Starting /dee2/code/volunteer_pipeline.sh SRR12671378 current disk space = 3052959191040 free memory = 1347518796 SRR12671378 SRAfilesize db17103c37845265ccc1af68da6fa8bb SRR12671378.sra SRR12671378.sra file validated SRR12671378 is paired end SRR12671378 is conventional basespace SRR12671378 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671378_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.637 37.0 37.0 37.0 37.0 37.0 2 36.523 37.0 37.0 37.0 37.0 37.0 3 36.59 37.0 37.0 37.0 37.0 37.0 4 36.621 37.0 37.0 37.0 37.0 37.0 5 36.6155 37.0 37.0 37.0 37.0 37.0 6 36.58 37.0 37.0 37.0 37.0 37.0 7 36.4995 37.0 37.0 37.0 37.0 37.0 8 36.641 37.0 37.0 37.0 37.0 37.0 9 36.567 37.0 37.0 37.0 37.0 37.0 10-14 36.6803 37.0 37.0 37.0 37.0 37.0 15-19 36.6556 37.0 37.0 37.0 37.0 37.0 20-24 36.6286 37.0 37.0 37.0 37.0 37.0 25-29 36.5871 37.0 37.0 37.0 37.0 37.0 30-34 36.5893 37.0 37.0 37.0 37.0 37.0 35-39 36.5912 37.0 37.0 37.0 37.0 37.0 40-44 36.584999999999994 37.0 37.0 37.0 37.0 37.0 45-49 36.5632 37.0 37.0 37.0 37.0 37.0 50-54 36.5298 37.0 37.0 37.0 37.0 37.0 55-59 36.5166 37.0 37.0 37.0 37.0 37.0 60-64 36.4696 37.0 37.0 37.0 37.0 37.0 65-69 36.446299999999994 37.0 37.0 37.0 37.0 37.0 70-74 36.417500000000004 37.0 37.0 37.0 37.0 37.0 75-79 36.4634 37.0 37.0 37.0 37.0 37.0 80-84 36.4045 37.0 37.0 37.0 37.0 37.0 85-89 36.3931 37.0 37.0 37.0 37.0 37.0 90-94 36.412400000000005 37.0 37.0 37.0 37.0 37.0 95-99 36.3584 37.0 37.0 37.0 37.0 37.0 100-104 36.343999999999994 37.0 37.0 37.0 37.0 37.0 105-109 36.36619999999999 37.0 37.0 37.0 37.0 37.0 110-114 36.2613 37.0 37.0 37.0 37.0 37.0 115-119 36.250800000000005 37.0 37.0 37.0 37.0 37.0 120-124 36.268299999999996 37.0 37.0 37.0 37.0 37.0 125-129 36.2547 37.0 37.0 37.0 37.0 37.0 130-134 36.2374 37.0 37.0 37.0 37.0 37.0 135-139 36.178799999999995 37.0 37.0 37.0 37.0 37.0 140-144 36.0985 37.0 37.0 37.0 37.0 37.0 145-149 36.0372 37.0 37.0 37.0 37.0 37.0 150-151 35.975 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 1.0 25 1.0 26 4.0 27 5.0 28 8.0 29 7.0 30 14.0 31 24.0 32 36.0 33 57.0 34 84.0 35 261.0 36 3050.0 37 448.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.1 10.825 4.875 42.199999999999996 2 18.812625250501004 11.648296593186373 39.754509018036075 29.784569138276552 3 17.8 18.325 28.199999999999996 35.675000000000004 4 23.200000000000003 25.525 22.525000000000002 28.749999999999996 5 23.075000000000003 33.525 23.849999999999998 19.55 6 18.0 34.300000000000004 26.125 21.575 7 12.975 25.374999999999996 44.9 16.75 8 16.175 24.075 33.725 26.025 9 16.05 22.625 37.0 24.325 10-14 19.085 30.130000000000003 27.644999999999996 23.14 15-19 19.56 27.96 27.345000000000002 25.135 20-24 19.805 28.939999999999998 27.33 23.925 25-29 19.835 28.955 27.71 23.5 30-34 20.26 29.09 27.49 23.16 35-39 20.044999999999998 28.475 27.944999999999997 23.535 40-44 19.75 29.265 27.58 23.405 45-49 19.994999999999997 28.055000000000003 27.54 24.41 50-54 19.53 28.71 27.339999999999996 24.42 55-59 20.0 28.42 28.22 23.36 60-64 19.64 28.799999999999997 27.634999999999998 23.925 65-69 19.994999999999997 27.63 28.34 24.035 70-74 19.81 28.675 27.46 24.055 75-79 19.685 27.68 28.165000000000003 24.47 80-84 20.11 28.815 26.924999999999997 24.15 85-89 19.650000000000002 28.645 27.644999999999996 24.060000000000002 90-94 20.11 28.055000000000003 27.639999999999997 24.195 95-99 20.115 27.800000000000004 28.08 24.005000000000003 100-104 19.875 29.080000000000002 27.425 23.62 105-109 20.535 28.33 28.03 23.105 110-114 20.015 27.775 27.915 24.295 115-119 20.93 28.315 27.215 23.54 120-124 20.89 28.12 27.625 23.365 125-129 20.275000000000002 28.48 26.8 24.445 130-134 20.549999999999997 27.85 27.439999999999998 24.16 135-139 20.630000000000003 27.694999999999997 28.4 23.275000000000002 140-144 20.875 28.105000000000004 27.29 23.73 145-149 20.8 27.975 27.944999999999997 23.28 150-151 20.1 28.7 26.8625 24.337500000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 1.0 24 2.5 25 3.0 26 3.5 27 13.0 28 13.0 29 13.5 30 23.5 31 20.5 32 30.0 33 38.5 34 48.0 35 71.5 36 81.0 37 98.0 38 136.5 39 165.0 40 191.5 41 217.5 42 239.5 43 261.5 44 263.5 45 266.5 46 281.5 47 261.5 48 219.0 49 199.5 50 177.0 51 141.5 52 110.5 53 89.0 54 73.5 55 62.5 56 54.5 57 40.5 58 28.5 59 22.5 60 13.5 61 7.5 62 5.0 63 4.0 64 3.5 65 1.0 66 0.0 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.2 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 83.55 #Duplication Level Percentage of deduplicated Percentage of total 1 84.38061041292639 70.5 2 12.567324955116696 21.0 3 2.3040095751047276 5.775 4 0.5984440454817475 2.0 5 0.08976660682226212 0.375 6 0.029922202274087373 0.15 7 0.0 0.0 8 0.029922202274087373 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCTGGAATTACCTTCAACACATTGAACCTCACTGTCTTTGATAATGGCCT 8 0.2 No Hit GTTTCTTGATTAAGTTTCTATGAAGAAAGGCAGCTCAGTTGCTTTCTGAA 6 0.15 No Hit ATGGATTCTTTGATGGGCTGGAACTTAAAGGACTGAAGATCATATGAAGG 5 0.125 No Hit CCAATCTCATCAAGAGCAAAGAAGGGTGGATCCAACAAAGACGGAACCTG 5 0.125 No Hit GTCCATTCCACCACTATAAATAATTTTGACATCCAACCCGCGTTTTGCAA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0125 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.037500000000000006 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.3 0.0 0.0 0.0 0.0 92-93 0.4125 0.0 0.0 0.0 0.0 94-95 0.4875 0.0 0.0 0.0 0.0 96-97 0.525 0.0 0.0 0.0 0.0 98-99 0.7 0.0 0.0 0.0 0.0 100-101 0.7625 0.0 0.0 0.0 0.0 102-103 0.8 0.0 0.0 0.0 0.0 104-105 0.9125000000000001 0.0 0.0 0.0 0.0 106-107 1.0 0.0 0.0 0.0 0.0 108-109 1.0875 0.0 0.0 0.0 0.0 110-111 1.1875 0.0 0.0 0.0 0.0 112-113 1.25 0.0 0.0 0.0 0.0 114-115 1.3625 0.0 0.0 0.0 0.0 116-117 1.5499999999999998 0.0 0.0 0.0125 0.0 118-119 1.7125 0.0 0.0 0.025 0.0 120-121 1.7625 0.0 0.0 0.025 0.0 122-123 1.7875 0.0 0.0 0.025 0.0 124-125 1.8375 0.0 0.0 0.025 0.0 126-127 1.925 0.0 0.0 0.025 0.0 128-129 2.15 0.0 0.0 0.025 0.0 130-131 2.2625 0.0 0.0 0.025 0.0 132-133 2.4 0.0 0.0 0.025 0.0 134-135 2.4375 0.0 0.0 0.025 0.0 136-137 2.5625 0.0 0.0 0.025 0.0 138-139 2.725 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAATTGG 10 0.006830828 145.0 5 TTGGGGC 10 0.006830828 145.0 8 TGGGGCA 10 0.006830828 145.0 9 AAAATTG 10 0.006830828 145.0 4 AATTGGG 10 0.006830828 145.0 6 GTAAAAT 10 0.006830828 145.0 2 GGTAAAA 10 0.006830828 145.0 1 >>END_MODULE SRR12671378 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671378_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.235 37.0 37.0 37.0 37.0 37.0 2 35.897 37.0 37.0 37.0 37.0 37.0 3 36.159 37.0 37.0 37.0 37.0 37.0 4 36.22 37.0 37.0 37.0 37.0 37.0 5 36.1565 37.0 37.0 37.0 37.0 37.0 6 36.2095 37.0 37.0 37.0 37.0 37.0 7 36.0455 37.0 37.0 37.0 37.0 37.0 8 36.2215 37.0 37.0 37.0 37.0 37.0 9 36.2305 37.0 37.0 37.0 37.0 37.0 10-14 36.244299999999996 37.0 37.0 37.0 37.0 37.0 15-19 36.2577 37.0 37.0 37.0 37.0 37.0 20-24 36.15820000000001 37.0 37.0 37.0 37.0 37.0 25-29 36.1044 37.0 37.0 37.0 37.0 37.0 30-34 36.0929 37.0 37.0 37.0 37.0 37.0 35-39 36.08240000000001 37.0 37.0 37.0 37.0 37.0 40-44 36.144800000000004 37.0 37.0 37.0 37.0 37.0 45-49 36.0627 37.0 37.0 37.0 37.0 37.0 50-54 36.0183 37.0 37.0 37.0 37.0 37.0 55-59 35.977799999999995 37.0 37.0 37.0 37.0 37.0 60-64 35.9813 37.0 37.0 37.0 37.0 37.0 65-69 35.9901 37.0 37.0 37.0 37.0 37.0 70-74 35.9254 37.0 37.0 37.0 37.0 37.0 75-79 35.929899999999996 37.0 37.0 37.0 37.0 37.0 80-84 35.83710000000001 37.0 37.0 37.0 37.0 37.0 85-89 35.8634 37.0 37.0 37.0 37.0 37.0 90-94 35.9067 37.0 37.0 37.0 37.0 37.0 95-99 35.7621 37.0 37.0 37.0 37.0 37.0 100-104 35.7684 37.0 37.0 37.0 37.0 37.0 105-109 35.7176 37.0 37.0 37.0 37.0 37.0 110-114 35.6783 37.0 37.0 37.0 37.0 37.0 115-119 35.7825 37.0 37.0 37.0 37.0 37.0 120-124 35.6889 37.0 37.0 37.0 37.0 37.0 125-129 35.6473 37.0 37.0 37.0 37.0 37.0 130-134 35.5593 37.0 37.0 37.0 37.0 37.0 135-139 35.454499999999996 37.0 37.0 37.0 37.0 37.0 140-144 35.5284 37.0 37.0 37.0 37.0 37.0 145-149 35.438 37.0 37.0 37.0 37.0 37.0 150-151 35.29925 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 2.0 15 0.0 16 0.0 17 0.0 18 1.0 19 0.0 20 0.0 21 1.0 22 3.0 23 3.0 24 6.0 25 5.0 26 9.0 27 9.0 28 15.0 29 24.0 30 20.0 31 46.0 32 63.0 33 115.0 34 226.0 35 612.0 36 2658.0 37 181.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.699999999999996 22.5 8.625 28.175 2 26.525 25.3 34.0 14.174999999999999 3 20.3 26.424999999999997 33.4 19.875 4 23.0 35.75 23.175 18.075 5 25.174999999999997 37.875 21.775 15.174999999999999 6 19.525000000000002 41.3 22.025 17.150000000000002 7 18.4 21.4 40.425 19.775000000000002 8 19.775000000000002 24.75 30.4 25.074999999999996 9 22.1 23.974999999999998 29.799999999999997 24.125 10-14 23.549999999999997 29.285 26.355 20.810000000000002 15-19 22.41 28.299999999999997 28.265 21.025 20-24 22.535 28.89 27.66 20.915 25-29 23.035 27.465 28.48 21.02 30-34 22.985 28.33 27.365000000000002 21.32 35-39 22.185 27.705000000000002 28.634999999999998 21.475 40-44 22.52 28.249999999999996 27.925 21.305 45-49 22.57 27.49 28.544999999999998 21.395 50-54 22.21 28.025 28.449999999999996 21.315 55-59 23.06 27.465 28.235 21.240000000000002 60-64 22.955000000000002 27.595 27.98 21.47 65-69 22.720000000000002 28.155 27.855 21.27 70-74 23.54 28.575 26.855 21.029999999999998 75-79 23.48 27.93 27.694999999999997 20.895 80-84 23.080000000000002 27.48 27.889999999999997 21.55 85-89 22.805 28.804999999999996 27.634999999999998 20.755000000000003 90-94 23.155 27.555000000000003 28.42 20.87 95-99 23.810000000000002 27.73 27.529999999999998 20.93 100-104 23.555 28.1 27.325 21.02 105-109 23.5 27.97 27.68 20.849999999999998 110-114 23.445 28.67 27.615000000000002 20.27 115-119 23.425 28.48 27.13 20.965 120-124 23.78 28.57 27.1 20.549999999999997 125-129 24.395 27.750000000000004 27.79 20.064999999999998 130-134 24.01 27.655 27.224999999999998 21.11 135-139 24.91 27.445000000000004 27.91 19.735 140-144 24.265 27.29 27.750000000000004 20.695 145-149 24.505 27.82 27.355 20.32 150-151 25.0 27.6625 27.875 19.4625 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.5 9 1.0 10 0.5 11 0.0 12 0.0 13 0.5 14 2.5 15 2.0 16 0.0 17 0.5 18 1.0 19 1.0 20 1.0 21 0.5 22 0.0 23 1.0 24 1.0 25 1.0 26 4.0 27 8.0 28 12.0 29 18.0 30 21.0 31 20.5 32 30.0 33 36.5 34 56.5 35 71.5 36 65.5 37 85.5 38 134.5 39 166.0 40 196.5 41 230.5 42 266.0 43 277.0 44 275.0 45 290.0 46 272.0 47 244.5 48 212.0 49 192.5 50 164.0 51 129.0 52 115.0 53 81.5 54 66.5 55 64.0 56 49.0 57 40.5 58 28.0 59 19.5 60 16.0 61 7.5 62 4.5 63 5.0 64 0.5 65 0.5 66 0.5 67 0.5 68 1.5 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.5 98 1.0 99 1.5 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 83.975 #Duplication Level Percentage of deduplicated Percentage of total 1 85.02530515034236 71.39999999999999 2 11.908306043465316 20.0 3 2.3221196784757367 5.8500000000000005 4 0.5954153021732659 2.0 5 0.05954153021732659 0.25 6 0.05954153021732659 0.3 7 0.0 0.0 8 0.029770765108663295 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CAGCAGCAGCAGCAGACATCTCTCAACAACCACCGCCATGGCTGAGCAGA 8 0.2 No Hit AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 6 0.15 No Hit GGTAGCTTAGTTTCATGGTAAGAAAAACGGGCTGTTTTCAGATTTGGAAA 6 0.15 No Hit GTGATTCTCTTAGAAGATCATTACCTTTGCATAATACCAAGTTAAGATTT 5 0.125 No Hit AGAACTCCTTGAATTACAGCCATGGCCACTACCCTTACCCCCTATCTATC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0125 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.025 0.0 0.0 52-53 0.025 0.0 0.025 0.0 0.0 54-55 0.025 0.0 0.025 0.0 0.0 56-57 0.025 0.0 0.025 0.0 0.0 58-59 0.037500000000000006 0.0 0.025 0.0 0.0 60-61 0.05 0.0 0.025 0.0 0.0 62-63 0.05 0.0 0.025 0.0 0.0 64-65 0.05 0.0 0.025 0.0 0.0 66-67 0.05 0.0 0.025 0.0 0.0 68-69 0.05 0.0 0.025 0.0 0.0 70-71 0.05 0.0 0.025 0.0 0.0 72-73 0.05 0.0 0.025 0.0 0.0 74-75 0.05 0.0 0.025 0.0 0.0 76-77 0.05 0.0 0.025 0.0 0.0 78-79 0.0875 0.0 0.025 0.0 0.0 80-81 0.125 0.0 0.025 0.0 0.0 82-83 0.125 0.0 0.025 0.0 0.0 84-85 0.15 0.0 0.025 0.0 0.0 86-87 0.175 0.0 0.025 0.0 0.0 88-89 0.25 0.0 0.025 0.0 0.0 90-91 0.3 0.0 0.025 0.0 0.0 92-93 0.4125 0.0 0.025 0.0 0.0 94-95 0.4875 0.0 0.025 0.0 0.0 96-97 0.525 0.0 0.025 0.0 0.0 98-99 0.7 0.0 0.025 0.0 0.0 100-101 0.7625 0.0 0.025 0.0 0.0 102-103 0.8 0.0 0.025 0.0 0.0 104-105 0.9125000000000001 0.0 0.025 0.0 0.0 106-107 1.0 0.0 0.025 0.0 0.0 108-109 1.0875 0.0 0.025 0.0 0.0 110-111 1.1875 0.0 0.025 0.0 0.0 112-113 1.25 0.0 0.025 0.0 0.0 114-115 1.3625 0.0 0.025 0.0 0.0 116-117 1.5499999999999998 0.0 0.025 0.0 0.0 118-119 1.7125 0.0 0.025 0.0 0.0 120-121 1.7625 0.0 0.025 0.0 0.0 122-123 1.7875 0.0 0.025 0.0 0.0 124-125 1.8375 0.0 0.025 0.0 0.0 126-127 1.925 0.0 0.025 0.0 0.0 128-129 2.15 0.0 0.025 0.0 0.0 130-131 2.2625 0.0 0.025 0.0 0.0 132-133 2.4 0.0 0.025 0.0 0.0 134-135 2.4375 0.0 0.025 0.0 0.0 136-137 2.5625 0.0 0.025 0.0 0.0 138-139 2.725 0.0 0.025 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCAAAA 10 0.006830828 145.0 5 AAAAGTG 10 0.006830828 145.0 8 ATAAAGC 10 0.006830828 145.0 145 GCTCTTC 10 0.006830828 145.0 1 AAAGTGT 10 0.006830828 145.0 9 >>END_MODULE Read 818173 spots for SRR12671378.sra Written 818173 spots for SRR12671378.sra Read 818173 spots for SRR12671378.sra Written 818173 spots for SRR12671378.sra Read 818173 spots for SRR12671378.sra Written 818173 spots for SRR12671378.sra Read 818173 spots for SRR12671378.sra Written 818173 spots for SRR12671378.sra Read 818173 spots for SRR12671378.sra Written 818173 spots for SRR12671378.sra Read 818173 spots for SRR12671378.sra Written 818173 spots for SRR12671378.sra Read 818173 spots for SRR12671378.sra Written 818173 spots for SRR12671378.sra Read 818173 spots for SRR12671378.sra Written 818173 spots for SRR12671378.sra Read 818173 spots for SRR12671378.sra Written 818173 spots for SRR12671378.sra Read 818173 spots for SRR12671378.sra Written 818173 spots for SRR12671378.sra Read 818173 spots for SRR12671378.sra Written 818173 spots for SRR12671378.sra Read 818173 spots for SRR12671378.sra Written 818173 spots for SRR12671378.sra Read 818173 spots for SRR12671378.sra Read 818173 spots for SRR12671378.sra Written 818173 spots for SRR12671378.sra Written 818173 spots for SRR12671378.sra Read 818173 spots for SRR12671378.sra Written 818173 spots for SRR12671378.sra Read 818178 spots for SRR12671378.sra Written 818178 spots for SRR12671378.sra Read 818173 spots for SRR12671378.sra Written 818173 spots for SRR12671378.sra Read 818173 spots for SRR12671378.sra Written 818173 spots for SRR12671378.sra Read 818173 spots for SRR12671378.sra Written 818173 spots for SRR12671378.sra Read 818173 spots for SRR12671378.sra Written 818173 spots for SRR12671378.sra SRR ids: ['SRR12671378.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_d92znx1j SRR12671378.sra spots: 16363465 blocks: [[1, 818173], [818174, 1636346], [1636347, 2454519], [2454520, 3272692], [3272693, 4090865], [4090866, 4909038], [4909039, 5727211], [5727212, 6545384], [6545385, 7363557], [7363558, 8181730], [8181731, 8999903], [8999904, 9818076], [9818077, 10636249], [10636250, 11454422], [11454423, 12272595], [12272596, 13090768], [13090769, 13908941], [13908942, 14727114], [14727115, 15545287], [15545288, 16363465]] SRR12671378 file size 5539320 SRR12671378 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671378 SRR12671378_1.fastq SRR12671378_2.fastq Input file: SRR12671378_1.fastq Paired file: SRR12671378_2.fastq trimmed: SRR12671378-trimmed-pair1.fastq, SRR12671378-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 20:57:36 2025 >> started Tue Feb 11 20:57:54 2025 >> done (17.992s) 16363465 read pairs processed; of these: 48 ( 0.00%) short read pairs filtered out after trimming by size control 1031 ( 0.01%) empty read pairs filtered out after trimming by size control 16362386 (99.99%) read pairs available; of these: 584131 ( 3.57%) trimmed read pairs available after processing 15778255 (96.43%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 9 0.00% 20 5 0.00% 21 5 0.00% 22 11 0.00% 23 5 0.00% 24 5 0.00% 25 4 0.00% 26 5 0.00% 27 6 0.00% 28 5 0.00% 29 16 0.00% 30 9 0.00% 31 17 0.00% 32 15 0.00% 33 12 0.00% 34 15 0.00% 35 16 0.00% 36 23 0.00% 37 10 0.00% 38 14 0.00% 39 27 0.00% 40 17 0.00% 41 26 0.00% 42 24 0.00% 43 24 0.00% 44 17 0.00% 45 41 0.00% 46 36 0.00% 47 41 0.00% 48 47 0.00% 49 38 0.00% 50 49 0.00% 51 79 0.00% 52 71 0.00% 53 78 0.00% 54 82 0.00% 55 83 0.00% 56 89 0.00% 57 110 0.00% 58 117 0.00% 59 134 0.00% 60 140 0.00% 61 136 0.00% 62 185 0.00% 63 190 0.00% 64 237 0.00% 65 279 0.00% 66 276 0.00% 67 328 0.00% 68 348 0.00% 69 391 0.00% 70 455 0.00% 71 514 0.00% 72 638 0.00% 73 595 0.00% 74 663 0.00% 75 782 0.00% 76 858 0.01% 77 910 0.01% 78 981 0.01% 79 1105 0.01% 80 1218 0.01% 81 1374 0.01% 82 1460 0.01% 83 1613 0.01% 84 1805 0.01% 85 1877 0.01% 86 2133 0.01% 87 2105 0.01% 88 2347 0.01% 89 2364 0.01% 90 2499 0.02% 91 2650 0.02% 92 2882 0.02% 93 2965 0.02% 94 3169 0.02% 95 3442 0.02% 96 3555 0.02% 97 3750 0.02% 98 3902 0.02% 99 4088 0.02% 100 4286 0.03% 101 4437 0.03% 102 4715 0.03% 103 4767 0.03% 104 4876 0.03% 105 5296 0.03% 106 5453 0.03% 107 5801 0.04% 108 5891 0.04% 109 6016 0.04% 110 6175 0.04% 111 6349 0.04% 112 6569 0.04% 113 6759 0.04% 114 6726 0.04% 115 7160 0.04% 116 7465 0.05% 117 7820 0.05% 118 7992 0.05% 119 8195 0.05% 120 8441 0.05% 121 8766 0.05% 122 8798 0.05% 123 9142 0.06% 124 9411 0.06% 125 9655 0.06% 126 10095 0.06% 127 10389 0.06% 128 10575 0.06% 129 10894 0.07% 130 11232 0.07% 131 11396 0.07% 132 11541 0.07% 133 11938 0.07% 134 12052 0.07% 135 12578 0.08% 136 12822 0.08% 137 13476 0.08% 138 13692 0.08% 139 14117 0.09% 140 14349 0.09% 141 14632 0.09% 142 15245 0.09% 143 15204 0.09% 144 15723 0.10% 145 15976 0.10% 146 16587 0.10% 147 16880 0.10% 148 17312 0.11% 149 17530 0.11% 150 18283 0.11% 151 15778255 96.43% 16362386 reads passed initial QC criterion=sequence-density sequence-density=0.58 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=23 prefix-density=0.59 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.12 sequence-density-rank=18 fanout-score=11.15 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=5.7 sequence=CCATCCACATTAGCACCATATTTGTCGACATATTGGTACAC criterion=sequence-density sequence-density=0.68 sequence-density-rank=1 fanout-score=2.08 fanout-score-rank=25 prefix-density=0.68 prefix-fanout=2.1 sequence=CCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=23.93 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=2.3 sequence=GGAACTCAAACGCATAGCTTCCTACAAATACCCCAGCTAGCCAATACTCTCCACCACTAAACCCAAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTC SRR12671378 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 20:58:38 Started mapping on | Feb 11 20:58:38 Finished on | Feb 11 21:00:28 Mapping speed, Million of reads per hour | 535.50 Number of input reads | 16362386 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 15379932 Uniquely mapped reads % | 94.00% Average mapped length | 298.77 Number of splices: Total | 15825716 Number of splices: Annotated (sjdb) | 15507361 Number of splices: GT/AG | 15507249 Number of splices: GC/AG | 264551 Number of splices: AT/AC | 8742 Number of splices: Non-canonical | 45174 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.84 Insertion rate per base | 0.02% Insertion average length | 2.21 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 343248 % of reads mapped to multiple loci | 2.10% Number of reads mapped to too many loci | 35886 % of reads mapped to too many loci | 0.22% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.60% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 639206 639206 639206 N_multimapping 343248 343248 343248 N_noFeature 582687 15144434 658956 N_ambiguous 260982 981 101310 UnstrandedReadsAssigned:14536263 PositiveStrandReadsAssigned:234517 NegativeStrandReadsAssigned:14619666 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671378 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671378-trimmed-pair1.fastq SRR12671378-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,362,386 reads, 14,555,652 reads pseudoaligned [quant] estimated average fragment length: 313.819 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,070 rounds 52401 SRR12671378.ke.tsv 34699 SRR12671378.se.tsv 87100 total ==> SRR12671378.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1705.18 603 22.96 Potri.005G024800.1.v4.1 1035 722.181 186 16.7221 Potri.004G059700.1.v4.1 961 648.492 0 0 Potri.007G009000.2.v4.1 1416 1103.18 0 0 Potri.003G141000.2.v4.1 2943 2630.18 934 23.0561 Potri.016G087400.1.v4.1 270 67.3519 500 481.997 Potri.015G069301.1.v4.1 564 273.672 0 0 Potri.010G195200.1.v4.1 1773 1460.18 39 1.73413 Potri.012G127500.1.v4.1 977 664.369 73 7.13408 ==> SRR12671378.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 82 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 170 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 5 SRR12671378 completed mapping pipeline successfully