Starting /dee2/code/volunteer_pipeline.sh SRR12671377 current disk space = 3053017636864 free memory = 1448604428 SRR12671377 SRAfilesize e72ef8a589384beb681689a63fd192c2 SRR12671377.sra SRR12671377.sra file validated SRR12671377 is paired end SRR12671377 is conventional basespace SRR12671377 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671377_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.621 37.0 37.0 37.0 37.0 37.0 2 36.4255 37.0 37.0 37.0 37.0 37.0 3 36.645 37.0 37.0 37.0 37.0 37.0 4 36.6405 37.0 37.0 37.0 37.0 37.0 5 36.6485 37.0 37.0 37.0 37.0 37.0 6 36.6025 37.0 37.0 37.0 37.0 37.0 7 36.5675 37.0 37.0 37.0 37.0 37.0 8 36.509 37.0 37.0 37.0 37.0 37.0 9 36.613 37.0 37.0 37.0 37.0 37.0 10-14 36.6546 37.0 37.0 37.0 37.0 37.0 15-19 36.6079 37.0 37.0 37.0 37.0 37.0 20-24 36.6197 37.0 37.0 37.0 37.0 37.0 25-29 36.5966 37.0 37.0 37.0 37.0 37.0 30-34 36.5178 37.0 37.0 37.0 37.0 37.0 35-39 36.5118 37.0 37.0 37.0 37.0 37.0 40-44 36.5302 37.0 37.0 37.0 37.0 37.0 45-49 36.4815 37.0 37.0 37.0 37.0 37.0 50-54 36.4225 37.0 37.0 37.0 37.0 37.0 55-59 36.456100000000006 37.0 37.0 37.0 37.0 37.0 60-64 36.408699999999996 37.0 37.0 37.0 37.0 37.0 65-69 36.3911 37.0 37.0 37.0 37.0 37.0 70-74 36.3617 37.0 37.0 37.0 37.0 37.0 75-79 36.4041 37.0 37.0 37.0 37.0 37.0 80-84 36.375099999999996 37.0 37.0 37.0 37.0 37.0 85-89 36.3134 37.0 37.0 37.0 37.0 37.0 90-94 36.3186 37.0 37.0 37.0 37.0 37.0 95-99 36.2638 37.0 37.0 37.0 37.0 37.0 100-104 36.2483 37.0 37.0 37.0 37.0 37.0 105-109 36.274699999999996 37.0 37.0 37.0 37.0 37.0 110-114 36.192400000000006 37.0 37.0 37.0 37.0 37.0 115-119 36.13850000000001 37.0 37.0 37.0 37.0 37.0 120-124 36.1297 37.0 37.0 37.0 37.0 37.0 125-129 36.1562 37.0 37.0 37.0 37.0 37.0 130-134 36.102 37.0 37.0 37.0 37.0 37.0 135-139 36.046800000000005 37.0 37.0 37.0 37.0 37.0 140-144 36.008300000000006 37.0 37.0 37.0 37.0 37.0 145-149 35.9416 37.0 37.0 37.0 37.0 37.0 150-151 35.8455 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 2.0 21 2.0 22 0.0 23 0.0 24 3.0 25 5.0 26 2.0 27 4.0 28 8.0 29 18.0 30 21.0 31 31.0 32 32.0 33 53.0 34 102.0 35 262.0 36 2979.0 37 476.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.275 10.6 6.05 39.074999999999996 2 19.36936936936937 11.761761761761761 37.787787787787785 31.08108108108108 3 17.325 16.85 28.375 37.45 4 23.025000000000002 24.525 23.9 28.549999999999997 5 24.15 32.15 23.125 20.575 6 17.724999999999998 34.775 25.35 22.15 7 13.200000000000001 25.025 43.775 18.0 8 16.25 24.425 35.525 23.799999999999997 9 16.825000000000003 23.1 34.699999999999996 25.374999999999996 10-14 19.295 30.464999999999996 28.18 22.06 15-19 19.900000000000002 27.04 28.375 24.685000000000002 20-24 19.994999999999997 28.22 27.560000000000002 24.224999999999998 25-29 19.355 28.389999999999997 28.595 23.66 30-34 19.885 28.34 27.67 24.104999999999997 35-39 20.115 28.299999999999997 27.675 23.91 40-44 20.669999999999998 28.544999999999998 27.525 23.26 45-49 20.005 28.27 27.72 24.005000000000003 50-54 19.525000000000002 28.415000000000003 27.900000000000002 24.16 55-59 20.16 28.444999999999997 27.755000000000003 23.64 60-64 20.465 28.76 27.76 23.015 65-69 20.365 28.585 27.900000000000002 23.150000000000002 70-74 20.265 28.53 28.18 23.025000000000002 75-79 19.455 29.075 27.6 23.87 80-84 20.405 28.575 27.474999999999998 23.544999999999998 85-89 20.075000000000003 28.634999999999998 27.495000000000005 23.794999999999998 90-94 20.48 27.689999999999998 28.294999999999998 23.535 95-99 19.505 27.860000000000003 28.07 24.565 100-104 20.105 28.799999999999997 27.465 23.630000000000003 105-109 20.005 28.694999999999997 27.445000000000004 23.855 110-114 20.39 27.694999999999997 28.084999999999997 23.830000000000002 115-119 19.84 28.435 27.88 23.845 120-124 20.915 28.015 27.650000000000002 23.419999999999998 125-129 20.125 27.939999999999998 28.555000000000003 23.380000000000003 130-134 20.23 27.93 28.23 23.61 135-139 20.905 28.084999999999997 27.54 23.47 140-144 20.555 27.605 28.345 23.494999999999997 145-149 20.87 28.110000000000003 27.205000000000002 23.815 150-151 20.7375 28.449999999999996 27.3625 23.45 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.5 7 0.5 8 0.0 9 0.5 10 1.0 11 0.5 12 0.5 13 1.0 14 0.5 15 0.0 16 0.5 17 0.5 18 1.5 19 2.0 20 0.5 21 0.0 22 0.5 23 1.5 24 4.0 25 5.0 26 5.5 27 7.5 28 12.0 29 15.0 30 19.5 31 26.0 32 39.5 33 50.0 34 47.5 35 55.5 36 75.5 37 99.0 38 132.5 39 152.0 40 183.5 41 235.0 42 239.5 43 249.5 44 263.5 45 261.5 46 263.0 47 234.0 48 213.0 49 209.5 50 182.0 51 160.0 52 140.0 53 106.0 54 94.0 55 66.0 56 31.5 57 28.0 58 27.0 59 23.0 60 14.5 61 6.5 62 3.0 63 2.0 64 2.0 65 1.5 66 1.0 67 0.0 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.1 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 84.475 #Duplication Level Percentage of deduplicated Percentage of total 1 85.23231725362534 72.0 2 11.95620005918911 20.200000000000003 3 2.1899970405445397 5.55 4 0.5031074282332051 1.7000000000000002 5 0.059189109203906486 0.25 6 0.059189109203906486 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TCCAGGTAAACCAGTTCCAAACTGTCTCGACTGCCCAAAAGTCCCAAGAA 6 0.15 No Hit GCTTGAAGTCACAAACTGAATGACAAACCCGCATCTTCAAGGGGCAGCAG 6 0.15 No Hit CCTTAACCTTAAGCTCATGATGTTTCCATTGACCATGAACTGTATCATAC 5 0.125 No Hit CTGCATTTTTTGGATCCCCACGTAATAATACATCTCACCTTCCCACTGAA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1125 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.16249999999999998 0.0 0.0 0.0 0.0 92-93 0.2125 0.0 0.0 0.0 0.0 94-95 0.25 0.0 0.0 0.0 0.0 96-97 0.25 0.0 0.0 0.0 0.0 98-99 0.2875 0.0 0.0 0.0 0.0 100-101 0.3625 0.0 0.0 0.0 0.0 102-103 0.4625 0.0 0.0 0.0 0.0 104-105 0.4875 0.0 0.0 0.0 0.0 106-107 0.55 0.0 0.0 0.0 0.0 108-109 0.6125 0.0 0.0 0.0 0.0 110-111 0.6625000000000001 0.0 0.0 0.0 0.0 112-113 0.725 0.0 0.0 0.0 0.0 114-115 0.8875 0.0 0.0 0.0 0.0 116-117 1.0125 0.0 0.0 0.0 0.0 118-119 1.2 0.0 0.0 0.0 0.0 120-121 1.375 0.0 0.0 0.0 0.0 122-123 1.5 0.0 0.0 0.0 0.0 124-125 1.6375000000000002 0.0 0.0 0.0 0.0 126-127 1.8 0.0 0.0 0.0 0.0 128-129 1.975 0.0 0.0 0.0 0.0 130-131 2.1375 0.0 0.0 0.0 0.0 132-133 2.45 0.0 0.0 0.0 0.0 134-135 2.7 0.0 0.0 0.0 0.0 136-137 2.925 0.0 0.0 0.0 0.0 138-139 3.1125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12671377 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671377_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2745 37.0 37.0 37.0 37.0 37.0 2 36.122 37.0 37.0 37.0 37.0 37.0 3 36.06 37.0 37.0 37.0 37.0 37.0 4 36.1775 37.0 37.0 37.0 37.0 37.0 5 36.3525 37.0 37.0 37.0 37.0 37.0 6 36.12 37.0 37.0 37.0 37.0 37.0 7 36.1985 37.0 37.0 37.0 37.0 37.0 8 36.249 37.0 37.0 37.0 37.0 37.0 9 36.22 37.0 37.0 37.0 37.0 37.0 10-14 36.2169 37.0 37.0 37.0 37.0 37.0 15-19 36.236799999999995 37.0 37.0 37.0 37.0 37.0 20-24 36.1567 37.0 37.0 37.0 37.0 37.0 25-29 36.1772 37.0 37.0 37.0 37.0 37.0 30-34 36.0943 37.0 37.0 37.0 37.0 37.0 35-39 36.1323 37.0 37.0 37.0 37.0 37.0 40-44 36.113800000000005 37.0 37.0 37.0 37.0 37.0 45-49 36.090500000000006 37.0 37.0 37.0 37.0 37.0 50-54 36.023999999999994 37.0 37.0 37.0 37.0 37.0 55-59 36.0013 37.0 37.0 37.0 37.0 37.0 60-64 36.0071 37.0 37.0 37.0 37.0 37.0 65-69 35.944300000000005 37.0 37.0 37.0 37.0 37.0 70-74 35.9311 37.0 37.0 37.0 37.0 37.0 75-79 35.9182 37.0 37.0 37.0 37.0 37.0 80-84 35.9205 37.0 37.0 37.0 37.0 37.0 85-89 35.8961 37.0 37.0 37.0 37.0 37.0 90-94 35.908100000000005 37.0 37.0 37.0 37.0 37.0 95-99 35.7966 37.0 37.0 37.0 37.0 37.0 100-104 35.766600000000004 37.0 37.0 37.0 37.0 37.0 105-109 35.7534 37.0 37.0 37.0 37.0 37.0 110-114 35.6617 37.0 37.0 37.0 37.0 37.0 115-119 35.8053 37.0 37.0 37.0 37.0 37.0 120-124 35.7834 37.0 37.0 37.0 37.0 37.0 125-129 35.626 37.0 37.0 37.0 37.0 37.0 130-134 35.602 37.0 37.0 37.0 37.0 37.0 135-139 35.5231 37.0 37.0 37.0 37.0 37.0 140-144 35.585100000000004 37.0 37.0 37.0 37.0 37.0 145-149 35.5277 37.0 37.0 37.0 37.0 37.0 150-151 35.39975 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 1.0 14 1.0 15 1.0 16 1.0 17 0.0 18 0.0 19 0.0 20 4.0 21 3.0 22 6.0 23 5.0 24 2.0 25 8.0 26 6.0 27 6.0 28 12.0 29 21.0 30 39.0 31 39.0 32 63.0 33 99.0 34 203.0 35 560.0 36 2662.0 37 256.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.05 20.599999999999998 9.975000000000001 26.375 2 26.424999999999997 24.8 32.525 16.25 3 19.6 28.000000000000004 34.300000000000004 18.099999999999998 4 23.25 33.975 23.175 19.6 5 25.624999999999996 37.574999999999996 21.875 14.924999999999999 6 19.3 39.800000000000004 22.775000000000002 18.125 7 19.275000000000002 21.925 39.625 19.175 8 20.349999999999998 26.375 28.975 24.3 9 24.0 24.474999999999998 29.299999999999997 22.225 10-14 22.865 29.395 26.779999999999998 20.96 15-19 22.48 28.525 27.450000000000003 21.545 20-24 22.46 28.79 27.834999999999997 20.915 25-29 22.775000000000002 28.865000000000002 27.765 20.595 30-34 22.64 28.355000000000004 27.744999999999997 21.26 35-39 22.275 28.08 28.494999999999997 21.15 40-44 23.28 27.525 28.1 21.095 45-49 22.52 28.439999999999998 27.92 21.12 50-54 23.02 27.425 27.900000000000002 21.654999999999998 55-59 23.05 27.685 28.425 20.84 60-64 22.715 27.985 27.950000000000003 21.349999999999998 65-69 23.265 27.515 27.905 21.315 70-74 23.095 27.095000000000002 28.275 21.535 75-79 22.53 28.244999999999997 27.865000000000002 21.36 80-84 22.685 29.04 26.950000000000003 21.325 85-89 23.34 28.075 27.589999999999996 20.995 90-94 22.770000000000003 28.64 27.18 21.41 95-99 22.884999999999998 27.77 27.97 21.375 100-104 23.175 27.900000000000002 27.58 21.345 105-109 23.695 27.339999999999996 28.050000000000004 20.915 110-114 23.355 28.105000000000004 28.425 20.115 115-119 24.01 28.560000000000002 26.640000000000004 20.79 120-124 23.015 28.035 27.665 21.285 125-129 23.555 27.800000000000004 27.565 21.08 130-134 23.705000000000002 28.095 27.525 20.674999999999997 135-139 23.98 28.355000000000004 27.950000000000003 19.715 140-144 24.240000000000002 28.38 26.889999999999997 20.49 145-149 24.675 27.944999999999997 27.185 20.195 150-151 24.3875 27.025 28.349999999999998 20.2375 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 1.0 6 1.0 7 0.0 8 0.0 9 1.0 10 1.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 1.0 20 1.5 21 0.5 22 1.0 23 1.0 24 2.0 25 4.5 26 5.5 27 7.0 28 10.5 29 12.5 30 19.0 31 27.5 32 36.5 33 46.5 34 49.5 35 58.5 36 78.0 37 108.0 38 135.0 39 157.0 40 192.0 41 234.0 42 268.5 43 280.5 44 272.5 45 264.5 46 251.0 47 235.5 48 225.0 49 208.5 50 172.0 51 133.0 52 105.0 53 78.5 54 68.0 55 62.0 56 49.5 57 37.0 58 27.0 59 23.0 60 17.5 61 8.0 62 4.5 63 4.0 64 1.5 65 1.0 66 1.5 67 0.5 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.5 95 0.5 96 0.0 97 0.0 98 0.5 99 1.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 84.6 #Duplication Level Percentage of deduplicated Percentage of total 1 85.52009456264776 72.35000000000001 2 11.6725768321513 19.75 3 2.068557919621749 5.25 4 0.6501182033096926 2.1999999999999997 5 0.0 0.0 6 0.08865248226950355 0.44999999999999996 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGCTTGAAAAGGAGAGACAGACAGAGATAAGGAGCTACAAGGGTTTGATG 6 0.15 No Hit CTTCACTTGTATCTCCTCACTGACTCCAACTCTCATACTGTTTCTCAGCG 6 0.15 No Hit GCTGCACAAATGAACTTAATTTGGGAAATCTTGGAGGTTTTGGGATTGGT 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1125 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.16249999999999998 0.0 0.0 0.0 0.0 92-93 0.2125 0.0 0.0 0.0 0.0 94-95 0.25 0.0 0.0 0.0 0.0 96-97 0.25 0.0 0.0 0.0 0.0 98-99 0.2875 0.0 0.0 0.0 0.0 100-101 0.35 0.0 0.0 0.0 0.0 102-103 0.4375 0.0 0.0 0.0 0.0 104-105 0.4625 0.0 0.0 0.0 0.0 106-107 0.525 0.0 0.0 0.0 0.0 108-109 0.5875 0.0 0.0 0.0 0.0 110-111 0.6625000000000001 0.0 0.0 0.0 0.0 112-113 0.725 0.0 0.0 0.0 0.0 114-115 0.8875 0.0 0.0 0.0 0.0 116-117 1.0125 0.0 0.0 0.0 0.0 118-119 1.2 0.0 0.0 0.0 0.0 120-121 1.4 0.0 0.0 0.0 0.0 122-123 1.525 0.0 0.0 0.0 0.0 124-125 1.6625 0.0 0.0 0.0 0.0 126-127 1.825 0.0 0.0 0.0 0.0 128-129 2.0 0.0 0.0 0.0 0.0 130-131 2.1624999999999996 0.0 0.0 0.0 0.0 132-133 2.4749999999999996 0.0 0.0 0.0 0.0 134-135 2.7625 0.0 0.0 0.0 0.0 136-137 3.0 0.0 0.0 0.0 0.0 138-139 3.1875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 972644 spots for SRR12671377.sra Written 972644 spots for SRR12671377.sra Read 972644 spots for SRR12671377.sra Written 972644 spots for SRR12671377.sra Read 972644 spots for SRR12671377.sra Written 972644 spots for SRR12671377.sra Read 972644 spots for SRR12671377.sra Written 972644 spots for SRR12671377.sra Read 972644 spots for SRR12671377.sra Written 972644 spots for SRR12671377.sra Read 972644 spots for SRR12671377.sra Written 972644 spots for SRR12671377.sra Read 972644 spots for SRR12671377.sra Written 972644 spots for SRR12671377.sra Read 972644 spots for SRR12671377.sra Written 972644 spots for SRR12671377.sra Read 972644 spots for SRR12671377.sra Written 972644 spots for SRR12671377.sra Read 972644 spots for SRR12671377.sra Written 972644 spots for SRR12671377.sra Read 972653 spots for SRR12671377.sra Written 972653 spots for SRR12671377.sra Read 972644 spots for SRR12671377.sra Written 972644 spots for SRR12671377.sra Read 972644 spots for SRR12671377.sra Written 972644 spots for SRR12671377.sra Read 972644 spots for SRR12671377.sra Written 972644 spots for SRR12671377.sra Read 972644 spots for SRR12671377.sra Written 972644 spots for SRR12671377.sra Read 972644 spots for SRR12671377.sra Written 972644 spots for SRR12671377.sra Read 972644 spots for SRR12671377.sra Written 972644 spots for SRR12671377.sra Read 972644 spots for SRR12671377.sra Written 972644 spots for SRR12671377.sra Read 972644 spots for SRR12671377.sra Written 972644 spots for SRR12671377.sra Read 972644 spots for SRR12671377.sra Written 972644 spots for SRR12671377.sra SRR ids: ['SRR12671377.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_12nu3ssb SRR12671377.sra spots: 19452889 blocks: [[1, 972644], [972645, 1945288], [1945289, 2917932], [2917933, 3890576], [3890577, 4863220], [4863221, 5835864], [5835865, 6808508], [6808509, 7781152], [7781153, 8753796], [8753797, 9726440], [9726441, 10699084], [10699085, 11671728], [11671729, 12644372], [12644373, 13617016], [13617017, 14589660], [14589661, 15562304], [15562305, 16534948], [16534949, 17507592], [17507593, 18480236], [18480237, 19452889]] SRR12671377 file size 6589242 SRR12671377 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671377 SRR12671377_1.fastq SRR12671377_2.fastq Input file: SRR12671377_1.fastq Paired file: SRR12671377_2.fastq trimmed: SRR12671377-trimmed-pair1.fastq, SRR12671377-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 20:36:43 2025 >> started Tue Feb 11 20:37:04 2025 >> done (21.470s) 19452889 read pairs processed; of these: 125 ( 0.00%) short read pairs filtered out after trimming by size control 3036 ( 0.02%) empty read pairs filtered out after trimming by size control 19449728 (99.98%) read pairs available; of these: 872200 ( 4.48%) trimmed read pairs available after processing 18577528 (95.52%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 6 0.00% 20 12 0.00% 21 13 0.00% 22 11 0.00% 23 9 0.00% 24 6 0.00% 25 11 0.00% 26 15 0.00% 27 12 0.00% 28 14 0.00% 29 22 0.00% 30 16 0.00% 31 22 0.00% 32 20 0.00% 33 22 0.00% 34 18 0.00% 35 20 0.00% 36 17 0.00% 37 23 0.00% 38 30 0.00% 39 13 0.00% 40 30 0.00% 41 21 0.00% 42 34 0.00% 43 23 0.00% 44 21 0.00% 45 33 0.00% 46 41 0.00% 47 34 0.00% 48 55 0.00% 49 49 0.00% 50 47 0.00% 51 72 0.00% 52 51 0.00% 53 77 0.00% 54 62 0.00% 55 67 0.00% 56 81 0.00% 57 103 0.00% 58 111 0.00% 59 143 0.00% 60 176 0.00% 61 169 0.00% 62 182 0.00% 63 203 0.00% 64 239 0.00% 65 267 0.00% 66 303 0.00% 67 355 0.00% 68 402 0.00% 69 408 0.00% 70 511 0.00% 71 529 0.00% 72 668 0.00% 73 734 0.00% 74 805 0.00% 75 876 0.00% 76 941 0.00% 77 1083 0.01% 78 1136 0.01% 79 1314 0.01% 80 1332 0.01% 81 1567 0.01% 82 1741 0.01% 83 1884 0.01% 84 2128 0.01% 85 2289 0.01% 86 2503 0.01% 87 2693 0.01% 88 2827 0.01% 89 2990 0.02% 90 3152 0.02% 91 3490 0.02% 92 3732 0.02% 93 3900 0.02% 94 4365 0.02% 95 4566 0.02% 96 4836 0.02% 97 5204 0.03% 98 5323 0.03% 99 5649 0.03% 100 5929 0.03% 101 6107 0.03% 102 6564 0.03% 103 6830 0.04% 104 6916 0.04% 105 7459 0.04% 106 7777 0.04% 107 7875 0.04% 108 8470 0.04% 109 8725 0.04% 110 8754 0.05% 111 9261 0.05% 112 9617 0.05% 113 9613 0.05% 114 10048 0.05% 115 10768 0.06% 116 11051 0.06% 117 11644 0.06% 118 12179 0.06% 119 12473 0.06% 120 12660 0.07% 121 12587 0.06% 122 13236 0.07% 123 13696 0.07% 124 14410 0.07% 125 14719 0.08% 126 15300 0.08% 127 15984 0.08% 128 16287 0.08% 129 16713 0.09% 130 17168 0.09% 131 17162 0.09% 132 17734 0.09% 133 18381 0.09% 134 18786 0.10% 135 19280 0.10% 136 20034 0.10% 137 20488 0.11% 138 21108 0.11% 139 22182 0.11% 140 22577 0.12% 141 22879 0.12% 142 23430 0.12% 143 23729 0.12% 144 24501 0.13% 145 25122 0.13% 146 25706 0.13% 147 26179 0.13% 148 27284 0.14% 149 27401 0.14% 150 28454 0.15% 151 18577528 95.52% 19449728 reads passed initial QC criterion=sequence-density sequence-density=0.45 sequence-density-rank=1 fanout-score=2.08 fanout-score-rank=39 prefix-density=0.46 prefix-fanout=2.0 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=43 fanout-score=71.92 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=5.6 sequence=AAACAGAATATTTACTTTTAGCGCAAGTTTCAATTCATGAGCTCGTTACATCACAAGTTAACATTACAAGCCAATAGTCCCAGCACAGAAAAAACTCTTTTGTTGCTCACTTTCCGGGAACGAAGTTTGTGGCATATGCCCAGGCGTTGTTGTTTACTGGGTCAGAAAGGTGGTCAGCCAGGTTCTCCAGTGGTCCCTTTCCGGTCACAATGGCCTGGACAAAGAATCCGAACATTGAGAACATAGCCAACCT criterion=sequence-density sequence-density=0.81 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=32 prefix-density=0.82 prefix-fanout=2.0 sequence=AACCGCACCCCGGCACA criterion=fanout-score sequence-density=0.16 sequence-density-rank=15 fanout-score=36.70 fanout-score-rank=1 prefix-density=0.43 prefix-fanout=13.6 sequence=AAAGAAAAGAAAA SRR12671377 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 20:37:51 Started mapping on | Feb 11 20:37:51 Finished on | Feb 11 20:39:45 Mapping speed, Million of reads per hour | 614.20 Number of input reads | 19449728 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 18387836 Uniquely mapped reads % | 94.54% Average mapped length | 298.45 Number of splices: Total | 18357722 Number of splices: Annotated (sjdb) | 17981681 Number of splices: GT/AG | 17997649 Number of splices: GC/AG | 299210 Number of splices: AT/AC | 11603 Number of splices: Non-canonical | 49260 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.87 Insertion rate per base | 0.02% Insertion average length | 2.18 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 452550 % of reads mapped to multiple loci | 2.33% Number of reads mapped to too many loci | 24375 % of reads mapped to too many loci | 0.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.91% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 609342 609342 609342 N_multimapping 452550 452550 452550 N_noFeature 648815 18119233 748284 N_ambiguous 286695 1022 117002 UnstrandedReadsAssigned:17452326 PositiveStrandReadsAssigned:267581 NegativeStrandReadsAssigned:17522550 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671377 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671377-trimmed-pair1.fastq SRR12671377-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,449,728 reads, 17,446,912 reads pseudoaligned [quant] estimated average fragment length: 298.287 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,115 rounds 52401 SRR12671377.ke.tsv 34699 SRR12671377.se.tsv 87100 total ==> SRR12671377.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1720.71 529 16.4848 Potri.005G024800.1.v4.1 1035 737.713 277 20.1339 Potri.004G059700.1.v4.1 961 663.949 5 0.403804 Potri.007G009000.2.v4.1 1416 1118.71 0 0 Potri.003G141000.2.v4.1 2943 2645.71 1043 21.1386 Potri.016G087400.1.v4.1 270 69.9413 730 559.661 Potri.015G069301.1.v4.1 564 285.81 0 0 Potri.010G195200.1.v4.1 1773 1475.71 15 0.545036 Potri.012G127500.1.v4.1 977 679.847 140 11.0421 ==> SRR12671377.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 283 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 219 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 5 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 13 SRR12671377 completed mapping pipeline successfully