Starting /dee2/code/volunteer_pipeline.sh SRR12671372 current disk space = 3052889948160 free memory = 1509253528 SRR12671372 SRAfilesize feabc28684baa26efe6ac4f1ebcd9d1f SRR12671372.sra SRR12671372.sra file validated SRR12671372 is paired end SRR12671372 is conventional basespace SRR12671372 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671372_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5805 37.0 37.0 37.0 37.0 37.0 2 36.534 37.0 37.0 37.0 37.0 37.0 3 36.6095 37.0 37.0 37.0 37.0 37.0 4 36.719 37.0 37.0 37.0 37.0 37.0 5 36.6155 37.0 37.0 37.0 37.0 37.0 6 36.6845 37.0 37.0 37.0 37.0 37.0 7 36.677 37.0 37.0 37.0 37.0 37.0 8 36.6375 37.0 37.0 37.0 37.0 37.0 9 36.6195 37.0 37.0 37.0 37.0 37.0 10-14 36.647499999999994 37.0 37.0 37.0 37.0 37.0 15-19 36.6595 37.0 37.0 37.0 37.0 37.0 20-24 36.628400000000006 37.0 37.0 37.0 37.0 37.0 25-29 36.586800000000004 37.0 37.0 37.0 37.0 37.0 30-34 36.564499999999995 37.0 37.0 37.0 37.0 37.0 35-39 36.5629 37.0 37.0 37.0 37.0 37.0 40-44 36.5444 37.0 37.0 37.0 37.0 37.0 45-49 36.484 37.0 37.0 37.0 37.0 37.0 50-54 36.4735 37.0 37.0 37.0 37.0 37.0 55-59 36.473200000000006 37.0 37.0 37.0 37.0 37.0 60-64 36.4719 37.0 37.0 37.0 37.0 37.0 65-69 36.456399999999995 37.0 37.0 37.0 37.0 37.0 70-74 36.420100000000005 37.0 37.0 37.0 37.0 37.0 75-79 36.41830000000001 37.0 37.0 37.0 37.0 37.0 80-84 36.305699999999995 37.0 37.0 37.0 37.0 37.0 85-89 36.2904 37.0 37.0 37.0 37.0 37.0 90-94 36.3341 37.0 37.0 37.0 37.0 37.0 95-99 36.293899999999994 37.0 37.0 37.0 37.0 37.0 100-104 36.277499999999996 37.0 37.0 37.0 37.0 37.0 105-109 36.285000000000004 37.0 37.0 37.0 37.0 37.0 110-114 36.22839999999999 37.0 37.0 37.0 37.0 37.0 115-119 36.2257 37.0 37.0 37.0 37.0 37.0 120-124 36.180800000000005 37.0 37.0 37.0 37.0 37.0 125-129 36.233700000000006 37.0 37.0 37.0 37.0 37.0 130-134 36.1582 37.0 37.0 37.0 37.0 37.0 135-139 36.1176 37.0 37.0 37.0 37.0 37.0 140-144 36.0429 37.0 37.0 37.0 37.0 37.0 145-149 35.9931 37.0 37.0 37.0 37.0 37.0 150-151 35.92274999999999 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 1.0 21 0.0 22 0.0 23 1.0 24 2.0 25 3.0 26 3.0 27 5.0 28 7.0 29 12.0 30 28.0 31 25.0 32 43.0 33 51.0 34 80.0 35 239.0 36 3016.0 37 483.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 47.375 13.125 4.65 34.849999999999994 2 19.504256384576866 11.71757636454682 37.63144717075613 31.146720080120183 3 18.025 16.925 27.950000000000003 37.1 4 21.9 23.825 25.124999999999996 29.15 5 23.425 30.7 24.025 21.85 6 18.925 35.175 24.15 21.75 7 14.524999999999999 27.150000000000002 42.1 16.225 8 15.475 25.224999999999998 34.5 24.8 9 16.175 23.45 36.15 24.224999999999998 10-14 18.9 31.05 27.589999999999996 22.46 15-19 19.919999999999998 28.175 28.76 23.145 20-24 19.765 28.360000000000003 28.470000000000002 23.405 25-29 19.869999999999997 29.134999999999998 27.445000000000004 23.549999999999997 30-34 19.55 29.765000000000004 27.49 23.195 35-39 20.27 29.29 27.725 22.715 40-44 19.54 29.455 27.665 23.34 45-49 19.415 28.825 28.175 23.585 50-54 19.975 28.810000000000002 27.339999999999996 23.875 55-59 19.955000000000002 28.835 27.55 23.66 60-64 19.955000000000002 28.52 27.395000000000003 24.13 65-69 20.24 28.58 27.43 23.75 70-74 19.72 28.765 27.68 23.835 75-79 19.655 28.875 27.639999999999997 23.830000000000002 80-84 19.865 28.82 27.74 23.575 85-89 20.555 28.275 27.665 23.505000000000003 90-94 19.985 27.91 27.905 24.2 95-99 20.09 28.470000000000002 27.325 24.115000000000002 100-104 20.31 28.825 27.065 23.799999999999997 105-109 20.89 28.050000000000004 27.555000000000003 23.505000000000003 110-114 20.630000000000003 28.744999999999997 26.38 24.245 115-119 20.724999999999998 28.810000000000002 26.784999999999997 23.68 120-124 20.655 27.91 27.13 24.305 125-129 20.905 28.384999999999998 26.974999999999998 23.735 130-134 20.385 28.71 26.974999999999998 23.93 135-139 22.040000000000003 27.88 26.69 23.39 140-144 20.64 27.860000000000003 27.515 23.985 145-149 20.73 28.005000000000003 27.139999999999997 24.125 150-151 20.7 27.400000000000002 27.05 24.85 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 1.0 13 1.5 14 1.0 15 1.0 16 1.5 17 0.5 18 0.0 19 0.0 20 0.0 21 1.0 22 2.0 23 1.5 24 2.5 25 6.0 26 10.0 27 8.5 28 9.5 29 15.0 30 21.0 31 27.5 32 41.0 33 55.0 34 70.0 35 82.0 36 91.5 37 106.5 38 124.0 39 148.0 40 180.5 41 227.0 42 251.5 43 238.5 44 231.0 45 251.5 46 264.0 47 251.0 48 240.5 49 215.5 50 182.5 51 151.5 52 113.5 53 94.5 54 81.5 55 62.5 56 47.0 57 28.0 58 15.0 59 12.5 60 9.5 61 5.5 62 4.0 63 4.5 64 3.0 65 2.5 66 1.0 67 0.0 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.15 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 84.39999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 85.15995260663507 71.875 2 11.907582938388625 20.1 3 2.4289099526066353 6.15 4 0.38507109004739337 1.3 5 0.05924170616113744 0.25 6 0.02962085308056872 0.15 7 0.02962085308056872 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCATAAATCAATACCTAATGGGGTTGCTAAACCTTAACACAAATTTTCTA 7 0.17500000000000002 No Hit CATCATTAACACCATCTCCTGTCATTCCACAGATGTGCTTCCTCTCCTGT 6 0.15 No Hit GTCGCCACCAATGTCTGGAAAACCTCTCAACTTAGTAGTGGAAACCTTGT 5 0.125 No Hit ACCGAACTTGACACCATTCTTTGCAAGAATTTCAGGAAAGACACATCCAA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.2375 0.0 0.0 0.0 0.0 92-93 0.2625 0.0 0.0 0.0 0.0 94-95 0.275 0.0 0.0 0.0 0.0 96-97 0.2875 0.0 0.0 0.0 0.0 98-99 0.35 0.0 0.0 0.0 0.0 100-101 0.4 0.0 0.0 0.0 0.0 102-103 0.4625 0.0 0.0 0.0 0.0 104-105 0.6125 0.0 0.0 0.0 0.0 106-107 0.7125 0.0 0.0 0.0 0.0 108-109 0.8125 0.0 0.0 0.0 0.0 110-111 0.9375 0.0 0.0 0.0 0.0 112-113 1.1124999999999998 0.0 0.0 0.0 0.0 114-115 1.3125 0.0 0.0 0.0 0.0 116-117 1.5375 0.0 0.0 0.0 0.0 118-119 1.7625000000000002 0.0 0.0 0.0 0.0 120-121 1.9 0.0 0.0 0.0 0.0 122-123 2.075 0.0 0.0 0.0 0.0 124-125 2.2125 0.0 0.0 0.0 0.0 126-127 2.3375000000000004 0.0 0.0 0.0 0.0 128-129 2.4375 0.0 0.0 0.0 0.0 130-131 2.5625 0.0 0.0 0.0 0.0 132-133 2.6875 0.0 0.0 0.0 0.0 134-135 2.9375 0.0 0.0 0.0 0.0 136-137 3.0875 0.0 0.0 0.0 0.0 138-139 3.2625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCGGTTC 10 0.006830828 145.0 2 >>END_MODULE SRR12671372 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671372_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3805 37.0 37.0 37.0 37.0 37.0 2 36.1895 37.0 37.0 37.0 37.0 37.0 3 36.222 37.0 37.0 37.0 37.0 37.0 4 36.488 37.0 37.0 37.0 37.0 37.0 5 36.3525 37.0 37.0 37.0 37.0 37.0 6 36.38 37.0 37.0 37.0 37.0 37.0 7 36.1855 37.0 37.0 37.0 37.0 37.0 8 36.462 37.0 37.0 37.0 37.0 37.0 9 36.351 37.0 37.0 37.0 37.0 37.0 10-14 36.3883 37.0 37.0 37.0 37.0 37.0 15-19 36.353899999999996 37.0 37.0 37.0 37.0 37.0 20-24 36.3173 37.0 37.0 37.0 37.0 37.0 25-29 36.2746 37.0 37.0 37.0 37.0 37.0 30-34 36.2644 37.0 37.0 37.0 37.0 37.0 35-39 36.221799999999995 37.0 37.0 37.0 37.0 37.0 40-44 36.1956 37.0 37.0 37.0 37.0 37.0 45-49 36.1867 37.0 37.0 37.0 37.0 37.0 50-54 36.2041 37.0 37.0 37.0 37.0 37.0 55-59 36.1412 37.0 37.0 37.0 37.0 37.0 60-64 36.1534 37.0 37.0 37.0 37.0 37.0 65-69 36.1317 37.0 37.0 37.0 37.0 37.0 70-74 36.110600000000005 37.0 37.0 37.0 37.0 37.0 75-79 36.112100000000005 37.0 37.0 37.0 37.0 37.0 80-84 36.056200000000004 37.0 37.0 37.0 37.0 37.0 85-89 36.1184 37.0 37.0 37.0 37.0 37.0 90-94 36.0375 37.0 37.0 37.0 37.0 37.0 95-99 36.0413 37.0 37.0 37.0 37.0 37.0 100-104 35.954899999999995 37.0 37.0 37.0 37.0 37.0 105-109 35.9077 37.0 37.0 37.0 37.0 37.0 110-114 35.8899 37.0 37.0 37.0 37.0 37.0 115-119 35.998000000000005 37.0 37.0 37.0 37.0 37.0 120-124 35.9492 37.0 37.0 37.0 37.0 37.0 125-129 35.86370000000001 37.0 37.0 37.0 37.0 37.0 130-134 35.84839999999999 37.0 37.0 37.0 37.0 37.0 135-139 35.796099999999996 37.0 37.0 37.0 37.0 37.0 140-144 35.8048 37.0 37.0 37.0 37.0 37.0 145-149 35.7201 37.0 37.0 37.0 37.0 37.0 150-151 35.5145 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 2.0 14 5.0 15 3.0 16 1.0 17 1.0 18 1.0 19 0.0 20 3.0 21 4.0 22 5.0 23 2.0 24 5.0 25 8.0 26 6.0 27 4.0 28 11.0 29 14.0 30 18.0 31 29.0 32 25.0 33 72.0 34 141.0 35 436.0 36 2883.0 37 320.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.275 26.375 8.35 23.0 2 27.1 26.700000000000003 30.825000000000003 15.375 3 21.575 26.924999999999997 33.25 18.25 4 23.799999999999997 33.475 23.425 19.3 5 27.575 37.824999999999996 19.025 15.575 6 22.6 40.175 19.85 17.375 7 20.575 23.225 38.175 18.025 8 21.875 25.2 28.775000000000002 24.15 9 22.45 23.7 29.425 24.425 10-14 23.275000000000002 29.13 26.545 21.05 15-19 23.31 28.505000000000003 26.935 21.25 20-24 24.175 28.64 26.69 20.495 25-29 23.905 28.04 27.065 20.990000000000002 30-34 22.82 27.994999999999997 27.98 21.205 35-39 23.455000000000002 27.435 28.29 20.82 40-44 23.96 27.785 27.43 20.825 45-49 23.1 27.925 28.105000000000004 20.87 50-54 22.595000000000002 27.71 28.535 21.16 55-59 23.76 27.555000000000003 27.27 21.415 60-64 23.62 27.72 27.665 20.995 65-69 23.34 27.439999999999998 27.915 21.305 70-74 23.665 27.534999999999997 27.485 21.315 75-79 23.68 27.625 27.345000000000002 21.349999999999998 80-84 23.825 27.655 27.38 21.14 85-89 23.72 28.24 26.795 21.245 90-94 24.055 27.675 27.38 20.89 95-99 23.195 28.410000000000004 27.16 21.235 100-104 23.695 27.46 27.650000000000002 21.195 105-109 23.345 27.72 28.29 20.645 110-114 23.48 28.01 27.61 20.9 115-119 24.435000000000002 27.139999999999997 27.33 21.095 120-124 24.05 27.955000000000002 27.295 20.7 125-129 24.065 27.73 27.365000000000002 20.84 130-134 24.740000000000002 27.52 27.27 20.47 135-139 24.62 27.639999999999997 27.439999999999998 20.3 140-144 24.64 27.445000000000004 27.41 20.505000000000003 145-149 24.532453245324533 27.747774777477748 27.557755775577558 20.162016201620162 150-151 24.637500000000003 27.212500000000002 27.975 20.175 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.5 13 0.5 14 3.5 15 3.5 16 0.5 17 2.0 18 2.5 19 1.5 20 3.0 21 3.0 22 1.5 23 3.5 24 4.5 25 3.5 26 2.5 27 4.5 28 6.5 29 5.0 30 8.5 31 22.0 32 29.0 33 29.0 34 41.0 35 55.5 36 70.0 37 87.5 38 112.5 39 158.0 40 187.5 41 206.0 42 247.0 43 271.0 44 275.5 45 263.5 46 265.0 47 260.0 48 231.0 49 208.0 50 186.0 51 153.0 52 115.5 53 97.0 54 82.0 55 73.0 56 65.5 57 43.5 58 28.0 59 22.0 60 14.0 61 10.0 62 7.0 63 5.5 64 3.0 65 2.0 66 0.5 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 1.0 73 1.0 74 0.0 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.5 81 1.0 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.5 94 1.0 95 0.5 96 0.0 97 0.0 98 0.0 99 0.5 100 2.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.01 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 84.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 85.56609365737997 72.175 2 11.470065204505039 19.35 3 2.311796087729698 5.8500000000000005 4 0.4742145820983995 1.6 5 0.05927682276229994 0.25 6 0.02963841138114997 0.15 7 0.05927682276229994 0.35000000000000003 8 0.0 0.0 9 0.0 0.0 >10 0.02963841138114997 0.27499999999999997 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 11 0.27499999999999997 No Hit GGAGTTAATTCAATGTAATATTTTTTTAGAAACATTAAAATTAATGAAAA 7 0.17500000000000002 No Hit ATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAAT 7 0.17500000000000002 No Hit GACAGTGCTGAAACCATCAGAAGAGCTCTCCACCTTGGTGTTAATGTTAA 6 0.15 No Hit CAGTCACACTTAACTCCTCCTAGCTTTCTCTAGCTCAGCAACAAATGGAG 5 0.125 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.2375 0.0 0.0 0.0 0.0 92-93 0.2625 0.0 0.0 0.0 0.0 94-95 0.275 0.0 0.0 0.0 0.0 96-97 0.2875 0.0 0.0 0.0 0.0 98-99 0.35 0.0 0.0 0.0 0.0 100-101 0.4 0.0 0.0 0.0 0.0 102-103 0.4625 0.0 0.0 0.0 0.0 104-105 0.6125 0.0 0.0 0.0 0.0 106-107 0.7125 0.0 0.0 0.0 0.0 108-109 0.8125 0.0 0.0 0.0 0.0 110-111 0.9375 0.0 0.0 0.0 0.0 112-113 1.1124999999999998 0.0 0.0 0.0 0.0 114-115 1.3125 0.0 0.0 0.0 0.0 116-117 1.5375 0.0 0.0 0.0 0.0 118-119 1.7625000000000002 0.0 0.0 0.0 0.0 120-121 1.9249999999999998 0.0 0.0 0.0 0.0 122-123 2.1 0.0 0.0 0.0 0.0 124-125 2.2625 0.0 0.0 0.0 0.0 126-127 2.3875 0.0 0.0 0.0 0.0 128-129 2.4875 0.0 0.0 0.0 0.0 130-131 2.6125 0.0 0.0 0.0 0.0 132-133 2.7375 0.0 0.0 0.0 0.0 134-135 2.9875 0.0 0.0 0.0 0.0 136-137 3.1375 0.0 0.0 0.0 0.0 138-139 3.3125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 788259 spots for SRR12671372.sra Written 788259 spots for SRR12671372.sra Read 788259 spots for SRR12671372.sra Written 788259 spots for SRR12671372.sra Read 788259 spots for SRR12671372.sra Written 788259 spots for SRR12671372.sra Read 788259 spots for SRR12671372.sra Written 788259 spots for SRR12671372.sra Read 788259 spots for SRR12671372.sra Written 788259 spots for SRR12671372.sra Read 788259 spots for SRR12671372.sra Written 788259 spots for SRR12671372.sra Read 788259 spots for SRR12671372.sra Written 788259 spots for SRR12671372.sra Read 788259 spots for SRR12671372.sra Written 788259 spots for SRR12671372.sra Read 788259 spots for SRR12671372.sra Written 788259 spots for SRR12671372.sra Read 788259 spots for SRR12671372.sra Written 788259 spots for SRR12671372.sra Read 788259 spots for SRR12671372.sra Written 788259 spots for SRR12671372.sra Read 788259 spots for SRR12671372.sra Written 788259 spots for SRR12671372.sra Read 788259 spots for SRR12671372.sra Written 788259 spots for SRR12671372.sra Read 788259 spots for SRR12671372.sra Written 788259 spots for SRR12671372.sra Read 788259 spots for SRR12671372.sra Written 788259 spots for SRR12671372.sra Read 788259 spots for SRR12671372.sra Written 788259 spots for SRR12671372.sra Read 788261 spots for SRR12671372.sra Written 788261 spots for SRR12671372.sra Read 788259 spots for SRR12671372.sra Written 788259 spots for SRR12671372.sra Read 788259 spots for SRR12671372.sra Written 788259 spots for SRR12671372.sra Read 788259 spots for SRR12671372.sra Written 788259 spots for SRR12671372.sra SRR ids: ['SRR12671372.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_d_oq1hmr SRR12671372.sra spots: 15765182 blocks: [[1, 788259], [788260, 1576518], [1576519, 2364777], [2364778, 3153036], [3153037, 3941295], [3941296, 4729554], [4729555, 5517813], [5517814, 6306072], [6306073, 7094331], [7094332, 7882590], [7882591, 8670849], [8670850, 9459108], [9459109, 10247367], [10247368, 11035626], [11035627, 11823885], [11823886, 12612144], [12612145, 13400403], [13400404, 14188662], [14188663, 14976921], [14976922, 15765182]] SRR12671372 file size 5335998 SRR12671372 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671372 SRR12671372_1.fastq SRR12671372_2.fastq Input file: SRR12671372_1.fastq Paired file: SRR12671372_2.fastq trimmed: SRR12671372-trimmed-pair1.fastq, SRR12671372-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 20:42:18 2025 >> started Tue Feb 11 20:42:36 2025 >> done (18.730s) 15765182 read pairs processed; of these: 48 ( 0.00%) short read pairs filtered out after trimming by size control 8655 ( 0.05%) empty read pairs filtered out after trimming by size control 15756479 (99.94%) read pairs available; of these: 728650 ( 4.62%) trimmed read pairs available after processing 15027829 (95.38%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 6 0.00% 20 4 0.00% 21 8 0.00% 22 8 0.00% 23 9 0.00% 24 13 0.00% 25 15 0.00% 26 14 0.00% 27 14 0.00% 28 22 0.00% 29 13 0.00% 30 14 0.00% 31 20 0.00% 32 17 0.00% 33 11 0.00% 34 12 0.00% 35 21 0.00% 36 31 0.00% 37 40 0.00% 38 19 0.00% 39 24 0.00% 40 30 0.00% 41 23 0.00% 42 31 0.00% 43 31 0.00% 44 18 0.00% 45 24 0.00% 46 38 0.00% 47 34 0.00% 48 50 0.00% 49 53 0.00% 50 59 0.00% 51 76 0.00% 52 72 0.00% 53 85 0.00% 54 59 0.00% 55 85 0.00% 56 102 0.00% 57 114 0.00% 58 135 0.00% 59 125 0.00% 60 158 0.00% 61 177 0.00% 62 233 0.00% 63 225 0.00% 64 269 0.00% 65 271 0.00% 66 315 0.00% 67 334 0.00% 68 420 0.00% 69 453 0.00% 70 557 0.00% 71 636 0.00% 72 790 0.01% 73 809 0.01% 74 901 0.01% 75 981 0.01% 76 970 0.01% 77 1162 0.01% 78 1182 0.01% 79 1286 0.01% 80 1435 0.01% 81 1655 0.01% 82 1773 0.01% 83 1848 0.01% 84 2155 0.01% 85 2384 0.02% 86 2559 0.02% 87 2577 0.02% 88 2655 0.02% 89 2707 0.02% 90 3116 0.02% 91 3261 0.02% 92 3382 0.02% 93 3615 0.02% 94 3865 0.02% 95 4159 0.03% 96 4426 0.03% 97 4583 0.03% 98 4657 0.03% 99 4823 0.03% 100 5133 0.03% 101 5046 0.03% 102 5469 0.03% 103 5706 0.04% 104 6036 0.04% 105 6316 0.04% 106 6433 0.04% 107 6802 0.04% 108 6885 0.04% 109 7055 0.04% 110 7375 0.05% 111 7607 0.05% 112 7681 0.05% 113 8158 0.05% 114 8299 0.05% 115 8867 0.06% 116 9190 0.06% 117 9489 0.06% 118 9667 0.06% 119 9932 0.06% 120 10578 0.07% 121 10833 0.07% 122 10844 0.07% 123 11182 0.07% 124 11746 0.07% 125 12002 0.08% 126 12515 0.08% 127 12887 0.08% 128 13170 0.08% 129 13798 0.09% 130 14178 0.09% 131 14304 0.09% 132 14439 0.09% 133 14936 0.09% 134 15519 0.10% 135 15737 0.10% 136 16323 0.10% 137 16839 0.11% 138 17448 0.11% 139 18155 0.12% 140 18393 0.12% 141 18780 0.12% 142 19210 0.12% 143 19530 0.12% 144 20118 0.13% 145 20768 0.13% 146 21281 0.14% 147 21687 0.14% 148 22518 0.14% 149 22758 0.14% 150 23680 0.15% 151 15027829 95.38% 15756479 reads passed initial QC criterion=sequence-density sequence-density=0.80 sequence-density-rank=1 fanout-score=2.07 fanout-score-rank=18 prefix-density=0.82 prefix-fanout=2.0 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=286.03 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=10.8 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTC criterion=sequence-density sequence-density=0.72 sequence-density-rank=1 fanout-score=2.25 fanout-score-rank=16 prefix-density=0.75 prefix-fanout=2.2 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=25 fanout-score=12.82 fanout-score-rank=1 prefix-density=0.03 prefix-fanout=3.9 sequence=ACTAAACCCAAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTC SRR12671372 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 20:43:26 Started mapping on | Feb 11 20:43:27 Finished on | Feb 11 20:45:05 Mapping speed, Million of reads per hour | 578.81 Number of input reads | 15756479 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 14846490 Uniquely mapped reads % | 94.22% Average mapped length | 298.42 Number of splices: Total | 14950927 Number of splices: Annotated (sjdb) | 14696898 Number of splices: GT/AG | 14625424 Number of splices: GC/AG | 280136 Number of splices: AT/AC | 8787 Number of splices: Non-canonical | 36580 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.93 Insertion rate per base | 0.02% Insertion average length | 2.10 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 344582 % of reads mapped to multiple loci | 2.19% Number of reads mapped to too many loci | 32385 % of reads mapped to too many loci | 0.21% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.29% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 565407 565407 565407 N_multimapping 344582 344582 344582 N_noFeature 415633 14561013 492547 N_ambiguous 310849 1062 101660 UnstrandedReadsAssigned:14120008 PositiveStrandReadsAssigned:284415 NegativeStrandReadsAssigned:14252283 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671372 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671372-trimmed-pair1.fastq SRR12671372-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,756,479 reads, 14,186,063 reads pseudoaligned [quant] estimated average fragment length: 288.449 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,317 rounds 52401 SRR12671372.ke.tsv 34699 SRR12671372.se.tsv 87100 total ==> SRR12671372.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1730.55 504 15.7866 Potri.005G024800.1.v4.1 1035 747.551 230 16.6775 Potri.004G059700.1.v4.1 961 673.679 5 0.40231 Potri.007G009000.2.v4.1 1416 1128.55 0 0 Potri.003G141000.2.v4.1 2943 2655.55 749 15.2887 Potri.016G087400.1.v4.1 270 69.3151 642.091 502.125 Potri.015G069301.1.v4.1 564 290.24 0 0 Potri.010G195200.1.v4.1 1773 1485.55 80 2.91908 Potri.012G127500.1.v4.1 977 689.626 163 12.812 ==> SRR12671372.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 132 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 331 Potri.001G212900.v4.1 40 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR12671372 completed mapping pipeline successfully