Starting /dee2/code/volunteer_pipeline.sh SRR12671376 current disk space = 3052986322944 free memory = 1459018616 SRR12671376 SRAfilesize a1ee6add4259b6e58b9e95742494a977 SRR12671376.sra SRR12671376.sra file validated SRR12671376 is paired end SRR12671376 is conventional basespace SRR12671376 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671376_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.524 37.0 37.0 37.0 37.0 37.0 2 36.3355 37.0 37.0 37.0 37.0 37.0 3 36.5865 37.0 37.0 37.0 37.0 37.0 4 36.6075 37.0 37.0 37.0 37.0 37.0 5 36.6365 37.0 37.0 37.0 37.0 37.0 6 36.6285 37.0 37.0 37.0 37.0 37.0 7 36.615 37.0 37.0 37.0 37.0 37.0 8 36.6105 37.0 37.0 37.0 37.0 37.0 9 36.519 37.0 37.0 37.0 37.0 37.0 10-14 36.639799999999994 37.0 37.0 37.0 37.0 37.0 15-19 36.630700000000004 37.0 37.0 37.0 37.0 37.0 20-24 36.591300000000004 37.0 37.0 37.0 37.0 37.0 25-29 36.5385 37.0 37.0 37.0 37.0 37.0 30-34 36.4851 37.0 37.0 37.0 37.0 37.0 35-39 36.527699999999996 37.0 37.0 37.0 37.0 37.0 40-44 36.482 37.0 37.0 37.0 37.0 37.0 45-49 36.438599999999994 37.0 37.0 37.0 37.0 37.0 50-54 36.4369 37.0 37.0 37.0 37.0 37.0 55-59 36.397 37.0 37.0 37.0 37.0 37.0 60-64 36.4174 37.0 37.0 37.0 37.0 37.0 65-69 36.345600000000005 37.0 37.0 37.0 37.0 37.0 70-74 36.3638 37.0 37.0 37.0 37.0 37.0 75-79 36.312 37.0 37.0 37.0 37.0 37.0 80-84 36.3055 37.0 37.0 37.0 37.0 37.0 85-89 36.2084 37.0 37.0 37.0 37.0 37.0 90-94 36.263000000000005 37.0 37.0 37.0 37.0 37.0 95-99 36.221 37.0 37.0 37.0 37.0 37.0 100-104 36.186800000000005 37.0 37.0 37.0 37.0 37.0 105-109 36.19 37.0 37.0 37.0 37.0 37.0 110-114 36.1129 37.0 37.0 37.0 37.0 37.0 115-119 36.1349 37.0 37.0 37.0 37.0 37.0 120-124 36.1339 37.0 37.0 37.0 37.0 37.0 125-129 36.096999999999994 37.0 37.0 37.0 37.0 37.0 130-134 36.0597 37.0 37.0 37.0 37.0 37.0 135-139 36.0391 37.0 37.0 37.0 37.0 37.0 140-144 35.9531 37.0 37.0 37.0 37.0 37.0 145-149 35.859899999999996 37.0 37.0 37.0 37.0 37.0 150-151 35.744749999999996 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 1.0 21 1.0 22 0.0 23 1.0 24 0.0 25 3.0 26 6.0 27 10.0 28 8.0 29 13.0 30 23.0 31 31.0 32 50.0 33 66.0 34 109.0 35 273.0 36 2946.0 37 458.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.949999999999996 11.3 6.25 40.5 2 18.671679197994987 14.385964912280702 40.150375939849624 26.79197994987469 3 20.1 19.275000000000002 26.275 34.35 4 23.175 27.725 22.625 26.474999999999998 5 23.9 33.75 23.825 18.525 6 17.825 34.25 25.124999999999996 22.8 7 14.249999999999998 24.9 44.25 16.6 8 17.65 22.400000000000002 33.675 26.275 9 15.9 22.225 36.8 25.074999999999996 10-14 19.869999999999997 30.115 26.6 23.415 15-19 19.155 27.955000000000002 28.655 24.235 20-24 19.75 28.9 27.705000000000002 23.645 25-29 20.345 28.660000000000004 27.505000000000003 23.49 30-34 19.445 29.085 27.37 24.099999999999998 35-39 20.06 27.834999999999997 28.455000000000002 23.65 40-44 19.89 28.415000000000003 28.634999999999998 23.06 45-49 20.06 28.525 27.805000000000003 23.61 50-54 19.875 28.499999999999996 28.389999999999997 23.235 55-59 19.84 27.884999999999998 28.405 23.87 60-64 19.865 28.13 28.12 23.885 65-69 19.755 28.444999999999997 27.915 23.885 70-74 20.48 28.15 27.97 23.400000000000002 75-79 19.98 27.500000000000004 28.68 23.84 80-84 20.035 27.950000000000003 28.050000000000004 23.965 85-89 20.185 28.71 27.450000000000003 23.655 90-94 20.200000000000003 28.54 27.755000000000003 23.505000000000003 95-99 19.939999999999998 28.53 28.244999999999997 23.285 100-104 20.255000000000003 28.444999999999997 27.705000000000002 23.595 105-109 20.57 28.575 27.73 23.125 110-114 20.335 27.825 28.125 23.715 115-119 20.525 28.535 27.57 23.369999999999997 120-124 20.625 28.67 27.339999999999996 23.365 125-129 21.099999999999998 28.910000000000004 26.650000000000002 23.34 130-134 20.73 28.395 27.474999999999998 23.400000000000002 135-139 20.94 28.804999999999996 26.85 23.405 140-144 20.68 28.49 27.68 23.150000000000002 145-149 21.029999999999998 28.415000000000003 26.695 23.86 150-151 21.725 27.200000000000003 27.474999999999998 23.599999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 0.5 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 2.0 24 3.0 25 5.5 26 5.0 27 5.5 28 12.5 29 19.0 30 27.0 31 26.5 32 29.0 33 37.0 34 53.5 35 75.5 36 98.0 37 119.5 38 138.5 39 160.0 40 170.5 41 201.5 42 242.0 43 265.5 44 264.5 45 268.0 46 268.0 47 242.0 48 222.5 49 205.0 50 181.5 51 143.5 52 111.5 53 96.0 54 79.0 55 63.0 56 48.0 57 40.0 58 31.0 59 15.0 60 6.0 61 4.5 62 4.0 63 2.0 64 2.5 65 1.0 66 0.0 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.25 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 83.975 #Duplication Level Percentage of deduplicated Percentage of total 1 84.69782673414706 71.125 2 12.444179815421256 20.9 3 2.232807383149747 5.625 4 0.3870199464126228 1.3 5 0.17862459065197975 0.75 6 0.05954153021732659 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCCTTTGAGAACCTTCTATATACAGAAGGTTTCCGGCTGCCGTTTTGAT 6 0.15 No Hit GTCATTGTTAGCCTTTCTGGTGACCGGGAAAGCTGAGGTAGACTTGAGGC 6 0.15 No Hit GCATGTTCATGATCCAACTAAGCTTGATCTCTAAGTGGAAATCCAATAGT 5 0.125 No Hit GAATAATGTTAGGCATCTACAATTCAGCTTATTCCTAACTATGCAAACAA 5 0.125 No Hit GTTCCTCGACGCATTCGATCTCAGTTCCGAGGACTCGAATGAGATTCTCA 5 0.125 No Hit GTGGAATTAACAGGATTGCTAATTATGTTGACAATAGCTTTTGGGCAGCA 5 0.125 No Hit CTCCTCAGTTATCTTACTATTTTGGTCACCATATAGTTCTCTATTTAGCT 5 0.125 No Hit GGCGGTTTCAGGATCCATTGGAGACGATTTCCTCAAGTGATCAGCCTTGT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.1875 0.0 0.0 0.0 0.0 90-91 0.2375 0.0 0.0 0.0 0.0 92-93 0.275 0.0 0.0 0.0 0.0 94-95 0.3125 0.0 0.0 0.0 0.0 96-97 0.4125 0.0 0.0 0.0 0.0 98-99 0.5 0.0 0.0 0.0 0.0 100-101 0.5875 0.0 0.0 0.0 0.0 102-103 0.85 0.0 0.0 0.0 0.0 104-105 0.9125000000000001 0.0 0.0 0.0 0.0 106-107 1.0125 0.0 0.0 0.0 0.0 108-109 1.2000000000000002 0.0 0.0 0.0 0.0 110-111 1.4125 0.0 0.0 0.0 0.0 112-113 1.6625 0.0 0.0 0.0 0.0 114-115 2.0999999999999996 0.0 0.0 0.0 0.0 116-117 2.55 0.0 0.0 0.0 0.0 118-119 3.0125 0.0 0.0 0.0 0.0 120-121 3.25 0.0 0.0 0.0 0.0 122-123 3.4125 0.0 0.0 0.0 0.0 124-125 3.7625 0.0 0.0 0.0 0.0 126-127 4.0875 0.0 0.0 0.0 0.0 128-129 4.3125 0.0 0.0 0.0 0.0 130-131 4.675 0.0 0.0 0.0 0.0 132-133 4.9875 0.0 0.0 0.0 0.0 134-135 5.45 0.0 0.0 0.0 0.0 136-137 5.9 0.0 0.0 0.0 0.0 138-139 6.1625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCAGCCT 10 0.006830828 145.0 145 GAATTAT 10 0.006830828 145.0 3 GTGGCAT 10 0.006830828 145.0 1 GCTCCTA 10 0.006830828 145.0 5 >>END_MODULE SRR12671376 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671376_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2425 37.0 37.0 37.0 37.0 37.0 2 35.918 37.0 37.0 37.0 37.0 37.0 3 35.9575 37.0 37.0 37.0 37.0 37.0 4 36.091 37.0 37.0 37.0 37.0 37.0 5 36.1645 37.0 37.0 37.0 37.0 37.0 6 35.993 37.0 37.0 37.0 37.0 37.0 7 36.0685 37.0 37.0 37.0 37.0 37.0 8 36.132 37.0 37.0 37.0 37.0 37.0 9 36.188 37.0 37.0 37.0 37.0 37.0 10-14 36.152699999999996 37.0 37.0 37.0 37.0 37.0 15-19 36.1995 37.0 37.0 37.0 37.0 37.0 20-24 36.149899999999995 37.0 37.0 37.0 37.0 37.0 25-29 36.1356 37.0 37.0 37.0 37.0 37.0 30-34 36.041599999999995 37.0 37.0 37.0 37.0 37.0 35-39 36.0631 37.0 37.0 37.0 37.0 37.0 40-44 36.0321 37.0 37.0 37.0 37.0 37.0 45-49 36.0229 37.0 37.0 37.0 37.0 37.0 50-54 35.972300000000004 37.0 37.0 37.0 37.0 37.0 55-59 35.9653 37.0 37.0 37.0 37.0 37.0 60-64 35.9448 37.0 37.0 37.0 37.0 37.0 65-69 35.916799999999995 37.0 37.0 37.0 37.0 37.0 70-74 35.8464 37.0 37.0 37.0 37.0 37.0 75-79 35.8564 37.0 37.0 37.0 37.0 37.0 80-84 35.784000000000006 37.0 37.0 37.0 37.0 37.0 85-89 35.8605 37.0 37.0 37.0 37.0 37.0 90-94 35.780899999999995 37.0 37.0 37.0 37.0 37.0 95-99 35.7543 37.0 37.0 37.0 37.0 37.0 100-104 35.7736 37.0 37.0 37.0 37.0 37.0 105-109 35.6516 37.0 37.0 37.0 37.0 37.0 110-114 35.5704 37.0 37.0 37.0 37.0 37.0 115-119 35.655899999999995 37.0 37.0 37.0 37.0 37.0 120-124 35.6687 37.0 37.0 37.0 37.0 37.0 125-129 35.5447 37.0 37.0 37.0 37.0 37.0 130-134 35.480199999999996 37.0 37.0 37.0 34.6 37.0 135-139 35.3936 37.0 37.0 37.0 34.6 37.0 140-144 35.44109999999999 37.0 37.0 37.0 37.0 37.0 145-149 35.38250000000001 37.0 37.0 37.0 34.6 37.0 150-151 35.1095 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 3.0 13 2.0 14 0.0 15 3.0 16 4.0 17 0.0 18 2.0 19 1.0 20 1.0 21 3.0 22 7.0 23 4.0 24 7.0 25 10.0 26 9.0 27 16.0 28 19.0 29 22.0 30 25.0 31 45.0 32 54.0 33 94.0 34 199.0 35 565.0 36 2650.0 37 255.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.800000000000004 20.474999999999998 10.525 29.2 2 24.099999999999998 25.35 34.025 16.525000000000002 3 20.05 27.800000000000004 32.175 19.975 4 24.474999999999998 34.449999999999996 22.825 18.25 5 26.075 37.35 21.425 15.15 6 19.75 39.825 22.6 17.825 7 19.15 21.425 40.075 19.35 8 18.625 25.1 29.475 26.8 9 19.875 24.575 31.45 24.099999999999998 10-14 22.634999999999998 28.875 26.619999999999997 21.87 15-19 22.71 27.99 28.084999999999997 21.215 20-24 22.470000000000002 29.01 27.675 20.845 25-29 22.264999999999997 28.470000000000002 28.144999999999996 21.12 30-34 21.625 29.205 27.839999999999996 21.33 35-39 21.715 29.185 28.395 20.705000000000002 40-44 22.155 27.384999999999998 29.03 21.43 45-49 21.97 28.925 28.249999999999996 20.855 50-54 22.55 27.884999999999998 28.27 21.295 55-59 23.095 28.33 27.985 20.59 60-64 21.88 27.49 28.82 21.81 65-69 23.075000000000003 27.915 28.03 20.979999999999997 70-74 23.055 27.500000000000004 28.03 21.415 75-79 22.645 27.97 28.04 21.345 80-84 23.505000000000003 27.43 28.055000000000003 21.01 85-89 23.645 27.775 27.93 20.65 90-94 23.39 28.23 28.04 20.34 95-99 23.5 27.439999999999998 28.025 21.035 100-104 23.435 27.735 27.83 21.0 105-109 22.75 27.905 28.285 21.060000000000002 110-114 23.34 28.22 28.18 20.26 115-119 24.169999999999998 28.205000000000002 27.415 20.21 120-124 24.615000000000002 27.24 27.900000000000002 20.244999999999997 125-129 24.415 27.73 27.58 20.275000000000002 130-134 24.94 27.11 27.644999999999996 20.305 135-139 24.9 27.43 28.28 19.39 140-144 24.46 27.939999999999998 27.339999999999996 20.26 145-149 25.91 26.900000000000002 27.58 19.61 150-151 25.624999999999996 28.349999999999998 26.5875 19.4375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 1.0 9 0.5 10 0.0 11 0.5 12 0.5 13 1.0 14 1.0 15 0.5 16 1.5 17 1.5 18 0.5 19 0.0 20 0.0 21 1.5 22 2.0 23 1.5 24 1.5 25 3.5 26 4.5 27 4.5 28 10.0 29 11.0 30 19.0 31 26.5 32 28.5 33 40.5 34 62.0 35 72.0 36 83.0 37 121.5 38 150.5 39 175.0 40 210.5 41 230.5 42 247.5 43 279.5 44 290.5 45 285.0 46 277.5 47 238.5 48 202.0 49 175.0 50 128.5 51 108.0 52 104.0 53 84.5 54 71.0 55 60.0 56 45.5 57 34.0 58 23.5 59 20.5 60 21.0 61 12.5 62 4.5 63 2.5 64 2.0 65 3.0 66 2.5 67 1.0 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 1.0 80 1.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.5 87 1.0 88 1.0 89 0.5 90 1.0 91 1.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 84.375 #Duplication Level Percentage of deduplicated Percentage of total 1 85.3037037037037 71.975 2 11.733333333333333 19.8 3 2.3703703703703702 6.0 4 0.35555555555555557 1.2 5 0.2074074074074074 0.8750000000000001 6 0.02962962962962963 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTGTAAGTTAATTATCTAACCAAAACCATGAAGGTAATGGTTCTTTAACA 6 0.15 No Hit ATTGGTTTCTCTTCTTCACTTGTATGATGTCGTCAATGCTCCTGGTGTCA 5 0.125 No Hit CACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATC 5 0.125 No Hit GTTTGATAATGCTGGTGCTATGATGAGCGTGGATGAGACCTTGATGTGTT 5 0.125 No Hit CTTGTTGATTTGCCATTTATAAGAATTGCAGTTGTATCGCTTTTGGAGTT 5 0.125 No Hit CTTCAATCAAAATCTCTATAAATGGCCTTCAACTCTGTACTTCGCCGAGC 5 0.125 No Hit CGATGATCTTGTTATCTTAAGCAGATCCCAACACCGAGAGCAGGCTGCCA 5 0.125 No Hit ACAACATTGAATCTACTCAACAACATGGAAATCTCTTCTGATCAGATCAC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88-89 0.21250000000000002 0.0 0.0 0.0 0.0 90-91 0.2625 0.0 0.0 0.0 0.0 92-93 0.3 0.0 0.0 0.0 0.0 94-95 0.3375 0.0 0.0 0.0 0.0 96-97 0.4375 0.0 0.0 0.0 0.0 98-99 0.525 0.0 0.0 0.0 0.0 100-101 0.6125 0.0 0.0 0.0 0.0 102-103 0.875 0.0 0.0 0.0 0.0 104-105 0.95 0.0 0.0 0.0 0.0 106-107 1.0625 0.0 0.0 0.0 0.0 108-109 1.25 0.0 0.0 0.0 0.0 110-111 1.4625 0.0 0.0 0.0 0.0 112-113 1.7125 0.0 0.0 0.0 0.0 114-115 2.1500000000000004 0.0 0.0 0.0 0.0 116-117 2.5875 0.0 0.0 0.0 0.0 118-119 3.0374999999999996 0.0 0.0 0.0 0.0 120-121 3.275 0.0 0.0 0.0 0.0 122-123 3.4375 0.0 0.0 0.0 0.0 124-125 3.8125 0.0 0.0 0.0 0.0 126-127 4.1625 0.0 0.0 0.0 0.0 128-129 4.387499999999999 0.0 0.0 0.0 0.0 130-131 4.762499999999999 0.0 0.0 0.0 0.0 132-133 5.0875 0.0 0.0 0.0 0.0 134-135 5.55 0.0 0.0 0.0 0.0 136-137 6.025 0.0 0.0 0.0 0.0 138-139 6.2875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACCATTG 10 0.006830828 145.0 2 TGACATT 10 0.006830828 145.0 7 CACTGGT 10 0.006830828 145.0 145 CTAACAT 10 0.006830828 145.0 6 CACCATT 10 0.006830828 145.0 1 >>END_MODULE Read 865577 spots for SRR12671376.sra Written 865577 spots for SRR12671376.sra Read 865577 spots for SRR12671376.sra Written 865577 spots for SRR12671376.sra Read 865577 spots for SRR12671376.sra Written 865577 spots for SRR12671376.sra Read 865577 spots for SRR12671376.sra Written 865577 spots for SRR12671376.sra Read 865577 spots for SRR12671376.sra Written 865577 spots for SRR12671376.sra Read 865577 spots for SRR12671376.sra Written 865577 spots for SRR12671376.sra Read 865577 spots for SRR12671376.sra Written 865577 spots for SRR12671376.sra Read 865577 spots for SRR12671376.sra Written 865577 spots for SRR12671376.sra Read 865577 spots for SRR12671376.sra Written 865577 spots for SRR12671376.sra Read 865577 spots for SRR12671376.sra Written 865577 spots for SRR12671376.sra Read 865577 spots for SRR12671376.sra Written 865577 spots for SRR12671376.sra Read 865577 spots for SRR12671376.sra Written 865577 spots for SRR12671376.sra Read 865590 spots for SRR12671376.sra Written 865590 spots for SRR12671376.sra Read 865577 spots for SRR12671376.sra Written 865577 spots for SRR12671376.sra Read 865577 spots for SRR12671376.sra Written 865577 spots for SRR12671376.sra Read 865577 spots for SRR12671376.sra Written 865577 spots for SRR12671376.sra Read 865577 spots for SRR12671376.sra Written 865577 spots for SRR12671376.sra Read 865577 spots for SRR12671376.sra Written 865577 spots for SRR12671376.sra Read 865577 spots for SRR12671376.sra Written 865577 spots for SRR12671376.sra Read 865577 spots for SRR12671376.sra Written 865577 spots for SRR12671376.sra SRR ids: ['SRR12671376.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_4ke538iu SRR12671376.sra spots: 17311553 blocks: [[1, 865577], [865578, 1731154], [1731155, 2596731], [2596732, 3462308], [3462309, 4327885], [4327886, 5193462], [5193463, 6059039], [6059040, 6924616], [6924617, 7790193], [7790194, 8655770], [8655771, 9521347], [9521348, 10386924], [10386925, 11252501], [11252502, 12118078], [12118079, 12983655], [12983656, 13849232], [13849233, 14714809], [14714810, 15580386], [15580387, 16445963], [16445964, 17311553]] SRR12671376 file size 5861522 SRR12671376 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671376 SRR12671376_1.fastq SRR12671376_2.fastq Input file: SRR12671376_1.fastq Paired file: SRR12671376_2.fastq trimmed: SRR12671376-trimmed-pair1.fastq, SRR12671376-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 20:27:24 2025 >> started Tue Feb 11 20:27:44 2025 >> done (19.881s) 17311553 read pairs processed; of these: 51 ( 0.00%) short read pairs filtered out after trimming by size control 1415 ( 0.01%) empty read pairs filtered out after trimming by size control 17310087 (99.99%) read pairs available; of these: 1673944 ( 9.67%) trimmed read pairs available after processing 15636143 (90.33%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 3 0.00% 20 5 0.00% 21 1 0.00% 22 0 0.00% 23 12 0.00% 24 2 0.00% 25 1 0.00% 26 9 0.00% 27 13 0.00% 28 4 0.00% 29 9 0.00% 30 9 0.00% 31 9 0.00% 32 14 0.00% 33 12 0.00% 34 8 0.00% 35 13 0.00% 36 15 0.00% 37 11 0.00% 38 17 0.00% 39 19 0.00% 40 12 0.00% 41 27 0.00% 42 19 0.00% 43 21 0.00% 44 26 0.00% 45 32 0.00% 46 35 0.00% 47 22 0.00% 48 43 0.00% 49 54 0.00% 50 48 0.00% 51 47 0.00% 52 56 0.00% 53 73 0.00% 54 76 0.00% 55 96 0.00% 56 102 0.00% 57 100 0.00% 58 106 0.00% 59 151 0.00% 60 181 0.00% 61 207 0.00% 62 234 0.00% 63 280 0.00% 64 290 0.00% 65 334 0.00% 66 383 0.00% 67 399 0.00% 68 461 0.00% 69 530 0.00% 70 575 0.00% 71 660 0.00% 72 846 0.00% 73 909 0.01% 74 987 0.01% 75 1183 0.01% 76 1327 0.01% 77 1510 0.01% 78 1653 0.01% 79 1879 0.01% 80 2033 0.01% 81 2433 0.01% 82 2655 0.02% 83 2839 0.02% 84 3271 0.02% 85 3590 0.02% 86 4104 0.02% 87 4475 0.03% 88 4765 0.03% 89 5140 0.03% 90 5484 0.03% 91 5966 0.03% 92 6455 0.04% 93 6941 0.04% 94 7677 0.04% 95 8292 0.05% 96 8700 0.05% 97 9482 0.05% 98 9955 0.06% 99 10564 0.06% 100 11174 0.06% 101 11790 0.07% 102 12651 0.07% 103 13467 0.08% 104 13915 0.08% 105 14434 0.08% 106 15214 0.09% 107 16108 0.09% 108 16599 0.10% 109 17530 0.10% 110 18343 0.11% 111 18994 0.11% 112 19628 0.11% 113 20300 0.12% 114 20776 0.12% 115 21882 0.13% 116 22811 0.13% 117 23912 0.14% 118 24709 0.14% 119 25255 0.15% 120 25864 0.15% 121 27214 0.16% 122 27807 0.16% 123 28367 0.16% 124 29330 0.17% 125 30045 0.17% 126 31439 0.18% 127 32271 0.19% 128 32768 0.19% 129 33977 0.20% 130 35019 0.20% 131 34956 0.20% 132 35866 0.21% 133 36845 0.21% 134 37431 0.22% 135 38137 0.22% 136 38794 0.22% 137 40017 0.23% 138 40046 0.23% 139 41556 0.24% 140 41971 0.24% 141 43084 0.25% 142 43419 0.25% 143 44057 0.25% 144 45993 0.27% 145 45542 0.26% 146 46636 0.27% 147 47379 0.27% 148 48898 0.28% 149 48628 0.28% 150 50111 0.29% 151 15636143 90.33% 17310087 reads passed initial QC criterion=sequence-density sequence-density=0.33 sequence-density-rank=1 fanout-score=1.94 fanout-score-rank=31 prefix-density=0.33 prefix-fanout=1.9 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTTCGAGCGAAGAAGGTAATCAATTTCCTTGGCCAATTCCTCCTCTGTGAGATCTGGAAGGTAAGAAAGAGTCTCGAACTTCTTCAATCCAGTTGGTGGCCACACCTGCATGCATTGAACTC criterion=fanout-score sequence-density=0.02 sequence-density-rank=29 fanout-score=39.79 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=8.7 sequence=CCAACAAAGCAGCAGGAAATACAAGACACTTACAGATTACTAGCCATCAAATGAGATCCTGTAGAAAGGATTTGAGGAGGCCATGGCTAGCTAACTGTACTTTAATTTACAGCAAATACTATATTAGACAAACATGGAGTGACCAGACTTCTTCTTTTTATTTATTATAGTTCCATAAAACTGCTTGGTTGGAGCCATGCGGCGACGTTTTCTCATTTGCAGGAGCATGGATCACAGGTGCAGTTTGATCCACATTTGCAGCCATTCTCAGCACCAAAGTTCATCTCAGAGCTCTCGTAGAACATCCTAACTGGAGCTACACCAGCAATGATTGTCTGACTTGTGGTGGTCTCGGAGAAACTCAAGTCTGGGTACATGCTGCATCCATTGCAGCCACTGCCGCACTTGCA criterion=sequence-density sequence-density=0.52 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=34 prefix-density=0.52 prefix-fanout=2.0 sequence=AACCGCACCCCGGCACA criterion=fanout-score sequence-density=0.11 sequence-density-rank=14 fanout-score=46.67 fanout-score-rank=1 prefix-density=0.37 prefix-fanout=14.3 sequence=AAAGAAAAGAAAA SRR12671376 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 20:28:42 Started mapping on | Feb 11 20:28:42 Finished on | Feb 11 20:30:39 Mapping speed, Million of reads per hour | 532.62 Number of input reads | 17310087 Average input read length | 289 UNIQUE READS: Uniquely mapped reads number | 14952758 Uniquely mapped reads % | 86.38% Average mapped length | 289.24 Number of splices: Total | 14576267 Number of splices: Annotated (sjdb) | 14243426 Number of splices: GT/AG | 14299194 Number of splices: GC/AG | 222004 Number of splices: AT/AC | 8352 Number of splices: Non-canonical | 46717 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 2.83 Insertion rate per base | 0.03% Insertion average length | 2.23 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 404754 % of reads mapped to multiple loci | 2.34% Number of reads mapped to too many loci | 37246 % of reads mapped to too many loci | 0.22% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 10.97% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1952575 1952575 1952575 N_multimapping 404754 404754 404754 N_noFeature 579274 14752044 657544 N_ambiguous 270658 1988 146773 UnstrandedReadsAssigned:14102826 PositiveStrandReadsAssigned:198726 NegativeStrandReadsAssigned:14148441 Dataset is classified negative stranded MeadianReadLen=143 20thPercentileLength=143 echo kmer=139 SRR12671376 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671376-trimmed-pair1.fastq SRR12671376-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,310,087 reads, 15,302,474 reads pseudoaligned [quant] estimated average fragment length: 263.559 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,215 rounds 52401 SRR12671376.ke.tsv 34699 SRR12671376.se.tsv 87100 total ==> SRR12671376.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1755.44 702 26.8451 Potri.005G024800.1.v4.1 1035 772.441 324 28.1575 Potri.004G059700.1.v4.1 961 698.729 1 0.0960739 Potri.007G009000.2.v4.1 1416 1153.44 0 0 Potri.003G141000.2.v4.1 2943 2680.44 747.876 18.73 Potri.016G087400.1.v4.1 270 89.6502 832 622.998 Potri.015G069301.1.v4.1 564 320.677 0 0 Potri.010G195200.1.v4.1 1773 1510.44 220 9.77762 Potri.012G127500.1.v4.1 977 714.62 195 18.3178 ==> SRR12671376.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 405 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 191 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 11 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 6 SRR12671376 completed mapping pipeline successfully