Starting /dee2/code/volunteer_pipeline.sh SRR12671371 current disk space = 3053117022208 free memory = 1390708128 SRR12671371 SRAfilesize 5b77d8beae2c63853a78700acf18306e SRR12671371.sra SRR12671371.sra file validated SRR12671371 is paired end SRR12671371 is conventional basespace SRR12671371 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671371_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.6165 37.0 37.0 37.0 37.0 37.0 2 36.35375 37.0 37.0 37.0 37.0 37.0 3 36.519 37.0 37.0 37.0 37.0 37.0 4 36.6385 37.0 37.0 37.0 37.0 37.0 5 36.6 37.0 37.0 37.0 37.0 37.0 6 36.645 37.0 37.0 37.0 37.0 37.0 7 36.503 37.0 37.0 37.0 37.0 37.0 8 36.6115 37.0 37.0 37.0 37.0 37.0 9 36.627 37.0 37.0 37.0 37.0 37.0 10-14 36.6145 37.0 37.0 37.0 37.0 37.0 15-19 36.581500000000005 37.0 37.0 37.0 37.0 37.0 20-24 36.5129 37.0 37.0 37.0 37.0 37.0 25-29 36.418899999999994 37.0 37.0 37.0 37.0 37.0 30-34 36.4296 37.0 37.0 37.0 37.0 37.0 35-39 36.343999999999994 37.0 37.0 37.0 37.0 37.0 40-44 36.2818 37.0 37.0 37.0 37.0 37.0 45-49 36.259699999999995 37.0 37.0 37.0 37.0 37.0 50-54 36.2471 37.0 37.0 37.0 37.0 37.0 55-59 36.1846 37.0 37.0 37.0 37.0 37.0 60-64 36.210800000000006 37.0 37.0 37.0 37.0 37.0 65-69 36.1475 37.0 37.0 37.0 37.0 37.0 70-74 36.12049999999999 37.0 37.0 37.0 37.0 37.0 75-79 36.1265 37.0 37.0 37.0 37.0 37.0 80-84 36.1265 37.0 37.0 37.0 37.0 37.0 85-89 36.0758 37.0 37.0 37.0 37.0 37.0 90-94 36.0961 37.0 37.0 37.0 37.0 37.0 95-99 35.9401 37.0 37.0 37.0 37.0 37.0 100-104 35.9913 37.0 37.0 37.0 37.0 37.0 105-109 36.01709999999999 37.0 37.0 37.0 37.0 37.0 110-114 35.909299999999995 37.0 37.0 37.0 37.0 37.0 115-119 35.9394 37.0 37.0 37.0 37.0 37.0 120-124 35.9167 37.0 37.0 37.0 37.0 37.0 125-129 35.8361 37.0 37.0 37.0 37.0 37.0 130-134 35.7773 37.0 37.0 37.0 37.0 37.0 135-139 35.802699999999994 37.0 37.0 37.0 37.0 37.0 140-144 35.7057 37.0 37.0 37.0 37.0 37.0 145-149 35.7075 37.0 37.0 37.0 37.0 37.0 150-151 35.6635 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 2.0 19 3.0 20 1.0 21 6.0 22 9.0 23 5.0 24 7.0 25 5.0 26 9.0 27 10.0 28 11.0 29 20.0 30 20.0 31 36.0 32 53.0 33 78.0 34 119.0 35 300.0 36 2859.0 37 447.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 56.85 12.25 6.2 24.7 2 20.71733132681214 11.888638073739653 37.07047905693504 30.323551542513165 3 17.775 22.15 34.025 26.05 4 20.575 26.6 29.825000000000003 23.0 5 21.275 35.875 23.925 18.925 6 18.9 37.35 24.575 19.175 7 13.8 26.174999999999997 44.3 15.725 8 14.924999999999999 23.150000000000002 34.675 27.250000000000004 9 15.9 20.775 35.375 27.950000000000003 10-14 19.62 29.025000000000002 28.175 23.18 15-19 19.939999999999998 27.845 28.24 23.974999999999998 20-24 20.57 27.985 28.33 23.115 25-29 20.0 27.700000000000003 28.660000000000004 23.64 30-34 19.794999999999998 28.53 28.23 23.445 35-39 19.625 28.499999999999996 27.889999999999997 23.985 40-44 20.169999999999998 28.71 28.105000000000004 23.015 45-49 19.91 28.92 27.93 23.24 50-54 20.150000000000002 28.71 27.915 23.225 55-59 20.01 29.099999999999998 27.32 23.57 60-64 19.925 29.080000000000002 28.38 22.615 65-69 20.105 28.51 27.675 23.71 70-74 20.225 28.53 27.96 23.285 75-79 20.395 28.655 27.27 23.68 80-84 20.455000000000002 27.82 27.665 24.060000000000002 85-89 20.95 28.65 27.694999999999997 22.705000000000002 90-94 20.669999999999998 28.599999999999998 27.01 23.72 95-99 20.244999999999997 27.965 28.02 23.77 100-104 20.46 28.449999999999996 27.474999999999998 23.615 105-109 20.424999999999997 28.89 27.295 23.39 110-114 20.169999999999998 27.96 27.794999999999998 24.075 115-119 20.915 28.73 26.99 23.365 120-124 20.75 29.054999999999996 26.700000000000003 23.494999999999997 125-129 20.53 28.7 26.919999999999998 23.849999999999998 130-134 20.724999999999998 28.875 26.75 23.65 135-139 20.655 28.685 27.1 23.56 140-144 20.835 28.494999999999997 27.265 23.405 145-149 20.94 28.560000000000002 26.340000000000003 24.16 150-151 19.575 28.349999999999998 26.775 25.3 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 1.5 3 4.0 4 2.5 5 0.5 6 0.5 7 0.5 8 1.0 9 1.0 10 1.5 11 2.0 12 1.5 13 3.0 14 3.0 15 2.0 16 3.5 17 3.5 18 2.5 19 2.5 20 3.5 21 3.5 22 3.5 23 2.5 24 4.0 25 9.5 26 10.5 27 12.0 28 20.0 29 22.5 30 18.5 31 28.0 32 41.0 33 52.5 34 63.5 35 82.0 36 88.5 37 97.5 38 129.0 39 152.0 40 162.5 41 176.0 42 198.0 43 232.5 44 258.5 45 254.0 46 246.0 47 231.0 48 240.5 49 230.5 50 184.5 51 153.0 52 122.0 53 96.0 54 83.0 55 63.5 56 49.5 57 41.5 58 23.0 59 21.0 60 20.0 61 10.5 62 7.0 63 5.0 64 4.5 65 4.0 66 1.0 67 0.0 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.325 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 80.77499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 81.77034973692355 66.05 2 14.453729495512224 23.35 3 2.6307644692045806 6.375 4 0.7428040854224698 2.4 5 0.2166511915815537 0.8750000000000001 6 0.12380068090374496 0.6 7 0.06190034045187248 0.35000000000000003 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCCCGATTCAGCATCCGAATCCAGAAGCTAAAAACAAAAACAAAGTAGAA 7 0.17500000000000002 No Hit GCTTTGTGCGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGTCCACCCT 7 0.17500000000000002 No Hit GGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGA 6 0.15 No Hit GTAGCTTCCACATAGTCCAGTAGCGTCCATCATAGTACCCTGGTGAGCTG 6 0.15 No Hit GCATTGAACTCGTCCACCATTGCTTGCAATGGAAGTAATGTCATTAGCCT 6 0.15 No Hit CGATAAAACTGATGCACTGCACTTGACGAGTGTTGTCGAATCCAATGATA 6 0.15 No Hit GCGACAAGCAGGTCCATCCTTACACGGCTGAGTCCTGTAACGGGCAGGAT 5 0.125 No Hit AGCAGATTCTGATGAAGTAAGAGCAGTGCTGTGAATTCTGGGATTCTCTG 5 0.125 No Hit GGCCACTCTTGCACTTACCAGAATTGCTGCTTGTGAAGTAACGAATCCCT 5 0.125 No Hit GGGTCATTCAGCACAGGAGGGGTGCTAATAGAGGTGACTAGGTTTGGTGG 5 0.125 No Hit GTGTAAATGAATCTCATCATCAACTCGAAAACCTCCCATCTAATATTCGG 5 0.125 No Hit GCGGCACCGGACAATGGAGGCAGAGGGCAAGCGGAGGGTCTGACCCTTGA 5 0.125 No Hit GTACGATTCTCCACTGTTCGGAGCAGCCTGATCCCATCTGAATTTGCTAG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.037500000000000006 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.16249999999999998 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.275 0.0 0.0 0.0 0.0 88-89 0.425 0.0 0.0 0.0 0.0 90-91 0.5 0.0 0.0 0.0 0.0 92-93 0.575 0.0 0.0 0.0 0.0 94-95 0.6 0.0 0.0 0.0 0.0 96-97 0.6125 0.0 0.0 0.0 0.0 98-99 0.7375 0.0 0.0 0.0 0.0 100-101 1.0 0.0 0.0 0.0 0.0 102-103 1.0875 0.0 0.0 0.0 0.0 104-105 1.2375 0.0 0.0 0.0 0.0 106-107 1.4 0.0 0.0 0.0 0.0 108-109 1.4625 0.0 0.0 0.0 0.0 110-111 1.5750000000000002 0.0 0.0 0.0 0.0 112-113 1.6375 0.0 0.0 0.0 0.0 114-115 1.7374999999999998 0.0 0.0 0.0 0.0 116-117 1.9249999999999998 0.0 0.0 0.0 0.0 118-119 2.125 0.0 0.0 0.0 0.0 120-121 2.4124999999999996 0.0 0.0 0.0 0.0 122-123 2.5375 0.0 0.0 0.0 0.0 124-125 2.7375 0.0 0.0 0.0 0.0 126-127 2.9125 0.0 0.0 0.0 0.0 128-129 3.1125 0.0 0.0 0.0 0.0 130-131 3.4 0.0 0.0 0.0 0.0 132-133 3.7874999999999996 0.0 0.0 0.0 0.0 134-135 4.1125 0.0 0.0 0.0 0.0 136-137 4.362500000000001 0.0 0.0 0.0 0.0 138-139 4.8 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAAAAAT 10 0.006830828 145.0 9 GGGGGGG 110 8.710578E-6 13.181819 145 >>END_MODULE SRR12671371 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671371_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.0935 37.0 37.0 37.0 37.0 37.0 2 35.923 37.0 37.0 37.0 37.0 37.0 3 35.9235 37.0 37.0 37.0 37.0 37.0 4 36.072 37.0 37.0 37.0 37.0 37.0 5 36.1215 37.0 37.0 37.0 37.0 37.0 6 36.118 37.0 37.0 37.0 37.0 37.0 7 36.016 37.0 37.0 37.0 37.0 37.0 8 36.1325 37.0 37.0 37.0 37.0 37.0 9 36.1215 37.0 37.0 37.0 37.0 37.0 10-14 36.0184 37.0 37.0 37.0 37.0 37.0 15-19 36.0029 37.0 37.0 37.0 37.0 37.0 20-24 35.9187 37.0 37.0 37.0 37.0 37.0 25-29 35.88250000000001 37.0 37.0 37.0 37.0 37.0 30-34 35.862300000000005 37.0 37.0 37.0 37.0 37.0 35-39 35.8478 37.0 37.0 37.0 37.0 37.0 40-44 35.8241 37.0 37.0 37.0 37.0 37.0 45-49 35.7817 37.0 37.0 37.0 37.0 37.0 50-54 35.686800000000005 37.0 37.0 37.0 37.0 37.0 55-59 35.687200000000004 37.0 37.0 37.0 37.0 37.0 60-64 35.6483 37.0 37.0 37.0 37.0 37.0 65-69 35.6764 37.0 37.0 37.0 37.0 37.0 70-74 35.6533 37.0 37.0 37.0 37.0 37.0 75-79 35.5984 37.0 37.0 37.0 37.0 37.0 80-84 35.513 37.0 37.0 37.0 37.0 37.0 85-89 35.6519 37.0 37.0 37.0 37.0 37.0 90-94 35.5404 37.0 37.0 37.0 37.0 37.0 95-99 35.5692 37.0 37.0 37.0 37.0 37.0 100-104 35.5013 37.0 37.0 37.0 37.0 37.0 105-109 35.4359 37.0 37.0 37.0 37.0 37.0 110-114 35.3957 37.0 37.0 37.0 37.0 37.0 115-119 35.463100000000004 37.0 37.0 37.0 37.0 37.0 120-124 35.43429999999999 37.0 37.0 37.0 37.0 37.0 125-129 35.415800000000004 37.0 37.0 37.0 37.0 37.0 130-134 35.2742 37.0 37.0 37.0 32.2 37.0 135-139 35.2245 37.0 37.0 37.0 32.2 37.0 140-144 35.263999999999996 37.0 37.0 37.0 32.2 37.0 145-149 35.1485 37.0 37.0 37.0 27.4 37.0 150-151 34.933499999999995 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 5.0 14 10.0 15 6.0 16 2.0 17 6.0 18 2.0 19 1.0 20 7.0 21 7.0 22 9.0 23 11.0 24 12.0 25 12.0 26 20.0 27 14.0 28 18.0 29 21.0 30 26.0 31 43.0 32 50.0 33 107.0 34 217.0 35 543.0 36 2584.0 37 266.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 57.825 20.175 5.625 16.375 2 30.075000000000003 17.1 32.2 20.625 3 21.875 24.85 36.7 16.575 4 24.525 32.4 24.325 18.75 5 24.85 39.125 20.25 15.775 6 22.15 37.75 21.45 18.65 7 21.9 23.400000000000002 36.275 18.425 8 18.925 26.025 29.725 25.324999999999996 9 22.400000000000002 24.224999999999998 28.549999999999997 24.825 10-14 24.185000000000002 28.410000000000004 26.325 21.08 15-19 24.05 28.18 26.365 21.404999999999998 20-24 23.48 28.444999999999997 26.86 21.215 25-29 23.200000000000003 28.625 27.665 20.51 30-34 23.965 28.18 27.939999999999998 19.915 35-39 23.36 27.694999999999997 27.935 21.01 40-44 24.015 27.775 27.41 20.8 45-49 23.36 28.58 27.400000000000002 20.66 50-54 23.425 27.92 28.015 20.64 55-59 24.485 26.884999999999998 27.725 20.905 60-64 23.244999999999997 27.525 27.29 21.94 65-69 23.76 26.91 27.72 21.61 70-74 23.330000000000002 27.755000000000003 27.810000000000002 21.105 75-79 23.705000000000002 27.71 27.595 20.990000000000002 80-84 23.77 28.455000000000002 26.82 20.955 85-89 23.805 28.38 26.645000000000003 21.17 90-94 24.14 28.1 26.905 20.855 95-99 23.880000000000003 27.92 27.155 21.044999999999998 100-104 24.075 28.07 27.07 20.785 105-109 24.145 27.49 27.76 20.605 110-114 24.45 28.435 27.37 19.744999999999997 115-119 23.799999999999997 28.22 27.43 20.549999999999997 120-124 24.32 27.775 27.54 20.365 125-129 24.58 28.215 27.005000000000003 20.200000000000003 130-134 24.035 27.950000000000003 27.46 20.555 135-139 24.529999999999998 28.28 27.13 20.06 140-144 25.1 26.69 27.815 20.395 145-149 24.3974397439744 27.672767276727672 27.20772077207721 20.72207220722072 150-151 26.1625 27.3375 26.2625 20.2375 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.5 5 1.0 6 1.0 7 1.0 8 0.5 9 0.5 10 1.0 11 1.0 12 1.5 13 1.5 14 1.0 15 0.5 16 0.5 17 0.5 18 1.0 19 1.0 20 1.5 21 2.5 22 1.0 23 1.0 24 4.0 25 6.5 26 9.0 27 9.5 28 9.0 29 13.0 30 21.0 31 27.5 32 29.0 33 34.0 34 43.5 35 57.0 36 78.5 37 101.0 38 129.0 39 151.5 40 167.5 41 188.0 42 223.5 43 264.5 44 262.0 45 238.0 46 259.0 47 264.5 48 231.0 49 207.0 50 179.5 51 144.5 52 105.5 53 92.5 54 83.5 55 71.5 56 58.5 57 43.0 58 38.0 59 28.5 60 20.5 61 14.0 62 8.5 63 6.0 64 4.0 65 3.0 66 2.5 67 1.0 68 3.0 69 2.5 70 0.5 71 0.5 72 0.0 73 0.0 74 0.5 75 0.5 76 0.5 77 1.5 78 1.5 79 1.0 80 0.5 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 1.0 88 1.0 89 1.0 90 2.0 91 1.5 92 2.5 93 2.5 94 2.0 95 2.0 96 0.5 97 0.5 98 1.0 99 1.5 100 7.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.01 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 81.22500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 82.54847645429363 67.05 2 13.911972914742998 22.6 3 2.4007386888273317 5.8500000000000005 4 0.7694675284702985 2.5 5 0.24622960911049552 1.0 6 0.06155740227762388 0.3 7 0.03077870113881194 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.03077870113881194 0.525 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 21 0.525 No Hit GTGAAGCTCAACCCCTCCTCCTCTGAGATCATGGGCAATGGCCGTGTCTC 7 0.17500000000000002 No Hit GTTGGGTCTACCGCGAGCACCACCAGTCCCCAGGGTACTATGATGGACGC 6 0.15 No Hit GGAAGGAACGCTATTAGCTGTCTCAACAAATGACAATAGCATCAAAATTC 6 0.15 No Hit GGGTAAAATAGCTGAGGTGGAGACCAAAGAAGAATACCTGACGTGTGATG 5 0.125 No Hit GCATAGCTTATAAGCTTGTAAGAGATGGCTTCCTCCTCTATGATCTCATC 5 0.125 No Hit CCACTGCCTCACAAGGTCCCCAGCCCATAATCCATGGCACCGCAAGCGTA 5 0.125 No Hit GGGGATGTATTCTCGCCATGGAGGTAAAAGTTGGATCAAGTCGATGATTC 5 0.125 No Hit AGATAAGATAGCAGACACAAATTGTTATTATAGGCTCTATCTTGCACTAG 5 0.125 No Hit GCTAATCAGAATAGTAGGTATTACCTTTTAAAGAAACGGACACCATCTCA 5 0.125 No Hit GGAGCACTGCATAGCTTATAAGCTTGTAAGAGATGGCTTCCTCCTCTATG 5 0.125 No Hit TTGCCTGCTTGCTTCTTCAGATGCATTTCGGGCAATGTTTGATGGTGGTT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.037500000000000006 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.16249999999999998 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.2625 0.0 0.0 0.0 0.0 88-89 0.425 0.0 0.0 0.0 0.0 90-91 0.525 0.0 0.0 0.0 0.0 92-93 0.6 0.0 0.0 0.0 0.0 94-95 0.625 0.0 0.0 0.0 0.0 96-97 0.65 0.0 0.0 0.0 0.0 98-99 0.7875 0.0 0.0 0.0 0.0 100-101 1.075 0.0 0.0 0.0 0.0 102-103 1.1625 0.0 0.0 0.0 0.0 104-105 1.3125 0.0 0.0 0.0 0.0 106-107 1.475 0.0 0.0 0.0 0.0 108-109 1.5625 0.0 0.0 0.0 0.0 110-111 1.7000000000000002 0.0 0.0 0.0 0.0 112-113 1.7625 0.0 0.0 0.0 0.0 114-115 1.8624999999999998 0.0 0.0 0.0 0.0 116-117 2.05 0.0 0.0 0.0 0.0 118-119 2.25 0.0 0.0 0.0 0.0 120-121 2.5625 0.0 0.0 0.0 0.0 122-123 2.6875 0.0 0.0 0.0 0.0 124-125 2.8875 0.0 0.0 0.0 0.0 126-127 3.0625 0.0 0.0 0.0 0.0 128-129 3.275 0.0 0.0 0.0 0.0 130-131 3.575 0.0 0.0 0.0 0.0 132-133 3.9625000000000004 0.0 0.0 0.0 0.0 134-135 4.2625 0.0 0.0 0.0 0.0 136-137 4.512499999999999 0.0 0.0 0.0 0.0 138-139 4.95 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTGACAG 10 0.006830828 145.0 8 AAAAAAA 40 9.990927E-6 25.375 20-24 >>END_MODULE Read 981137 spots for SRR12671371.sra Written 981137 spots for SRR12671371.sra Read 981137 spots for SRR12671371.sra Written 981137 spots for SRR12671371.sra Read 981137 spots for SRR12671371.sra Written 981137 spots for SRR12671371.sra Read 981137 spots for SRR12671371.sra Written 981137 spots for SRR12671371.sra Read 981137 spots for SRR12671371.sra Written 981137 spots for SRR12671371.sra Read 981137 spots for SRR12671371.sra Written 981137 spots for SRR12671371.sra Read 981137 spots for SRR12671371.sra Written 981137 spots for SRR12671371.sra Read 981137 spots for SRR12671371.sra Written 981137 spots for SRR12671371.sra Read 981137 spots for SRR12671371.sra Written 981137 spots for SRR12671371.sra Read 981137 spots for SRR12671371.sra Written 981137 spots for SRR12671371.sra Read 981137 spots for SRR12671371.sra Written 981137 spots for SRR12671371.sra Read 981137 spots for SRR12671371.sra Written 981137 spots for SRR12671371.sra Read 981137 spots for SRR12671371.sra Written 981137 spots for SRR12671371.sra Read 981137 spots for SRR12671371.sra Written 981137 spots for SRR12671371.sra Read 981137 spots for SRR12671371.sra Written 981137 spots for SRR12671371.sra Read 981137 spots for SRR12671371.sra Written 981137 spots for SRR12671371.sra Read 981148 spots for SRR12671371.sra Written 981148 spots for SRR12671371.sra Read 981137 spots for SRR12671371.sra Written 981137 spots for SRR12671371.sra Read 981137 spots for SRR12671371.sra Written 981137 spots for SRR12671371.sra Read 981137 spots for SRR12671371.sra Written 981137 spots for SRR12671371.sra SRR ids: ['SRR12671371.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_vjqi6k93 SRR12671371.sra spots: 19622751 blocks: [[1, 981137], [981138, 1962274], [1962275, 2943411], [2943412, 3924548], [3924549, 4905685], [4905686, 5886822], [5886823, 6867959], [6867960, 7849096], [7849097, 8830233], [8830234, 9811370], [9811371, 10792507], [10792508, 11773644], [11773645, 12754781], [12754782, 13735918], [13735919, 14717055], [14717056, 15698192], [15698193, 16679329], [16679330, 17660466], [17660467, 18641603], [18641604, 19622751]] SRR12671371 file size 6646968 SRR12671371 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671371 SRR12671371_1.fastq SRR12671371_2.fastq Input file: SRR12671371_1.fastq Paired file: SRR12671371_2.fastq trimmed: SRR12671371-trimmed-pair1.fastq, SRR12671371-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 20:21:12 2025 >> started Tue Feb 11 20:21:33 2025 >> done (21.195s) 19622751 read pairs processed; of these: 644 ( 0.00%) short read pairs filtered out after trimming by size control 11775 ( 0.06%) empty read pairs filtered out after trimming by size control 19610332 (99.94%) read pairs available; of these: 1194523 ( 6.09%) trimmed read pairs available after processing 18415809 (93.91%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 56 0.00% 19 71 0.00% 20 75 0.00% 21 66 0.00% 22 90 0.00% 23 103 0.00% 24 103 0.00% 25 137 0.00% 26 158 0.00% 27 123 0.00% 28 125 0.00% 29 100 0.00% 30 123 0.00% 31 108 0.00% 32 89 0.00% 33 93 0.00% 34 75 0.00% 35 86 0.00% 36 69 0.00% 37 91 0.00% 38 92 0.00% 39 85 0.00% 40 73 0.00% 41 89 0.00% 42 78 0.00% 43 68 0.00% 44 73 0.00% 45 71 0.00% 46 98 0.00% 47 105 0.00% 48 104 0.00% 49 126 0.00% 50 158 0.00% 51 140 0.00% 52 185 0.00% 53 166 0.00% 54 192 0.00% 55 233 0.00% 56 204 0.00% 57 285 0.00% 58 324 0.00% 59 311 0.00% 60 377 0.00% 61 476 0.00% 62 472 0.00% 63 563 0.00% 64 582 0.00% 65 660 0.00% 66 707 0.00% 67 872 0.00% 68 857 0.00% 69 1031 0.01% 70 1198 0.01% 71 1417 0.01% 72 1545 0.01% 73 1799 0.01% 74 1893 0.01% 75 1989 0.01% 76 2060 0.01% 77 2339 0.01% 78 2609 0.01% 79 2666 0.01% 80 3058 0.02% 81 3312 0.02% 82 3625 0.02% 83 3924 0.02% 84 4042 0.02% 85 4212 0.02% 86 4357 0.02% 87 4668 0.02% 88 4890 0.02% 89 5197 0.03% 90 5637 0.03% 91 5860 0.03% 92 6139 0.03% 93 6790 0.03% 94 7132 0.04% 95 7346 0.04% 96 7410 0.04% 97 7662 0.04% 98 7975 0.04% 99 8208 0.04% 100 8679 0.04% 101 9121 0.05% 102 9941 0.05% 103 9924 0.05% 104 10606 0.05% 105 10544 0.05% 106 10668 0.05% 107 10958 0.06% 108 11617 0.06% 109 11894 0.06% 110 12117 0.06% 111 12901 0.07% 112 13677 0.07% 113 14035 0.07% 114 14399 0.07% 115 14576 0.07% 116 15509 0.08% 117 15738 0.08% 118 15876 0.08% 119 16033 0.08% 120 16599 0.08% 121 17397 0.09% 122 17967 0.09% 123 18899 0.10% 124 20031 0.10% 125 20167 0.10% 126 20789 0.11% 127 20974 0.11% 128 21120 0.11% 129 22286 0.11% 130 22475 0.11% 131 23064 0.12% 132 24172 0.12% 133 24780 0.13% 134 25451 0.13% 135 26395 0.13% 136 26155 0.13% 137 26659 0.14% 138 27493 0.14% 139 28099 0.14% 140 27875 0.14% 141 28386 0.14% 142 29539 0.15% 143 30960 0.16% 144 31896 0.16% 145 32820 0.17% 146 33157 0.17% 147 32829 0.17% 148 34049 0.17% 149 34130 0.17% 150 36340 0.19% 151 18415809 93.91% 19610332 reads passed initial QC criterion=sequence-density sequence-density=0.89 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=21 prefix-density=0.90 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=32.61 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=3.1 sequence=CACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGG criterion=sequence-density sequence-density=1.15 sequence-density-rank=1 fanout-score=2.10 fanout-score-rank=22 prefix-density=1.17 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=26.05 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=2.0 sequence=CCACCACTAAACCCAAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTCCTCCCCTTCGCTAGCCGGAAAGGCGGTGAAGCTCAACCCCTCCTCCTCTGAGATCATGGGCAATGGCCGTGTCTCCATGAGGAAAACCACCAAGCCTGTTCCCTCCGGGAGCCCATGGTACGGACCAGACCGTGTTAAATACTTGGGCCCGTTCTCTGGTGAGCCCCCATCCTACTTGACTGGTGAGTTCCCTGGTGACTACGGCTGGGACACTGCTGG SRR12671371 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 20:22:17 Started mapping on | Feb 11 20:22:18 Finished on | Feb 11 20:24:46 Mapping speed, Million of reads per hour | 477.01 Number of input reads | 19610332 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 17514953 Uniquely mapped reads % | 89.31% Average mapped length | 296.71 Number of splices: Total | 16887367 Number of splices: Annotated (sjdb) | 16552805 Number of splices: GT/AG | 16542333 Number of splices: GC/AG | 287614 Number of splices: AT/AC | 8693 Number of splices: Non-canonical | 48727 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.87 Insertion rate per base | 0.02% Insertion average length | 2.28 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 455110 % of reads mapped to multiple loci | 2.32% Number of reads mapped to too many loci | 29948 % of reads mapped to too many loci | 0.15% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 7.86% % of reads unmapped: other | 0.35% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1640269 1640269 1640269 N_multimapping 455110 455110 455110 N_noFeature 614527 17255190 706035 N_ambiguous 286292 1333 117281 UnstrandedReadsAssigned:16614134 PositiveStrandReadsAssigned:258430 NegativeStrandReadsAssigned:16691637 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671371 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671371-trimmed-pair1.fastq SRR12671371-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,610,332 reads, 16,819,304 reads pseudoaligned [quant] estimated average fragment length: 283.828 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,050 rounds 52401 SRR12671371.ke.tsv 34699 SRR12671371.se.tsv 87100 total ==> SRR12671371.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1735.17 439 14.2497 Potri.005G024800.1.v4.1 1035 752.172 367 27.4811 Potri.004G059700.1.v4.1 961 678.47 8 0.664116 Potri.007G009000.2.v4.1 1416 1133.17 0 0 Potri.003G141000.2.v4.1 2943 2660.17 735.769 15.5782 Potri.016G087400.1.v4.1 270 76.3211 666 491.49 Potri.015G069301.1.v4.1 564 299.875 0 0 Potri.010G195200.1.v4.1 1773 1490.17 82 3.09929 Potri.012G127500.1.v4.1 977 694.329 141 11.4377 ==> SRR12671371.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 367 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 225 Potri.001G212900.v4.1 5 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4 SRR12671371 completed mapping pipeline successfully