.5 65 5.0 66 3.0 67 0.0 68 0.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.42500000000000004 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 84.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 85.18189884649512 72.0 2 12.12658976634132 20.5 3 2.0408163265306123 5.175 4 0.5323868677905945 1.7999999999999998 5 0.08873114463176575 0.375 6 0.02957704821058858 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCCCGATAAAGCATGGCAACCTGAGAAACCTTTTCTGGTTTCTCAAACTG 6 0.15 No Hit GACCAGTCTTGACTCCTAGTCCCAGATGGTCACAGATGACCTTGGTGCAC 5 0.125 No Hit CAGCTTTAATACGGGTTTGGACACTCTCAAACTCCGAGAATCGGCAAGGA 5 0.125 No Hit GGCCCACCAGTGCTTCCACCAAAAATTGGTGATGGGGTACTCGGGTCCAA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0125 0.0 0.0 0.0 54-55 0.0 0.025 0.0 0.0 0.0 56-57 0.0 0.025 0.0 0.0 0.0 58-59 0.0 0.025 0.0 0.0 0.0 60-61 0.0 0.025 0.0 0.0 0.0 62-63 0.0 0.025 0.0 0.0 0.0 64-65 0.0 0.025 0.0 0.0 0.0 66-67 0.0 0.025 0.0 0.0 0.0 68-69 0.0 0.025 0.0 0.0 0.0 70-71 0.0 0.025 0.0 0.0 0.0 72-73 0.0 0.025 0.0 0.0 0.0 74-75 0.0 0.025 0.0 0.0 0.0 76-77 0.0 0.025 0.0 0.0 0.0 78-79 0.025 0.025 0.0 0.0 0.0 80-81 0.025 0.025 0.0 0.0 0.0 82-83 0.05 0.025 0.0 0.0 0.0 84-85 0.075 0.025 0.0 0.0 0.0 86-87 0.075 0.025 0.0 0.0 0.0 88-89 0.075 0.025 0.0 0.0 0.0 90-91 0.1 0.025 0.0 0.0 0.0 92-93 0.1375 0.025 0.0 0.0 0.0 94-95 0.175 0.025 0.0 0.0 0.0 96-97 0.2875 0.025 0.0 0.0 0.0 98-99 0.44999999999999996 0.025 0.0 0.0 0.0 100-101 0.5375 0.025 0.0 0.0 0.0 102-103 0.6375 0.025 0.0 0.0 0.0 104-105 0.7 0.025 0.0 0.0 0.0 106-107 0.7375 0.025 0.0 0.0 0.0 108-109 0.75 0.025 0.0 0.0 0.0 110-111 0.8125 0.025 0.0 0.0 0.0 112-113 0.9125000000000001 0.025 0.0 0.0 0.0 114-115 1.1125 0.025 0.0 0.0 0.0 116-117 1.2125 0.025 0.0 0.0 0.0 118-119 1.45 0.025 0.0 0.0 0.0 120-121 1.5875 0.025 0.0 0.0 0.0 122-123 1.8125 0.025 0.0 0.0 0.0 124-125 1.9875 0.025 0.0 0.0 0.0 126-127 2.1125 0.025 0.0 0.0 0.0 128-129 2.325 0.025 0.0 0.0 0.0 130-131 2.525 0.025 0.0 0.0 0.0 132-133 2.675 0.025 0.0 0.0 0.0 134-135 2.925 0.025 0.0 0.0 0.0 136-137 3.1500000000000004 0.025 0.0 0.0 0.0 138-139 3.3875 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12671370 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671370_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3805 37.0 37.0 37.0 37.0 37.0 2 36.012 37.0 37.0 37.0 37.0 37.0 3 36.123 37.0 37.0 37.0 37.0 37.0 4 36.1415 37.0 37.0 37.0 37.0 37.0 5 36.3005 37.0 37.0 37.0 37.0 37.0 6 36.1515 37.0 37.0 37.0 37.0 37.0 7 36.1915 37.0 37.0 37.0 37.0 37.0 8 36.2635 37.0 37.0 37.0 37.0 37.0 9 36.2185 37.0 37.0 37.0 37.0 37.0 10-14 36.3008 37.0 37.0 37.0 37.0 37.0 15-19 36.3059 37.0 37.0 37.0 37.0 37.0 20-24 36.21060000000001 37.0 37.0 37.0 37.0 37.0 25-29 36.1802 37.0 37.0 37.0 37.0 37.0 30-34 36.1401 37.0 37.0 37.0 37.0 37.0 35-39 36.152499999999996 37.0 37.0 37.0 37.0 37.0 40-44 36.062599999999996 37.0 37.0 37.0 37.0 37.0 45-49 36.0631 37.0 37.0 37.0 37.0 37.0 50-54 36.0344 37.0 37.0 37.0 37.0 37.0 55-59 36.009699999999995 37.0 37.0 37.0 37.0 37.0 60-64 35.9991 37.0 37.0 37.0 37.0 37.0 65-69 35.9567 37.0 37.0 37.0 37.0 37.0 70-74 35.908100000000005 37.0 37.0 37.0 37.0 37.0 75-79 35.8839 37.0 37.0 37.0 37.0 37.0 80-84 35.8418 37.0 37.0 37.0 37.0 37.0 85-89 35.8932 37.0 37.0 37.0 37.0 37.0 90-94 35.8313 37.0 37.0 37.0 37.0 37.0 95-99 35.7851 37.0 37.0 37.0 37.0 37.0 100-104 35.7949 37.0 37.0 37.0 37.0 37.0 105-109 35.6729 37.0 37.0 37.0 37.0 37.0 110-114 35.6413 37.0 37.0 37.0 37.0 37.0 115-119 35.720699999999994 37.0 37.0 37.0 37.0 37.0 120-124 35.669200000000004 37.0 37.0 37.0 37.0 37.0 125-129 35.666199999999996 37.0 37.0 37.0 37.0 37.0 130-134 35.6354 37.0 37.0 37.0 37.0 37.0 135-139 35.482000000000006 37.0 37.0 37.0 37.0 37.0 140-144 35.5961 37.0 37.0 37.0 37.0 37.0 145-149 35.49490000000001 37.0 37.0 37.0 37.0 37.0 150-151 35.315250000000006 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 4.0 14 2.0 15 1.0 16 1.0 17 4.0 18 2.0 19 0.0 20 1.0 21 0.0 22 4.0 23 9.0 24 5.0 25 5.0 26 10.0 27 14.0 28 16.0 29 17.0 30 32.0 31 44.0 32 58.0 33 75.0 34 186.0 35 536.0 36 2693.0 37 280.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.35 22.125 11.85 27.675 2 24.175 25.900000000000002 34.975 14.95 3 20.275000000000002 26.3 33.95 19.475 4 23.025000000000002 34.725 24.375 17.875 5 25.95 36.75 21.875 15.425 6 19.8 38.625 24.05 17.525 7 19.400000000000002 20.474999999999998 39.675 20.45 8 18.9 24.975 30.025000000000002 26.1 9 21.4 25.4 29.299999999999997 23.9 10-14 22.79 28.875 27.400000000000002 20.935000000000002 15-19 22.35 27.884999999999998 28.025 21.740000000000002 20-24 22.535 28.77 27.97 20.724999999999998 25-29 22.645 27.925 28.375 21.055 30-34 22.275 27.725 28.884999999999998 21.115000000000002 35-39 21.91 28.42 28.660000000000004 21.01 40-44 22.98 28.000000000000004 28.105000000000004 20.915 45-49 22.62 28.335 28.494999999999997 20.549999999999997 50-54 22.535 28.54 27.650000000000002 21.275 55-59 22.68 27.889999999999997 28.294999999999998 21.135 60-64 22.855 28.044999999999998 28.23 20.87 65-69 22.58 27.800000000000004 28.37 21.25 70-74 22.78 27.98 27.735 21.505 75-79 23.195 28.03 28.09 20.685000000000002 80-84 23.055 28.43 27.485 21.029999999999998 85-89 23.26 28.16 27.815 20.765 90-94 23.285 27.665 27.99 21.060000000000002 95-99 23.325000000000003 28.17 28.044999999999998 20.46 100-104 23.585 27.465 28.384999999999998 20.565 105-109 23.265 28.044999999999998 27.810000000000002 20.880000000000003 110-114 23.36 28.935 27.42 20.285 115-119 23.375 27.425 28.125 21.075 120-124 23.165 28.21 27.810000000000002 20.815 125-129 23.919999999999998 28.65 27.315 20.115 130-134 23.72 28.17 27.6 20.51 135-139 24.060000000000002 27.66 27.744999999999997 20.535 140-144 24.355 28.71 27.13 19.805 145-149 24.28228468540562 28.573572071621488 27.07812343703111 20.06601980594178 150-151 24.712500000000002 28.8625 27.037499999999998 19.3875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.5 13 1.0 14 0.5 15 0.5 16 0.5 17 0.0 18 1.5 19 2.0 20 2.0 21 2.5 22 1.5 23 2.5 24 4.0 25 5.5 26 11.0 27 13.0 28 9.5 29 9.5 30 17.0 31 29.0 32 41.0 33 48.5 34 53.0 35 75.0 36 98.0 37 126.5 38 145.5 39 156.5 40 191.0 41 242.0 42 269.5 43 263.5 44 251.5 45 248.5 46 260.5 47 242.0 48 210.0 49 180.0 50 154.0 51 134.0 52 109.5 53 90.0 54 68.0 55 51.0 56 43.5 57 33.5 58 24.0 59 20.0 60 15.0 61 11.5 62 7.5 63 4.0 64 3.0 65 0.5 66 0.0 67 0.5 68 1.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.5 76 0.5 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.5 83 1.0 84 1.5 85 1.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.5 91 0.5 92 0.5 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.03 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 84.65 #Duplication Level Percentage of deduplicated Percentage of total 1 85.4695806261075 72.35000000000001 2 11.872415829887775 20.1 3 2.067336089781453 5.25 4 0.3544004725339634 1.2 5 0.11813349084465447 0.5 6 0.11813349084465447 0.6 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCATGTCCCAAGATCTTTCATGGAAGGGACCAGCCAGACTCTGGGAGAAG 6 0.15 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 6 0.15 No Hit CGAAAGCCATCCTCTGAAACAACATCAATATGGCTCCTAAACTTTCCTGT 6 0.15 No Hit CAGAGAACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTA 6 0.15 No Hit TATTGAACCAGCACCCTCCTACAGACCCATATCACCCAACACCCTCGAAT 5 0.125 No Hit ACAAATTATGAGAAAGATAAGAGGTTTCAAGATTGGCAAACGGTTAGTCC 5 0.125 No Hit CAAGAACATTCTCTCACCGTCAACTCCATTTTTCTTCAACACCCTCTATG 5 0.125 No Hit AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1375 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.2875 0.0 0.0 0.0 0.0 98-99 0.44999999999999996 0.0 0.0 0.0 0.0 100-101 0.5375 0.0 0.0 0.0 0.0 102-103 0.6375 0.0 0.0 0.0 0.0 104-105 0.7 0.0 0.0 0.0 0.0 106-107 0.7375 0.0 0.0 0.0 0.0 108-109 0.75 0.0 0.0 0.0 0.0 110-111 0.8125 0.0 0.0 0.0 0.0 112-113 0.9125000000000001 0.0 0.0 0.0 0.0 114-115 1.1125 0.0 0.0 0.0 0.0 116-117 1.2125 0.0 0.0 0.0 0.0 118-119 1.45 0.0 0.0 0.0 0.0 120-121 1.5875 0.0 0.0 0.0 0.0 122-123 1.8125 0.0 0.0 0.0 0.0 124-125 1.9875 0.0 0.0 0.0 0.0 126-127 2.1125 0.0 0.0 0.0 0.0 128-129 2.325 0.0 0.0 0.0 0.0 130-131 2.525 0.0 0.0 0.0 0.0 132-133 2.675 0.0 0.0 0.0 0.0 134-135 2.925 0.0 0.0 0.0 0.0 136-137 3.1500000000000004 0.0 0.0 0.0 0.0 138-139 3.3875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAACCAC 10 0.006830828 145.0 5 CAAACAC 10 0.006830828 145.0 1 GGAAGAG 35 0.0035366106 20.714287 130-134 AAAAAAA 55 0.0025160722 15.818182 10-14 >>END_MODULE Read 838041 spots for SRR12671370.sra Written 838041 spots for SRR12671370.sra Read 838041 spots for SRR12671370.sra Written 838041 spots for SRR12671370.sra Read 838041 spots for SRR12671370.sra Written 838041 spots for SRR12671370.sra Read 838041 spots for SRR12671370.sra Written 838041 spots for SRR12671370.sra Read 838041 spots for SRR12671370.sra Written 838041 spots for SRR12671370.sra Read 838041 spots for SRR12671370.sra Written 838041 spots for SRR12671370.sra Read 838041 spots for SRR12671370.sra Written 838041 spots for SRR12671370.sra Read 838041 spots for SRR12671370.sra Written 838041 spots for SRR12671370.sra Read 838041 spots for SRR12671370.sra Written 838041 spots for SRR12671370.sra Read 838041 spots for SRR12671370.sra Written 838041 spots for SRR12671370.sra Read 838041 spots for SRR12671370.sra Written 838041 spots for SRR12671370.sra Read 838041 spots for SRR12671370.sra Written 838041 spots for SRR12671370.sra Read 838041 spots for SRR12671370.sra Written 838041 spots for SRR12671370.sra Read 838041 spots for SRR12671370.sra Written 838041 spots for SRR12671370.sra Read 838041 spots for SRR12671370.sra Written 838041 spots for SRR12671370.sra Read 838041 spots for SRR12671370.sra Written 838041 spots for SRR12671370.sra Read 838053 spots for SRR12671370.sra Written 838053 spots for SRR12671370.sra Read 838041 spots for SRR12671370.sra Written 838041 spots for SRR12671370.sra Read 838041 spots for SRR12671370.sra Written 838041 spots for SRR12671370.sra Read 838041 spots for SRR12671370.sra Written 838041 spots for SRR12671370.sra SRR ids: ['SRR12671370.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_h13zxqxr SRR12671370.sra spots: 16760832 blocks: [[1, 838041], [838042, 1676082], [1676083, 2514123], [2514124, 3352164], [3352165, 4190205], [4190206, 5028246], [5028247, 5866287], [5866288, 6704328], [6704329, 7542369], [7542370, 8380410], [8380411, 9218451], [9218452, 10056492], [10056493, 10894533], [10894534, 11732574], [11732575, 12570615], [12570616, 13408656], [13408657, 14246697], [14246698, 15084738], [15084739, 15922779], [15922780, 16760832]] SRR12671370 file size 5674363 SRR12671370 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671370 SRR12671370_1.fastq SRR12671370_2.fastq Input file: SRR12671370_1.fastq Paired file: SRR12671370_2.fastq trimmed: SRR12671370-trimmed-pair1.fastq, SRR12671370-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 19:44:52 2025 >> started Tue Feb 11 19:45:12 2025 >> done (19.277s) 16760832 read pairs processed; of these: 45 ( 0.00%) short read pairs filtered out after trimming by size control 1210 ( 0.01%) empty read pairs filtered out after trimming by size control 16759577 (99.99%) read pairs available; of these: 853824 ( 5.09%) trimmed read pairs available after processing 15905753 (94.91%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 2 0.00% 20 4 0.00% 21 4 0.00% 22 8 0.00% 23 2 0.00% 24 6 0.00% 25 8 0.00% 26 9 0.00% 27 6 0.00% 28 7 0.00% 29 9 0.00% 30 7 0.00% 31 9 0.00% 32 11 0.00% 33 15 0.00% 34 13 0.00% 35 4 0.00% 36 3 0.00% 37 10 0.00% 38 16 0.00% 39 16 0.00% 40 26 0.00% 41 16 0.00% 42 16 0.00% 43 31 0.00% 44 18 0.00% 45 26 0.00% 46 11 0.00% 47 27 0.00% 48 30 0.00% 49 39 0.00% 50 45 0.00% 51 49 0.00% 52 47 0.00% 53 60 0.00% 54 42 0.00% 55 64 0.00% 56 82 0.00% 57 89 0.00% 58 91 0.00% 59 108 0.00% 60 141 0.00% 61 131 0.00% 62 126 0.00% 63 173 0.00% 64 189 0.00% 65 228 0.00% 66 266 0.00% 67 277 0.00% 68 308 0.00% 69 354 0.00% 70 388 0.00% 71 423 0.00% 72 517 0.00% 73 571 0.00% 74 638 0.00% 75 673 0.00% 76 825 0.00% 77 888 0.01% 78 991 0.01% 79 1127 0.01% 80 1118 0.01% 81 1382 0.01% 82 1416 0.01% 83 1604 0.01% 84 1835 0.01% 85 1911 0.01% 86 2136 0.01% 87 2293 0.01% 88 2506 0.01% 89 2562 0.02% 90 2915 0.02% 91 3042 0.02% 92 3296 0.02% 93 3446 0.02% 94 3817 0.02% 95 4076 0.02% 96 4450 0.03% 97 4486 0.03% 98 4736 0.03% 99 5044 0.03% 100 5374 0.03% 101 5530 0.03% 102 5843 0.03% 103 5979 0.04% 104 6469 0.04% 105 6595 0.04% 106 6998 0.04% 107 7302 0.04% 108 7746 0.05% 109 7795 0.05% 110 8258 0.05% 111 8649 0.05% 112 9004 0.05% 113 9062 0.05% 114 9330 0.06% 115 10275 0.06% 116 10418 0.06% 117 11097 0.07% 118 11420 0.07% 119 11550 0.07% 120 12164 0.07% 121 12474 0.07% 122 13027 0.08% 123 13567 0.08% 124 13797 0.08% 125 14357 0.09% 126 15210 0.09% 127 15279 0.09% 128 16083 0.10% 129 16576 0.10% 130 16830 0.10% 131 17277 0.10% 132 17968 0.11% 133 18545 0.11% 134 18866 0.11% 135 19503 0.12% 136 20417 0.12% 137 20867 0.12% 138 21350 0.13% 139 22320 0.13% 140 22972 0.14% 141 23371 0.14% 142 23977 0.14% 143 24214 0.14% 144 25050 0.15% 145 25858 0.15% 146 26376 0.16% 147 27315 0.16% 148 27821 0.17% 149 28140 0.17% 150 29162 0.17% 151 15905753 94.91% 16759577 reads passed initial QC criterion=sequence-density sequence-density=0.38 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=23 prefix-density=0.38 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=79.95 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=4.1 sequence=ACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGG criterion=sequence-density sequence-density=0.67 sequence-density-rank=1 fanout-score=2.15 fanout-score-rank=26 prefix-density=0.68 prefix-fanout=2.1 sequence=CCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTG criterion=fanout-score sequence-density=0.15 sequence-density-rank=21 fanout-score=30.32 fanout-score-rank=1 prefix-density=0.39 prefix-fanout=11.4 sequence=AAAGAAAAGAAAA SRR12671370 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 19:46:14 Started mapping on | Feb 11 19:46:14 Finished on | Feb 11 19:48:01 Mapping speed, Million of reads per hour | 563.87 Number of input reads | 16759577 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 15183931 Uniquely mapped reads % | 90.60% Average mapped length | 294.93 Number of splices: Total | 15153013 Number of splices: Annotated (sjdb) | 14814449 Number of splices: GT/AG | 14853441 Number of splices: GC/AG | 240097 Number of splices: AT/AC | 9779 Number of splices: Non-canonical | 49696 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 2.90 Insertion rate per base | 0.03% Insertion average length | 2.32 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 400076 % of reads mapped to multiple loci | 2.39% Number of reads mapped to too many loci | 88980 % of reads mapped to too many loci | 0.53% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.33% % of reads unmapped: other | 0.15% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1175570 1175570 1175570 N_multimapping 400076 400076 400076 N_noFeature 615562 14972576 679036 N_ambiguous 286099 1432 137390 UnstrandedReadsAssigned:14282270 PositiveStrandReadsAssigned:209923 NegativeStrandReadsAssigned:14367505 Dataset is classified negative stranded MeadianReadLen=147 20thPercentileLength=147 echo kmer=143 SRR12671370 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671370-trimmed-pair1.fastq SRR12671370-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,759,577 reads, 14,848,581 reads pseudoaligned [quant] estimated average fragment length: 299.126 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,071 rounds 52401 SRR12671370.ke.tsv 34699 SRR12671370.se.tsv 87100 total ==> SRR12671370.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1719.87 677 24.4479 Potri.005G024800.1.v4.1 1035 736.874 325 27.393 Potri.004G059700.1.v4.1 961 663.284 6 0.561825 Potri.007G009000.2.v4.1 1416 1117.87 0 0 Potri.003G141000.2.v4.1 2943 2644.87 734.823 17.2555 Potri.016G087400.1.v4.1 270 76.5513 678 550.081 Potri.015G069301.1.v4.1 564 293.134 0 0 Potri.010G195200.1.v4.1 1773 1474.87 179 7.53785 Potri.012G127500.1.v4.1 977 679.11 206 18.8398 ==> SRR12671370.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 154 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 193 Potri.001G212900.v4.1 7 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 8 Potri.001G416900.v4.1 4 Potri.001G452600.v4.1 4 SRR12671370 completed mapping pipeline successfully