Starting /dee2/code/volunteer_pipeline.sh SRR12671373 current disk space = 3053069037568 free memory = 1467989048 SRR12671373 SRAfilesize ada6b9c6a2103bb89299b57f963af1f1 SRR12671373.sra SRR12671373.sra file validated SRR12671373 is paired end SRR12671373 is conventional basespace SRR12671373 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671373_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.633 37.0 37.0 37.0 37.0 37.0 2 36.51275 37.0 37.0 37.0 37.0 37.0 3 36.6455 37.0 37.0 37.0 37.0 37.0 4 36.6495 37.0 37.0 37.0 37.0 37.0 5 36.6385 37.0 37.0 37.0 37.0 37.0 6 36.6275 37.0 37.0 37.0 37.0 37.0 7 36.6095 37.0 37.0 37.0 37.0 37.0 8 36.5815 37.0 37.0 37.0 37.0 37.0 9 36.6885 37.0 37.0 37.0 37.0 37.0 10-14 36.6654 37.0 37.0 37.0 37.0 37.0 15-19 36.6661 37.0 37.0 37.0 37.0 37.0 20-24 36.659000000000006 37.0 37.0 37.0 37.0 37.0 25-29 36.612700000000004 37.0 37.0 37.0 37.0 37.0 30-34 36.569900000000004 37.0 37.0 37.0 37.0 37.0 35-39 36.569399999999995 37.0 37.0 37.0 37.0 37.0 40-44 36.5399 37.0 37.0 37.0 37.0 37.0 45-49 36.466300000000004 37.0 37.0 37.0 37.0 37.0 50-54 36.5153 37.0 37.0 37.0 37.0 37.0 55-59 36.4683 37.0 37.0 37.0 37.0 37.0 60-64 36.4766 37.0 37.0 37.0 37.0 37.0 65-69 36.43300000000001 37.0 37.0 37.0 37.0 37.0 70-74 36.3959 37.0 37.0 37.0 37.0 37.0 75-79 36.4028 37.0 37.0 37.0 37.0 37.0 80-84 36.3821 37.0 37.0 37.0 37.0 37.0 85-89 36.3587 37.0 37.0 37.0 37.0 37.0 90-94 36.3159 37.0 37.0 37.0 37.0 37.0 95-99 36.2788 37.0 37.0 37.0 37.0 37.0 100-104 36.279700000000005 37.0 37.0 37.0 37.0 37.0 105-109 36.2711 37.0 37.0 37.0 37.0 37.0 110-114 36.197900000000004 37.0 37.0 37.0 37.0 37.0 115-119 36.2173 37.0 37.0 37.0 37.0 37.0 120-124 36.1688 37.0 37.0 37.0 37.0 37.0 125-129 36.16949999999999 37.0 37.0 37.0 37.0 37.0 130-134 36.1453 37.0 37.0 37.0 37.0 37.0 135-139 36.0361 37.0 37.0 37.0 37.0 37.0 140-144 36.0171 37.0 37.0 37.0 37.0 37.0 145-149 36.0332 37.0 37.0 37.0 37.0 37.0 150-151 35.937 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 0.0 22 1.0 23 1.0 24 1.0 25 1.0 26 1.0 27 7.0 28 9.0 29 15.0 30 20.0 31 23.0 32 45.0 33 53.0 34 92.0 35 262.0 36 2961.0 37 507.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.325 11.825 5.6000000000000005 36.25 2 19.39924906132666 13.867334167709636 36.470588235294116 30.262828535669588 3 17.05 20.125 26.674999999999997 36.15 4 21.775 26.724999999999998 24.175 27.325 5 24.625 32.425 23.35 19.6 6 19.275000000000002 35.4 23.35 21.975 7 14.725 26.700000000000003 42.6 15.975 8 16.85 23.1 34.775 25.275 9 18.25 23.875 33.7 24.175 10-14 19.2 30.0 27.455000000000002 23.345 15-19 20.14 28.37 27.88 23.61 20-24 19.545 28.48 27.905 24.07 25-29 19.82 27.92 28.375 23.885 30-34 20.335 28.595 26.745 24.325 35-39 19.64 28.355000000000004 28.355000000000004 23.65 40-44 19.495 28.88 27.694999999999997 23.93 45-49 20.095 28.389999999999997 27.560000000000002 23.955000000000002 50-54 20.06 29.4 27.089999999999996 23.45 55-59 20.0 28.125 28.185 23.69 60-64 19.67 29.175 27.250000000000004 23.905 65-69 19.735 29.104999999999997 27.485 23.674999999999997 70-74 20.03 29.09 27.08 23.799999999999997 75-79 19.88 28.54 27.400000000000002 24.18 80-84 19.395 28.27 27.985 24.349999999999998 85-89 19.525000000000002 29.145 27.595 23.735 90-94 20.535 28.499999999999996 27.37 23.595 95-99 19.71 28.375 27.74 24.175 100-104 20.49 29.15 27.089999999999996 23.27 105-109 20.369999999999997 28.044999999999998 27.92 23.665 110-114 20.195 27.99 27.73 24.085 115-119 20.064999999999998 28.275 27.889999999999997 23.77 120-124 20.315 28.23 27.515 23.94 125-129 19.75 28.51 27.644999999999996 24.095 130-134 20.669999999999998 28.42 27.54 23.369999999999997 135-139 20.65 28.255000000000003 27.525 23.57 140-144 20.195 27.825 28.37 23.61 145-149 21.375 28.16 27.034999999999997 23.43 150-151 20.9875 27.6125 27.3 24.099999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 1.0 20 1.0 21 1.0 22 2.5 23 5.5 24 4.0 25 2.0 26 4.0 27 7.5 28 7.5 29 14.5 30 22.0 31 23.5 32 35.0 33 45.5 34 59.0 35 71.0 36 83.5 37 112.5 38 138.0 39 163.0 40 189.0 41 202.5 42 228.5 43 259.0 44 260.0 45 248.5 46 263.5 47 272.0 48 233.0 49 192.0 50 167.5 51 157.5 52 136.5 53 87.5 54 63.5 55 59.0 56 45.0 57 31.0 58 26.5 59 25.0 60 18.0 61 11.0 62 6.5 63 4.0 64 2.0 65 1.5 66 2.0 67 1.0 68 0.5 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.125 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 82.875 #Duplication Level Percentage of deduplicated Percentage of total 1 83.92156862745098 69.55 2 12.609351432880844 20.9 3 2.6244343891402715 6.525 4 0.603318250377074 2.0 5 0.21116138763197587 0.8750000000000001 6 0.030165912518853696 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCAGCGGATCGCTCTCATTTACAAGTGCAAGGATCGCAGGTACAGTTGGC 6 0.15 No Hit GCTTCTTGCTGAGACCAAAAGGATCGTAACCATAGTCTCCAGGGACTTCT 5 0.125 No Hit GGCAAATATAGCGTATTTGCTGCTAATTCCAAAGTCATGGAGGAAAGAAG 5 0.125 No Hit ACGATATTACAGTCAGGTAAGAAGACATGCATCCATAAAACTCTCTGATT 5 0.125 No Hit GTTCCTCCTTTCCCAGAGTCTTGATCTTCTGCTTTGAAAACCTTTTCAAA 5 0.125 No Hit GGGAGGGGGTCCAGAATTCACCCTCAATGGCCTCCCATCAAGTTCATAGC 5 0.125 No Hit CTCCAAATAAAAATGACCCTGCGGCTTCTGGACAACAAAGTTAGGGCTCA 5 0.125 No Hit GTGAGAGGGGAGGATGAGGAGGTGGGAGTGAGGGTGGGGAGAAAAGAAGA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0125 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.1875 0.0 0.0 0.0 0.0 92-93 0.2 0.0 0.0 0.0 0.0 94-95 0.2 0.0 0.0 0.0 0.0 96-97 0.275 0.0 0.0 0.0 0.0 98-99 0.3 0.0 0.0 0.0 0.0 100-101 0.375 0.0 0.0 0.0 0.0 102-103 0.475 0.0 0.0 0.0 0.0 104-105 0.5 0.0 0.0 0.0 0.0 106-107 0.55 0.0 0.0 0.0 0.0 108-109 0.6 0.0 0.0 0.0 0.0 110-111 0.675 0.0 0.0 0.0 0.0 112-113 0.7375 0.0 0.0 0.0 0.0 114-115 0.825 0.0 0.0 0.0 0.0 116-117 0.875 0.0 0.0 0.0 0.0 118-119 0.975 0.0 0.0 0.0 0.0 120-121 1.0 0.0 0.0 0.0 0.0 122-123 1.225 0.0 0.0 0.0 0.0 124-125 1.3250000000000002 0.0 0.0 0.0 0.0 126-127 1.4375 0.0 0.0 0.0 0.0 128-129 1.5 0.0 0.0 0.0 0.0 130-131 1.525 0.0 0.0 0.0 0.0 132-133 1.825 0.0 0.0 0.0 0.0 134-135 1.9249999999999998 0.0 0.0 0.0 0.0 136-137 2.0875 0.0 0.0 0.0 0.0 138-139 2.175 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATATGGT 10 0.006830828 145.0 145 >>END_MODULE SRR12671373 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671373_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.28 37.0 37.0 37.0 37.0 37.0 2 36.125 37.0 37.0 37.0 37.0 37.0 3 36.1905 37.0 37.0 37.0 37.0 37.0 4 36.166 37.0 37.0 37.0 37.0 37.0 5 36.318 37.0 37.0 37.0 37.0 37.0 6 36.2505 37.0 37.0 37.0 37.0 37.0 7 36.1975 37.0 37.0 37.0 37.0 37.0 8 36.327 37.0 37.0 37.0 37.0 37.0 9 36.33 37.0 37.0 37.0 37.0 37.0 10-14 36.2718 37.0 37.0 37.0 37.0 37.0 15-19 36.321299999999994 37.0 37.0 37.0 37.0 37.0 20-24 36.2669 37.0 37.0 37.0 37.0 37.0 25-29 36.1674 37.0 37.0 37.0 37.0 37.0 30-34 36.16709999999999 37.0 37.0 37.0 37.0 37.0 35-39 36.1926 37.0 37.0 37.0 37.0 37.0 40-44 36.129200000000004 37.0 37.0 37.0 37.0 37.0 45-49 36.079 37.0 37.0 37.0 37.0 37.0 50-54 36.0486 37.0 37.0 37.0 37.0 37.0 55-59 36.0299 37.0 37.0 37.0 37.0 37.0 60-64 36.004 37.0 37.0 37.0 37.0 37.0 65-69 36.0012 37.0 37.0 37.0 37.0 37.0 70-74 35.927800000000005 37.0 37.0 37.0 37.0 37.0 75-79 35.946 37.0 37.0 37.0 37.0 37.0 80-84 35.910999999999994 37.0 37.0 37.0 37.0 37.0 85-89 35.988 37.0 37.0 37.0 37.0 37.0 90-94 35.8834 37.0 37.0 37.0 37.0 37.0 95-99 35.8507 37.0 37.0 37.0 37.0 37.0 100-104 35.8575 37.0 37.0 37.0 37.0 37.0 105-109 35.7648 37.0 37.0 37.0 37.0 37.0 110-114 35.71810000000001 37.0 37.0 37.0 37.0 37.0 115-119 35.8331 37.0 37.0 37.0 37.0 37.0 120-124 35.791799999999995 37.0 37.0 37.0 37.0 37.0 125-129 35.73180000000001 37.0 37.0 37.0 37.0 37.0 130-134 35.66930000000001 37.0 37.0 37.0 37.0 37.0 135-139 35.5907 37.0 37.0 37.0 37.0 37.0 140-144 35.6024 37.0 37.0 37.0 37.0 37.0 145-149 35.5746 37.0 37.0 37.0 37.0 37.0 150-151 35.43575 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 3.0 13 0.0 14 4.0 15 2.0 16 1.0 17 0.0 18 4.0 19 4.0 20 1.0 21 5.0 22 8.0 23 4.0 24 3.0 25 7.0 26 6.0 27 8.0 28 7.0 29 11.0 30 15.0 31 36.0 32 48.0 33 96.0 34 175.0 35 536.0 36 2766.0 37 250.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.125 24.25 8.6 24.025 2 28.325 24.9 30.975 15.8 3 20.275000000000002 27.575 32.85 19.3 4 25.25 35.25 22.05 17.45 5 23.375 38.6 21.425 16.6 6 19.400000000000002 39.775 21.775 19.05 7 19.975 20.474999999999998 40.025 19.525000000000002 8 18.975 25.15 31.25 24.625 9 22.325 23.875 29.599999999999998 24.2 10-14 22.13 29.875 26.68 21.315 15-19 23.169999999999998 27.705000000000002 28.084999999999997 21.04 20-24 22.509999999999998 28.26 28.305000000000003 20.925 25-29 22.46 28.235 28.470000000000002 20.835 30-34 22.405 28.04 27.875 21.68 35-39 22.720000000000002 27.85 27.85 21.58 40-44 22.99 28.449999999999996 27.805000000000003 20.755000000000003 45-49 22.08 28.77 28.065 21.085 50-54 22.125 28.215 28.535 21.125 55-59 22.845 28.77 27.42 20.965 60-64 22.295 29.07 26.895000000000003 21.740000000000002 65-69 22.81 27.88 27.935 21.375 70-74 23.215 27.065 28.29 21.43 75-79 23.1 27.639999999999997 27.845 21.415 80-84 22.59 28.360000000000003 27.189999999999998 21.86 85-89 23.055 28.375 27.29 21.279999999999998 90-94 23.595 27.915 27.279999999999998 21.21 95-99 23.315 27.825 27.82 21.04 100-104 22.795 27.97 27.750000000000004 21.485000000000003 105-109 23.355 28.165000000000003 27.195000000000004 21.285 110-114 23.125 29.154999999999998 27.24 20.48 115-119 23.43 27.66 27.584999999999997 21.325 120-124 23.265 28.505000000000003 27.605 20.625 125-129 23.830000000000002 28.04 28.025 20.105 130-134 23.96 27.474999999999998 28.125 20.44 135-139 23.549999999999997 27.68 27.615000000000002 21.154999999999998 140-144 23.96 28.255000000000003 27.495000000000005 20.29 145-149 24.605 28.03 27.150000000000002 20.215 150-151 23.95 28.825 27.35 19.875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.5 10 1.0 11 0.5 12 0.0 13 0.0 14 1.5 15 1.5 16 0.5 17 2.5 18 2.5 19 2.0 20 3.0 21 2.5 22 1.0 23 1.0 24 3.5 25 5.0 26 6.0 27 10.0 28 12.0 29 14.0 30 19.5 31 25.5 32 29.5 33 35.0 34 44.0 35 69.0 36 95.5 37 110.5 38 137.5 39 165.0 40 195.0 41 220.5 42 245.5 43 254.5 44 249.0 45 259.5 46 260.5 47 258.5 48 239.5 49 190.5 50 157.5 51 148.0 52 124.5 53 79.5 54 64.0 55 64.5 56 49.5 57 38.5 58 26.0 59 22.5 60 18.5 61 7.5 62 3.5 63 3.5 64 2.5 65 1.5 66 1.5 67 1.5 68 1.0 69 0.0 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 1.5 88 1.5 89 0.0 90 0.0 91 0.5 92 0.5 93 0.0 94 0.5 95 0.5 96 1.0 97 1.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 82.975 #Duplication Level Percentage of deduplicated Percentage of total 1 84.5134076529075 70.125 2 11.871045495631215 19.7 3 2.6514010244049415 6.6000000000000005 4 0.7231093702922567 2.4 5 0.21090689966857487 0.8750000000000001 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.030129557095510694 0.3 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 12 0.3 No Hit AGTAGGGGCACGCAGACACAAAAACACAGAAAGAAGAAGAAGAAGAAGAA 5 0.125 No Hit GGTCTAGCAAACACTAGCTTGGCTTATTTTGGCAACCGACTGTACGCACT 5 0.125 No Hit AGAAAACTCTCTCCTCTGTCACTCTCTAATCCGCCACTCCTTATGGCTAT 5 0.125 No Hit ATCCACATCAACACTCTCCCTCGCAGCCTCAGCACAGTTCTTCTCTTCTT 5 0.125 No Hit GAGGGAAGCTATTTCGGTGAATGGGAACTTCTTGGTGAACATTTTGATTC 5 0.125 No Hit AGGAAACCATGTCTGCAACATCTGCCTCTTCGCTAGTCCTACCATCGCTT 5 0.125 No Hit CAGGAGCCCCAACAATTGGTTGCTGAGATGTGATTGCCTTTTATCTAGCT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.16249999999999998 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.2375 0.0 0.0 0.0 0.0 98-99 0.25 0.0 0.0 0.0 0.0 100-101 0.325 0.0 0.0 0.0 0.0 102-103 0.425 0.0 0.0 0.0 0.0 104-105 0.45 0.0 0.0 0.0 0.0 106-107 0.5 0.0 0.0 0.0 0.0 108-109 0.575 0.0 0.0 0.0 0.0 110-111 0.65 0.0 0.0 0.0 0.0 112-113 0.7125 0.0 0.0 0.0 0.0 114-115 0.8 0.0 0.0 0.0 0.0 116-117 0.85 0.0 0.0 0.0 0.0 118-119 0.95 0.0 0.0 0.0 0.0 120-121 0.975 0.0 0.0 0.0 0.0 122-123 1.2000000000000002 0.0 0.0 0.0 0.0 124-125 1.2999999999999998 0.0 0.0 0.0 0.0 126-127 1.4125 0.0 0.0 0.0 0.0 128-129 1.475 0.0 0.0 0.0 0.0 130-131 1.5 0.0 0.0 0.0 0.0 132-133 1.8 0.0 0.0 0.0 0.0 134-135 1.9 0.0 0.0 0.0 0.0 136-137 2.0625 0.0 0.0 0.0 0.0 138-139 2.15 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGGGGGG 30 0.0014437955 24.166668 140-144 >>END_MODULE Read 722304 spots for SRR12671373.sra Written 722304 spots for SRR12671373.sra Read 722304 spots for SRR12671373.sra Written 722304 spots for SRR12671373.sra Read 722304 spots for SRR12671373.sra Written 722304 spots for SRR12671373.sra Read 722304 spots for SRR12671373.sra Written 722304 spots for SRR12671373.sra Read 722304 spots for SRR12671373.sra Written 722304 spots for SRR12671373.sra Read 722304 spots for SRR12671373.sra Written 722304 spots for SRR12671373.sra Read 722304 spots for SRR12671373.sra Written 722304 spots for SRR12671373.sra Read 722304 spots for SRR12671373.sra Written 722304 spots for SRR12671373.sra Read 722304 spots for SRR12671373.sra Written 722304 spots for SRR12671373.sra Read 722304 spots for SRR12671373.sra Written 722304 spots for SRR12671373.sra Read 722304 spots for SRR12671373.sra Written 722304 spots for SRR12671373.sra Read 722304 spots for SRR12671373.sra Written 722304 spots for SRR12671373.sra Read 722304 spots for SRR12671373.sra Written 722304 spots for SRR12671373.sra Read 722304 spots for SRR12671373.sra Written 722304 spots for SRR12671373.sra Read 722312 spots for SRR12671373.sra Written 722312 spots for SRR12671373.sra Read 722304 spots for SRR12671373.sra Written 722304 spots for SRR12671373.sra Read 722304 spots for SRR12671373.sra Written 722304 spots for SRR12671373.sra Read 722304 spots for SRR12671373.sra Written 722304 spots for SRR12671373.sra Read 722304 spots for SRR12671373.sra Written 722304 spots for SRR12671373.sra Read 722304 spots for SRR12671373.sra Written 722304 spots for SRR12671373.sra SRR ids: ['SRR12671373.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_zd72duwg SRR12671373.sra spots: 14446088 blocks: [[1, 722304], [722305, 1444608], [1444609, 2166912], [2166913, 2889216], [2889217, 3611520], [3611521, 4333824], [4333825, 5056128], [5056129, 5778432], [5778433, 6500736], [6500737, 7223040], [7223041, 7945344], [7945345, 8667648], [8667649, 9389952], [9389953, 10112256], [10112257, 10834560], [10834561, 11556864], [11556865, 12279168], [12279169, 13001472], [13001473, 13723776], [13723777, 14446088]] SRR12671373 file size 4887712 SRR12671373 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671373 SRR12671373_1.fastq SRR12671373_2.fastq Input file: SRR12671373_1.fastq Paired file: SRR12671373_2.fastq trimmed: SRR12671373-trimmed-pair1.fastq, SRR12671373-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 20:22:40 2025 >> started Tue Feb 11 20:22:57 2025 >> done (16.602s) 14446088 read pairs processed; of these: 31 ( 0.00%) short read pairs filtered out after trimming by size control 1285 ( 0.01%) empty read pairs filtered out after trimming by size control 14444772 (99.99%) read pairs available; of these: 540089 ( 3.74%) trimmed read pairs available after processing 13904683 (96.26%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 2 0.00% 20 3 0.00% 21 1 0.00% 22 6 0.00% 23 6 0.00% 24 7 0.00% 25 6 0.00% 26 3 0.00% 27 6 0.00% 28 9 0.00% 29 11 0.00% 30 10 0.00% 31 15 0.00% 32 9 0.00% 33 18 0.00% 34 7 0.00% 35 10 0.00% 36 13 0.00% 37 7 0.00% 38 9 0.00% 39 20 0.00% 40 20 0.00% 41 19 0.00% 42 17 0.00% 43 20 0.00% 44 20 0.00% 45 24 0.00% 46 18 0.00% 47 24 0.00% 48 18 0.00% 49 30 0.00% 50 30 0.00% 51 36 0.00% 52 44 0.00% 53 39 0.00% 54 26 0.00% 55 63 0.00% 56 55 0.00% 57 62 0.00% 58 54 0.00% 59 82 0.00% 60 92 0.00% 61 107 0.00% 62 117 0.00% 63 130 0.00% 64 127 0.00% 65 160 0.00% 66 174 0.00% 67 196 0.00% 68 200 0.00% 69 260 0.00% 70 277 0.00% 71 311 0.00% 72 365 0.00% 73 395 0.00% 74 430 0.00% 75 546 0.00% 76 555 0.00% 77 630 0.00% 78 687 0.00% 79 695 0.00% 80 807 0.01% 81 946 0.01% 82 988 0.01% 83 1118 0.01% 84 1277 0.01% 85 1311 0.01% 86 1494 0.01% 87 1552 0.01% 88 1712 0.01% 89 1749 0.01% 90 1899 0.01% 91 2031 0.01% 92 2104 0.01% 93 2369 0.02% 94 2511 0.02% 95 2770 0.02% 96 2924 0.02% 97 3203 0.02% 98 3085 0.02% 99 3249 0.02% 100 3553 0.02% 101 3574 0.02% 102 3804 0.03% 103 3934 0.03% 104 4126 0.03% 105 4509 0.03% 106 4677 0.03% 107 4754 0.03% 108 5093 0.04% 109 5175 0.04% 110 5101 0.04% 111 5379 0.04% 112 5829 0.04% 113 5861 0.04% 114 6128 0.04% 115 6356 0.04% 116 6688 0.05% 117 7137 0.05% 118 7168 0.05% 119 7499 0.05% 120 7764 0.05% 121 8114 0.06% 122 7928 0.05% 123 8514 0.06% 124 8756 0.06% 125 9043 0.06% 126 9315 0.06% 127 9703 0.07% 128 10096 0.07% 129 10359 0.07% 130 10712 0.07% 131 10975 0.08% 132 11340 0.08% 133 11484 0.08% 134 11667 0.08% 135 12128 0.08% 136 12508 0.09% 137 12852 0.09% 138 13435 0.09% 139 13949 0.10% 140 14148 0.10% 141 14411 0.10% 142 14658 0.10% 143 14857 0.10% 144 15680 0.11% 145 15884 0.11% 146 16474 0.11% 147 16772 0.12% 148 17611 0.12% 149 17728 0.12% 150 18444 0.13% 151 13904683 96.26% 14444772 reads passed initial QC criterion=sequence-density sequence-density=0.50 sequence-density-rank=1 fanout-score=1.96 fanout-score-rank=30 prefix-density=0.50 prefix-fanout=1.9 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTTCGAGCGAAGAAGGTAATCAATTTCCTTGGCCAATTCCTCCTCTGTGAGATCTGGAAGGTAAGAAAGAGTCTCGAACTTCTTCAATCCAGTTGGTGGCCACACCTGCATGCATTGAACTCGTCCACCATTGCTTGCAATGGAAGTAATGTCATT criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=16.50 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=2.6 sequence=GACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCT criterion=sequence-density sequence-density=0.60 sequence-density-rank=1 fanout-score=2.18 fanout-score-rank=31 prefix-density=0.61 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.14 sequence-density-rank=18 fanout-score=35.47 fanout-score-rank=1 prefix-density=0.40 prefix-fanout=11.9 sequence=AAAGAAAAGAAAA SRR12671373 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 20:23:44 Started mapping on | Feb 11 20:23:44 Finished on | Feb 11 20:25:15 Mapping speed, Million of reads per hour | 571.44 Number of input reads | 14444772 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 13536834 Uniquely mapped reads % | 93.71% Average mapped length | 298.77 Number of splices: Total | 13665274 Number of splices: Annotated (sjdb) | 13395743 Number of splices: GT/AG | 13397366 Number of splices: GC/AG | 220950 Number of splices: AT/AC | 8256 Number of splices: Non-canonical | 38702 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.88 Insertion rate per base | 0.02% Insertion average length | 2.24 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 331227 % of reads mapped to multiple loci | 2.29% Number of reads mapped to too many loci | 22366 % of reads mapped to too many loci | 0.15% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.71% % of reads unmapped: other | 0.13% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 576711 576711 576711 N_multimapping 331227 331227 331227 N_noFeature 503383 13335496 574317 N_ambiguous 217091 998 86209 UnstrandedReadsAssigned:12816360 PositiveStrandReadsAssigned:200340 NegativeStrandReadsAssigned:12876308 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671373 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671373-trimmed-pair1.fastq SRR12671373-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,444,772 reads, 12,787,913 reads pseudoaligned [quant] estimated average fragment length: 304.747 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,057 rounds 52401 SRR12671373.ke.tsv 34699 SRR12671373.se.tsv 87100 total ==> SRR12671373.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1714.25 378 15.9614 Potri.005G024800.1.v4.1 1035 731.253 135 13.3635 Potri.004G059700.1.v4.1 961 657.452 2 0.220202 Potri.007G009000.2.v4.1 1416 1112.25 0 0 Potri.003G141000.2.v4.1 2943 2639.25 681 18.6776 Potri.016G087400.1.v4.1 270 67.015 466 503.348 Potri.015G069301.1.v4.1 564 280.301 0 0 Potri.010G195200.1.v4.1 1773 1469.25 71 3.49797 Potri.012G127500.1.v4.1 977 673.348 50 5.37508 ==> SRR12671373.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 106 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 136 Potri.001G212900.v4.1 11 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 8 SRR12671373 completed mapping pipeline successfully